Incidental Mutation 'R2011:Fat2'
ID219750
Institutional Source Beutler Lab
Gene Symbol Fat2
Ensembl Gene ENSMUSG00000055333
Gene NameFAT atypical cadherin 2
SynonymsmKIAA0811, LOC245827, Fath2, EMI2
MMRRC Submission 040020-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2011 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location55250609-55336564 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 55282757 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 2377 (P2377S)
Ref Sequence ENSEMBL: ENSMUSP00000104492 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068853] [ENSMUST00000108864]
Predicted Effect probably damaging
Transcript: ENSMUST00000068853
AA Change: P2377S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000067556
Gene: ENSMUSG00000055333
AA Change: P2377S

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
CA 55 146 3.65e-4 SMART
CA 170 254 3.99e-10 SMART
low complexity region 337 348 N/A INTRINSIC
CA 384 456 5.11e-8 SMART
CA 480 562 2.71e-21 SMART
CA 586 664 1.12e-2 SMART
CA 737 818 1.69e-22 SMART
CA 842 923 9.59e-22 SMART
CA 947 1028 7.39e-14 SMART
CA 1054 1135 3.74e-24 SMART
CA 1159 1240 1.84e-23 SMART
CA 1266 1342 8.9e-8 SMART
CA 1368 1446 7.4e-5 SMART
CA 1470 1553 1.98e-14 SMART
CA 1577 1658 6.84e-18 SMART
CA 1682 1756 2.76e-13 SMART
CA 1787 1870 1.49e-18 SMART
CA 1894 1966 1.11e-1 SMART
CA 1990 2068 2.4e-13 SMART
CA 2092 2171 3.42e-18 SMART
CA 2190 2270 1.9e-16 SMART
CA 2294 2377 1.49e-27 SMART
CA 2401 2479 8.31e-8 SMART
CA 2503 2583 6.48e-19 SMART
CA 2607 2690 1.53e-6 SMART
CA 2714 2797 3e-14 SMART
CA 2821 2906 5.85e-26 SMART
CA 2930 3011 4.58e-19 SMART
CA 3035 3113 2.1e-27 SMART
CA 3137 3218 9.67e-18 SMART
CA 3243 3321 1.92e-12 SMART
CA 3345 3426 4.04e-29 SMART
CA 3450 3531 1.79e-12 SMART
CA 3555 3629 9.3e-2 SMART
LamG 3794 3923 1.77e-28 SMART
EGF 3952 3986 6.5e-5 SMART
EGF 3991 4024 1.6e-4 SMART
transmembrane domain 4051 4073 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108864
AA Change: P2377S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104492
Gene: ENSMUSG00000055333
AA Change: P2377S

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
CA 55 146 3.65e-4 SMART
CA 170 254 3.99e-10 SMART
low complexity region 337 348 N/A INTRINSIC
CA 384 456 5.11e-8 SMART
CA 480 562 2.71e-21 SMART
CA 586 664 1.12e-2 SMART
CA 737 818 1.69e-22 SMART
CA 842 923 9.59e-22 SMART
CA 947 1028 7.39e-14 SMART
CA 1054 1135 3.74e-24 SMART
CA 1159 1240 1.84e-23 SMART
CA 1266 1342 8.9e-8 SMART
CA 1368 1446 7.4e-5 SMART
CA 1470 1553 1.98e-14 SMART
CA 1577 1658 6.84e-18 SMART
CA 1682 1756 2.76e-13 SMART
CA 1787 1870 1.49e-18 SMART
CA 1894 1966 1.11e-1 SMART
CA 1990 2068 2.4e-13 SMART
CA 2092 2171 3.42e-18 SMART
CA 2190 2270 1.9e-16 SMART
CA 2294 2377 1.49e-27 SMART
CA 2401 2479 8.31e-8 SMART
CA 2503 2583 6.48e-19 SMART
CA 2607 2690 1.53e-6 SMART
CA 2714 2797 3e-14 SMART
CA 2821 2906 5.85e-26 SMART
CA 2930 3011 4.58e-19 SMART
CA 3035 3113 2.1e-27 SMART
CA 3137 3218 9.67e-18 SMART
CA 3243 3321 1.92e-12 SMART
CA 3345 3426 4.04e-29 SMART
CA 3450 3531 1.79e-12 SMART
CA 3555 3629 9.3e-2 SMART
LamG 3794 3923 1.77e-28 SMART
EGF 3952 3986 6.5e-5 SMART
EGF 3991 4024 1.6e-4 SMART
transmembrane domain 4051 4073 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is the second identified human homolog of the Drosophila fat gene, which encodes a tumor suppressor essential for controlling cell proliferation during Drosophila development. The gene product is a member of the cadherin superfamily, a group of integral membrane proteins characterized by the presence of cadherin-type repeats. In addition to containing 34 tandem cadherin-type repeats, the gene product has two epidermal growth factor (EGF)-like repeats and one laminin G domain. This protein most likely functions as a cell adhesion molecule, controlling cell proliferation and playing an important role in cerebellum development. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are healthy, fertile and overtly normal, with no apparent defects in the development of red blood cells or platelets. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 107 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430F08Rik T G 10: 100,583,958 D58A probably damaging Het
Abhd6 A T 14: 8,042,742 T100S probably benign Het
Adam6a T C 12: 113,545,378 I457T probably benign Het
Aff3 T C 1: 38,207,915 N863S probably benign Het
Agk C A 6: 40,376,234 D177E probably benign Het
Alg9 C T 9: 50,788,200 A209V probably damaging Het
Arl6 A T 16: 59,624,313 I51K probably damaging Het
Bpi A T 2: 158,261,352 H89L probably damaging Het
C1qtnf1 T A 11: 118,448,284 F260Y probably benign Het
Cblc T A 7: 19,784,822 D452V probably benign Het
Ccar1 T C 10: 62,776,694 T231A probably benign Het
Ccdc112 A G 18: 46,287,432 L417P probably damaging Het
Ccdc144b A T 3: 36,010,678 C515* probably null Het
Ccdc34 G A 2: 110,044,304 R336Q possibly damaging Het
CK137956 A G 4: 127,951,036 S305P probably benign Het
Clip2 T C 5: 134,503,115 D612G probably damaging Het
Col28a1 T C 6: 8,059,360 T692A probably benign Het
Copg2 A T 6: 30,816,741 probably null Het
Ctnna2 T A 6: 76,973,791 I566F possibly damaging Het
Cux2 C T 5: 121,861,326 D1184N probably benign Het
Dclk3 A G 9: 111,468,354 E322G probably benign Het
Ddx41 A T 13: 55,534,093 probably null Het
Dnaaf2 G A 12: 69,196,785 P107S probably damaging Het
Eif2ak4 A G 2: 118,430,947 E578G probably damaging Het
Exd1 A G 2: 119,528,663 probably benign Het
Fbxl18 T C 5: 142,872,459 T741A probably benign Het
Fgr C A 4: 132,997,521 A311E probably damaging Het
Fmo4 T C 1: 162,798,889 T363A probably damaging Het
Fsbp T C 4: 11,584,006 V235A probably benign Het
Gm1110 T A 9: 26,894,258 H366L probably benign Het
Gm43302 T C 5: 105,290,980 N14S probably damaging Het
Gm5422 A G 10: 31,248,768 noncoding transcript Het
Gpr21 A G 2: 37,517,535 E31G probably damaging Het
Gucy1b2 G T 14: 62,408,758 N560K probably damaging Het
Hmcn1 T C 1: 150,677,334 Q2535R probably benign Het
Hnrnpm A T 17: 33,664,624 N264K probably damaging Het
Hyal6 A T 6: 24,734,724 I219L possibly damaging Het
Ifi211 A G 1: 173,907,603 S87P probably damaging Het
Il17rb A T 14: 29,996,840 C428* probably null Het
Iqca T C 1: 90,045,626 N808S probably benign Het
Kcnu1 A G 8: 25,918,442 I94V probably benign Het
Lrba A T 3: 86,310,017 E517V probably damaging Het
Mcidas A G 13: 112,993,981 E37G possibly damaging Het
Med23 T A 10: 24,879,755 F83L possibly damaging Het
Micu2 T C 14: 57,954,133 probably null Het
Mrgprx2 A T 7: 48,482,534 C179S probably damaging Het
Myo6 A G 9: 80,307,722 T1236A probably damaging Het
Myo7a A T 7: 98,054,708 V1946E possibly damaging Het
Nek10 A T 14: 14,885,122 Y695F probably damaging Het
Nr3c2 A T 8: 76,909,793 I508F possibly damaging Het
Olfr1056 A T 2: 86,356,186 H65Q possibly damaging Het
Olfr1133 A T 2: 87,645,889 I78N probably damaging Het
Olfr12 T C 1: 92,620,749 V281A probably benign Het
Olfr307 A T 7: 86,335,747 Y216* probably null Het
Olfr695 T C 7: 106,873,427 I273V probably benign Het
Olfr743 T C 14: 50,533,684 S91P probably damaging Het
Oxct1 T C 15: 4,153,761 S485P probably benign Het
Oxt A G 2: 130,576,652 D61G probably damaging Het
P2ry10 A C X: 107,102,635 I59L probably damaging Het
Parp11 A G 6: 127,477,891 N124S probably benign Het
Pcdh7 T A 5: 57,719,629 N175K probably damaging Het
Pdgfrb T A 18: 61,061,494 S114R probably benign Het
Pfdn5 A G 15: 102,326,521 N54S possibly damaging Het
Phc2 T A 4: 128,723,585 V468E probably benign Het
Piezo2 T C 18: 63,059,744 T1605A probably damaging Het
Pik3cb A T 9: 99,105,579 Y35* probably null Het
Piwil2 A T 14: 70,426,634 M22K probably damaging Het
Plag1 A G 4: 3,904,889 F101L probably damaging Het
Pomt2 A G 12: 87,111,399 L680P possibly damaging Het
Ppp1r36 A G 12: 76,418,926 probably null Het
Prkag2 C T 5: 24,871,054 probably null Het
Prkg1 T C 19: 31,664,142 D47G possibly damaging Het
Prl6a1 G A 13: 27,315,369 G45D probably benign Het
Rbm20 G A 19: 53,859,428 C1135Y probably damaging Het
Recql5 A T 11: 115,897,097 N465K probably benign Het
Rtcb A T 10: 85,941,933 I459N probably damaging Het
Rtp3 A T 9: 110,986,034 probably benign Het
Rundc3b T A 5: 8,512,409 probably null Het
Scube3 A G 17: 28,168,158 T877A probably damaging Het
Sh2d4a A T 8: 68,346,742 Q421L probably benign Het
Siglec1 A T 2: 131,083,357 Y395N probably damaging Het
Slc6a1 G T 6: 114,307,770 G263V probably damaging Het
Slco1c1 T A 6: 141,555,107 F437L probably benign Het
Slco3a1 G A 7: 74,346,671 A329V probably benign Het
Spag9 T A 11: 94,092,375 L504* probably null Het
Spen A T 4: 141,473,329 N2662K probably damaging Het
Sptb G C 12: 76,632,472 R70G possibly damaging Het
Stk3 A G 15: 35,072,498 S136P probably damaging Het
Synj1 A T 16: 90,938,696 F1456L probably damaging Het
Tbx5 T C 5: 119,841,906 probably null Het
Tchh G A 3: 93,446,961 R1236Q unknown Het
Timd4 C A 11: 46,820,030 T253K possibly damaging Het
Tmc6 A G 11: 117,769,406 Y669H probably damaging Het
Tmem151a C T 19: 5,082,938 R80H probably benign Het
Tpgs1 T C 10: 79,675,888 L288P probably damaging Het
Trhde T C 10: 114,498,793 I659V probably benign Het
Trpm7 A T 2: 126,823,997 Y896* probably null Het
Ttc5 C A 14: 50,781,550 E37* probably null Het
Uvrag A G 7: 98,939,889 probably null Het
Vmn1r59 T A 7: 5,454,284 D159V probably damaging Het
Vmn2r78 G A 7: 86,955,079 V822M possibly damaging Het
Vnn1 C A 10: 23,894,971 Y32* probably null Het
Wrn A G 8: 33,236,404 V1380A probably benign Het
Zc3h14 A C 12: 98,780,268 S579R possibly damaging Het
Zfp277 G A 12: 40,317,218 Q480* probably null Het
Zfp456 G A 13: 67,366,874 Q238* probably null Het
Zranb3 T A 1: 128,091,901 T35S probably benign Het
Other mutations in Fat2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00720:Fat2 APN 11 55311244 missense probably benign
IGL00897:Fat2 APN 11 55289252 missense probably damaging 0.99
IGL01161:Fat2 APN 11 55284191 missense probably benign
IGL01306:Fat2 APN 11 55310872 missense probably benign 0.28
IGL01393:Fat2 APN 11 55269309 missense probably benign 0.00
IGL01529:Fat2 APN 11 55282156 missense probably damaging 1.00
IGL01530:Fat2 APN 11 55283387 missense probably benign 0.42
IGL01555:Fat2 APN 11 55278930 missense probably damaging 0.99
IGL01758:Fat2 APN 11 55296209 missense probably damaging 1.00
IGL01768:Fat2 APN 11 55262568 missense probably damaging 1.00
IGL01939:Fat2 APN 11 55283980 missense probably benign 0.01
IGL01941:Fat2 APN 11 55312005 missense probably benign 0.01
IGL01967:Fat2 APN 11 55311823 missense probably damaging 1.00
IGL01978:Fat2 APN 11 55270146 missense probably benign 0.34
IGL01998:Fat2 APN 11 55296195 missense probably benign 0.00
IGL02001:Fat2 APN 11 55312245 start codon destroyed probably null 0.89
IGL02004:Fat2 APN 11 55282840 missense probably damaging 1.00
IGL02103:Fat2 APN 11 55289296 missense probably damaging 0.96
IGL02131:Fat2 APN 11 55309042 missense probably damaging 1.00
IGL02155:Fat2 APN 11 55262419 missense probably benign 0.00
IGL02223:Fat2 APN 11 55273129 missense probably benign 0.01
IGL02231:Fat2 APN 11 55281092 missense probably damaging 0.98
IGL02312:Fat2 APN 11 55270259 missense probably damaging 1.00
IGL02476:Fat2 APN 11 55311124 missense probably damaging 1.00
IGL02539:Fat2 APN 11 55281793 missense probably damaging 1.00
IGL02553:Fat2 APN 11 55311283 missense probably damaging 1.00
IGL02645:Fat2 APN 11 55282828 missense probably damaging 1.00
IGL02664:Fat2 APN 11 55311096 missense probably damaging 1.00
IGL02708:Fat2 APN 11 55282385 missense probably damaging 0.99
IGL02883:Fat2 APN 11 55256618 missense probably benign 0.16
IGL02894:Fat2 APN 11 55256653 missense probably damaging 1.00
IGL02975:Fat2 APN 11 55270194 missense probably benign 0.00
IGL03085:Fat2 APN 11 55283246 missense probably benign 0.09
IGL03106:Fat2 APN 11 55311901 missense probably benign 0.45
IGL03132:Fat2 APN 11 55253920 missense probably benign 0.25
IGL03133:Fat2 APN 11 55286043 missense probably benign 0.01
IGL03194:Fat2 APN 11 55310995 missense probably benign 0.02
IGL03266:Fat2 APN 11 55284029 missense possibly damaging 0.62
IGL03290:Fat2 APN 11 55256219 missense probably benign 0.33
IGL03291:Fat2 APN 11 55262595 missense probably benign
IGL03325:Fat2 APN 11 55282342 missense probably damaging 1.00
IGL03345:Fat2 APN 11 55282361 missense probably damaging 1.00
IGL03371:Fat2 APN 11 55311164 missense probably benign 0.10
ANU23:Fat2 UTSW 11 55310872 missense probably benign 0.28
BB001:Fat2 UTSW 11 55262787 missense probably benign 0.03
BB011:Fat2 UTSW 11 55262787 missense probably benign 0.03
P0040:Fat2 UTSW 11 55282213 missense possibly damaging 0.89
PIT4504001:Fat2 UTSW 11 55256110 missense possibly damaging 0.68
R0008:Fat2 UTSW 11 55311249 missense probably damaging 1.00
R0008:Fat2 UTSW 11 55311249 missense probably damaging 1.00
R0012:Fat2 UTSW 11 55262871 missense probably benign 0.16
R0012:Fat2 UTSW 11 55262871 missense probably benign 0.16
R0048:Fat2 UTSW 11 55310039 missense probably benign 0.00
R0048:Fat2 UTSW 11 55310039 missense probably benign 0.00
R0098:Fat2 UTSW 11 55298605 missense probably damaging 0.98
R0124:Fat2 UTSW 11 55283678 missense probably damaging 0.98
R0127:Fat2 UTSW 11 55289286 missense probably benign 0.01
R0130:Fat2 UTSW 11 55252118 missense probably benign 0.26
R0131:Fat2 UTSW 11 55273211 missense probably benign
R0158:Fat2 UTSW 11 55296185 missense probably benign 0.00
R0184:Fat2 UTSW 11 55296288 missense probably damaging 1.00
R0367:Fat2 UTSW 11 55292093 splice site probably benign
R0384:Fat2 UTSW 11 55269465 missense possibly damaging 0.81
R0390:Fat2 UTSW 11 55310777 missense probably damaging 0.99
R0403:Fat2 UTSW 11 55270349 missense probably benign 0.42
R0416:Fat2 UTSW 11 55284134 missense possibly damaging 0.94
R0437:Fat2 UTSW 11 55282799 missense probably benign 0.02
R0463:Fat2 UTSW 11 55262829 missense probably damaging 1.00
R0497:Fat2 UTSW 11 55283402 missense probably benign 0.03
R0617:Fat2 UTSW 11 55311843 missense possibly damaging 0.60
R0622:Fat2 UTSW 11 55283128 missense probably damaging 1.00
R0675:Fat2 UTSW 11 55309209 missense probably damaging 0.97
R0811:Fat2 UTSW 11 55253633 missense possibly damaging 0.75
R0812:Fat2 UTSW 11 55253633 missense possibly damaging 0.75
R0869:Fat2 UTSW 11 55311775 missense probably benign 0.08
R0870:Fat2 UTSW 11 55311775 missense probably benign 0.08
R0899:Fat2 UTSW 11 55256225 missense probably damaging 1.00
R1278:Fat2 UTSW 11 55268179 missense probably damaging 1.00
R1383:Fat2 UTSW 11 55310773 missense probably benign
R1428:Fat2 UTSW 11 55296087 missense probably damaging 1.00
R1438:Fat2 UTSW 11 55287811 missense probably damaging 1.00
R1495:Fat2 UTSW 11 55262673 missense probably benign
R1506:Fat2 UTSW 11 55284264 missense probably benign
R1547:Fat2 UTSW 11 55252255 missense probably benign 0.01
R1554:Fat2 UTSW 11 55253664 missense probably benign 0.01
R1562:Fat2 UTSW 11 55309974 missense probably damaging 1.00
R1588:Fat2 UTSW 11 55283404 missense probably damaging 1.00
R1592:Fat2 UTSW 11 55291870 splice site probably null
R1601:Fat2 UTSW 11 55282010 missense probably benign 0.01
R1610:Fat2 UTSW 11 55278924 missense probably damaging 1.00
R1634:Fat2 UTSW 11 55267684 missense probably damaging 1.00
R1634:Fat2 UTSW 11 55284719 missense probably benign
R1644:Fat2 UTSW 11 55287783 missense possibly damaging 0.91
R1644:Fat2 UTSW 11 55296181 missense possibly damaging 0.94
R1691:Fat2 UTSW 11 55311852 missense probably damaging 0.99
R1734:Fat2 UTSW 11 55281371 missense probably benign 0.00
R1748:Fat2 UTSW 11 55256647 missense probably damaging 0.97
R1771:Fat2 UTSW 11 55310865 missense probably benign 0.01
R1800:Fat2 UTSW 11 55283892 missense probably damaging 1.00
R1807:Fat2 UTSW 11 55289259 missense probably damaging 1.00
R1823:Fat2 UTSW 11 55256780 missense probably benign 0.29
R1848:Fat2 UTSW 11 55311558 missense probably damaging 1.00
R1866:Fat2 UTSW 11 55292014 missense probably benign 0.00
R1899:Fat2 UTSW 11 55262178 missense probably benign
R1954:Fat2 UTSW 11 55311084 missense probably benign 0.06
R2010:Fat2 UTSW 11 55253827 missense probably damaging 0.99
R2057:Fat2 UTSW 11 55281860 missense possibly damaging 0.60
R2081:Fat2 UTSW 11 55309677 missense possibly damaging 0.94
R2106:Fat2 UTSW 11 55256564 missense probably benign 0.00
R2165:Fat2 UTSW 11 55303716 missense probably benign 0.00
R2176:Fat2 UTSW 11 55267575 critical splice donor site probably null
R2284:Fat2 UTSW 11 55282360 missense probably damaging 1.00
R2338:Fat2 UTSW 11 55311901 missense possibly damaging 0.93
R2340:Fat2 UTSW 11 55270096 missense possibly damaging 0.90
R2427:Fat2 UTSW 11 55310812 missense probably benign 0.15
R2444:Fat2 UTSW 11 55281973 missense probably damaging 1.00
R2858:Fat2 UTSW 11 55283773 missense possibly damaging 0.94
R2882:Fat2 UTSW 11 55311305 missense probably damaging 0.96
R3029:Fat2 UTSW 11 55284709 missense probably damaging 1.00
R3085:Fat2 UTSW 11 55252171 missense possibly damaging 0.79
R3121:Fat2 UTSW 11 55311796 missense probably damaging 1.00
R3418:Fat2 UTSW 11 55278998 missense probably benign 0.01
R3500:Fat2 UTSW 11 55260516 missense probably damaging 0.99
R3607:Fat2 UTSW 11 55281685 missense probably damaging 1.00
R3611:Fat2 UTSW 11 55312069 missense probably benign
R3620:Fat2 UTSW 11 55256695 missense probably damaging 0.97
R3688:Fat2 UTSW 11 55281101 missense probably damaging 0.99
R3704:Fat2 UTSW 11 55309650 missense probably damaging 1.00
R3784:Fat2 UTSW 11 55256186 missense probably benign
R3889:Fat2 UTSW 11 55281763 missense probably damaging 1.00
R3951:Fat2 UTSW 11 55296382 missense probably benign 0.00
R4211:Fat2 UTSW 11 55283984 missense probably damaging 1.00
R4249:Fat2 UTSW 11 55284301 missense probably damaging 0.98
R4406:Fat2 UTSW 11 55262268 missense probably benign 0.00
R4433:Fat2 UTSW 11 55309640 missense possibly damaging 0.91
R4436:Fat2 UTSW 11 55296198 missense probably damaging 1.00
R4498:Fat2 UTSW 11 55270097 missense possibly damaging 0.90
R4560:Fat2 UTSW 11 55265951 missense possibly damaging 0.89
R4594:Fat2 UTSW 11 55284752 missense possibly damaging 0.78
R4663:Fat2 UTSW 11 55296213 nonsense probably null
R4669:Fat2 UTSW 11 55311615 missense probably benign 0.01
R4696:Fat2 UTSW 11 55285015 missense probably benign 0.00
R4734:Fat2 UTSW 11 55311468 missense probably benign 0.01
R4749:Fat2 UTSW 11 55311468 missense probably benign 0.01
R4765:Fat2 UTSW 11 55281187 missense probably damaging 1.00
R4803:Fat2 UTSW 11 55285060 missense probably benign 0.03
R4805:Fat2 UTSW 11 55283979 missense probably benign 0.01
R4822:Fat2 UTSW 11 55311318 missense probably benign 0.02
R4840:Fat2 UTSW 11 55279018 missense probably benign 0.21
R4849:Fat2 UTSW 11 55310637 missense probably damaging 1.00
R4943:Fat2 UTSW 11 55279033 missense probably benign 0.00
R4993:Fat2 UTSW 11 55283092 missense probably damaging 0.99
R5097:Fat2 UTSW 11 55310704 missense probably damaging 1.00
R5104:Fat2 UTSW 11 55278988 missense possibly damaging 0.93
R5115:Fat2 UTSW 11 55296333 missense probably damaging 1.00
R5213:Fat2 UTSW 11 55253832 missense probably benign 0.00
R5254:Fat2 UTSW 11 55281175 missense probably damaging 1.00
R5269:Fat2 UTSW 11 55287878 missense probably benign 0.00
R5288:Fat2 UTSW 11 55267656 missense probably benign 0.00
R5355:Fat2 UTSW 11 55282166 missense probably damaging 1.00
R5375:Fat2 UTSW 11 55262820 missense probably benign 0.00
R5379:Fat2 UTSW 11 55303941 missense probably damaging 0.99
R5411:Fat2 UTSW 11 55252226 missense probably benign 0.23
R5416:Fat2 UTSW 11 55303688 missense possibly damaging 0.77
R5480:Fat2 UTSW 11 55310086 missense probably damaging 0.99
R5486:Fat2 UTSW 11 55253681 missense probably benign 0.00
R5526:Fat2 UTSW 11 55269361 missense possibly damaging 0.90
R5532:Fat2 UTSW 11 55262337 missense probably damaging 1.00
R5583:Fat2 UTSW 11 55253889 missense probably benign 0.00
R5588:Fat2 UTSW 11 55282277 missense probably damaging 1.00
R5598:Fat2 UTSW 11 55281130 missense probably damaging 1.00
R5636:Fat2 UTSW 11 55282481 missense probably damaging 1.00
R5653:Fat2 UTSW 11 55310316 missense probably damaging 1.00
R5657:Fat2 UTSW 11 55310681 nonsense probably null
R5660:Fat2 UTSW 11 55284176 missense probably benign 0.00
R5752:Fat2 UTSW 11 55289237 missense possibly damaging 0.48
R5757:Fat2 UTSW 11 55252346 missense probably damaging 1.00
R5792:Fat2 UTSW 11 55262325 missense possibly damaging 0.77
R5872:Fat2 UTSW 11 55270382 missense probably damaging 1.00
R5933:Fat2 UTSW 11 55284051 missense probably damaging 1.00
R6030:Fat2 UTSW 11 55310303 nonsense probably null
R6030:Fat2 UTSW 11 55310303 nonsense probably null
R6032:Fat2 UTSW 11 55253934 missense probably damaging 1.00
R6032:Fat2 UTSW 11 55253934 missense probably damaging 1.00
R6221:Fat2 UTSW 11 55296072 critical splice donor site probably null
R6253:Fat2 UTSW 11 55296271 missense probably damaging 1.00
R6257:Fat2 UTSW 11 55262581 missense probably benign
R6307:Fat2 UTSW 11 55281280 missense possibly damaging 0.63
R6450:Fat2 UTSW 11 55289310 missense probably damaging 0.97
R6453:Fat2 UTSW 11 55282216 missense probably benign 0.29
R6455:Fat2 UTSW 11 55270457 missense probably damaging 0.96
R6483:Fat2 UTSW 11 55296345 missense probably damaging 1.00
R6504:Fat2 UTSW 11 55262397 missense probably benign 0.00
R6520:Fat2 UTSW 11 55284988 missense probably damaging 0.99
R6525:Fat2 UTSW 11 55283800 missense probably damaging 1.00
R6617:Fat2 UTSW 11 55296105 missense probably benign 0.01
R6652:Fat2 UTSW 11 55252262 missense probably benign
R6679:Fat2 UTSW 11 55309305 missense probably damaging 1.00
R6680:Fat2 UTSW 11 55310858 nonsense probably null
R6762:Fat2 UTSW 11 55253482 splice site probably null
R6810:Fat2 UTSW 11 55282241 missense possibly damaging 0.88
R6818:Fat2 UTSW 11 55309341 missense probably benign 0.31
R6919:Fat2 UTSW 11 55282771 missense possibly damaging 0.68
R6939:Fat2 UTSW 11 55252474 nonsense probably null
R6941:Fat2 UTSW 11 55262088 missense probably benign
R7023:Fat2 UTSW 11 55310502 missense probably benign 0.00
R7027:Fat2 UTSW 11 55269433 missense probably benign 0.03
R7027:Fat2 UTSW 11 55281851 nonsense probably null
R7095:Fat2 UTSW 11 55311331 missense probably damaging 1.00
R7102:Fat2 UTSW 11 55283434 missense probably damaging 1.00
R7116:Fat2 UTSW 11 55282336 missense probably damaging 1.00
R7117:Fat2 UTSW 11 55281262 missense probably damaging 1.00
R7167:Fat2 UTSW 11 55285001 missense possibly damaging 0.48
R7213:Fat2 UTSW 11 55281045 nonsense probably null
R7246:Fat2 UTSW 11 55296382 missense probably benign 0.00
R7252:Fat2 UTSW 11 55311262 missense probably damaging 0.98
R7266:Fat2 UTSW 11 55285030 missense probably damaging 0.99
R7316:Fat2 UTSW 11 55286067 missense probably damaging 1.00
R7326:Fat2 UTSW 11 55282304 missense probably damaging 0.99
R7355:Fat2 UTSW 11 55256551 missense probably benign 0.00
R7431:Fat2 UTSW 11 55309101 missense probably damaging 1.00
R7459:Fat2 UTSW 11 55303919 missense probably damaging 1.00
R7460:Fat2 UTSW 11 55278963 missense probably damaging 1.00
R7466:Fat2 UTSW 11 55310432 missense probably damaging 1.00
R7475:Fat2 UTSW 11 55303653 missense probably benign 0.31
R7678:Fat2 UTSW 11 55282330 missense probably damaging 0.99
R7689:Fat2 UTSW 11 55309840 missense probably damaging 1.00
R7704:Fat2 UTSW 11 55284347 missense probably benign 0.03
R7710:Fat2 UTSW 11 55310763 missense probably benign 0.35
R7724:Fat2 UTSW 11 55284796 missense probably damaging 1.00
R7731:Fat2 UTSW 11 55310706 missense probably damaging 1.00
R7739:Fat2 UTSW 11 55281131 nonsense probably null
R7757:Fat2 UTSW 11 55311421 missense probably benign 0.00
R7876:Fat2 UTSW 11 55311220 missense probably benign 0.01
R7883:Fat2 UTSW 11 55253364 splice site probably null
R7924:Fat2 UTSW 11 55262787 missense probably benign 0.03
R7936:Fat2 UTSW 11 55310167 missense probably benign
R7936:Fat2 UTSW 11 55311160 nonsense probably null
R7938:Fat2 UTSW 11 55273096 missense probably damaging 1.00
R7947:Fat2 UTSW 11 55287734 missense probably damaging 1.00
R8049:Fat2 UTSW 11 55312066 missense probably benign 0.13
R8094:Fat2 UTSW 11 55296139 missense probably benign 0.06
R8157:Fat2 UTSW 11 55252084 missense possibly damaging 0.90
R8170:Fat2 UTSW 11 55270455 missense probably damaging 1.00
R8172:Fat2 UTSW 11 55287812 missense probably damaging 1.00
R8182:Fat2 UTSW 11 55284397 missense possibly damaging 0.51
R8188:Fat2 UTSW 11 55273171 missense probably damaging 0.98
R8204:Fat2 UTSW 11 55284610 missense probably benign 0.02
R8211:Fat2 UTSW 11 55312209 missense possibly damaging 0.92
R8255:Fat2 UTSW 11 55270275 missense probably benign 0.19
R8263:Fat2 UTSW 11 55284136 missense probably benign
R8269:Fat2 UTSW 11 55282709 missense possibly damaging 0.48
R8443:Fat2 UTSW 11 55311709 missense probably damaging 1.00
R8465:Fat2 UTSW 11 55256704 missense possibly damaging 0.61
R8480:Fat2 UTSW 11 55282968 missense possibly damaging 0.61
R8511:Fat2 UTSW 11 55309237 missense probably damaging 0.99
R8680:Fat2 UTSW 11 55253866 missense probably benign
R8704:Fat2 UTSW 11 55281311 missense probably damaging 1.00
R8711:Fat2 UTSW 11 55268303 missense probably benign 0.22
R8724:Fat2 UTSW 11 55282960 missense probably damaging 1.00
R8788:Fat2 UTSW 11 55281103 missense possibly damaging 0.90
R8802:Fat2 UTSW 11 55282924 missense possibly damaging 0.95
R8902:Fat2 UTSW 11 55310070 missense probably damaging 1.00
R8940:Fat2 UTSW 11 55256810 missense possibly damaging 0.48
R8956:Fat2 UTSW 11 55282903 missense probably damaging 1.00
X0010:Fat2 UTSW 11 55252260 missense probably benign 0.00
X0011:Fat2 UTSW 11 55310431 missense probably damaging 0.98
X0018:Fat2 UTSW 11 55296210 missense probably damaging 1.00
X0028:Fat2 UTSW 11 55309414 missense possibly damaging 0.84
X0067:Fat2 UTSW 11 55283234 missense possibly damaging 0.48
Z1176:Fat2 UTSW 11 55282795 missense probably damaging 1.00
Z1176:Fat2 UTSW 11 55284991 missense probably damaging 1.00
Z1176:Fat2 UTSW 11 55303700 missense probably damaging 1.00
Z1176:Fat2 UTSW 11 55310121 missense probably damaging 0.96
Z1177:Fat2 UTSW 11 55278966 nonsense probably null
Z1186:Fat2 UTSW 11 55308970 frame shift probably null
Z1186:Fat2 UTSW 11 55309799 missense probably benign
Z1187:Fat2 UTSW 11 55308970 frame shift probably null
Z1187:Fat2 UTSW 11 55309799 missense probably benign
Z1188:Fat2 UTSW 11 55308970 frame shift probably null
Z1188:Fat2 UTSW 11 55309799 missense probably benign
Z1189:Fat2 UTSW 11 55308970 frame shift probably null
Z1189:Fat2 UTSW 11 55309799 missense probably benign
Z1190:Fat2 UTSW 11 55308970 frame shift probably null
Z1190:Fat2 UTSW 11 55309799 missense probably benign
Z1191:Fat2 UTSW 11 55308970 frame shift probably null
Z1191:Fat2 UTSW 11 55309799 missense probably benign
Z1192:Fat2 UTSW 11 55308970 frame shift probably null
Z1192:Fat2 UTSW 11 55309799 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCCCGATGTGCTATTGATGG -3'
(R):5'- CAGGACAGAACCAAGATGTCTC -3'

Sequencing Primer
(F):5'- GCTATTGATGGAAAAATGTCGGTCC -3'
(R):5'- GAACCAAGATGTCTCCTATCAGATTG -3'
Posted On2014-08-25