Incidental Mutation 'R1970:Nf1'
ID 219765
Institutional Source Beutler Lab
Gene Symbol Nf1
Ensembl Gene ENSMUSG00000020716
Gene Name neurofibromin 1
Synonyms Nf-1, neurofibromin
MMRRC Submission 039983-MU
Accession Numbers

Genbank: NM_010897; MGI: 97306
Essential gene? Essential (E-score: 1.000) question?
Stock # R1970 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 79339693-79581612 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 79553961 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Aspartic acid at position 371 (N371D)
Ref Sequence ENSEMBL: ENSMUSP00000120982 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071325] [ENSMUST00000108251] [ENSMUST00000137997]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000071325
AA Change: N2387D

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000071289
Gene: ENSMUSG00000020716
AA Change: N2387D

DomainStartEndE-ValueType
RasGAP 1189 1559 2.56e-151 SMART
SEC14 1585 1737 2.36e-11 SMART
low complexity region 2619 2629 N/A INTRINSIC
low complexity region 2750 2763 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108251
AA Change: N2366D

PolyPhen 2 Score 0.075 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000103886
Gene: ENSMUSG00000020716
AA Change: N2366D

DomainStartEndE-ValueType
RasGAP 1189 1538 1.23e-153 SMART
SEC14 1564 1716 2.36e-11 SMART
low complexity region 2598 2608 N/A INTRINSIC
low complexity region 2729 2742 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000137997
AA Change: N371D

PolyPhen 2 Score 0.075 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000120982
Gene: ENSMUSG00000020716
AA Change: N371D

DomainStartEndE-ValueType
low complexity region 604 614 N/A INTRINSIC
low complexity region 735 748 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146699
Meta Mutation Damage Score 0.1187 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.2%
Validation Efficiency 97% (121/125)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product appears to function as a negative regulator of the ras signal transduction pathway. Mutations in this gene have been linked to neurofibromatosis type 1, juvenile myelomonocytic leukemia and Watson syndrome. The mRNA for this gene is subject to RNA editing (CGA>UGA->Arg1306Term) resulting in premature translation termination. Alternatively spliced transcript variants encoding different isoforms have also been described for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous embryos die by day 14.5 with enlarged head and chest, pale liver, microphthalmia, cardiac defects and delayed organ development. Heterozygotes have elevated astrocyte number, predisposition to multiple tumor types and learning/memory deficits. [provided by MGI curators]
Allele List at MGI

All alleles(23) : Targeted, knock-out(4) Targeted, other(3) Gene trapped(16)
Other mutations in this stock
Total: 121 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 A T 17: 24,307,575 H578Q probably benign Het
Abcc12 A G 8: 86,527,281 I958T probably benign Het
Abcg5 AATCATTTG AG 17: 84,673,602 probably null Het
Acap2 A G 16: 31,133,527 probably null Het
Adgrb1 T C 15: 74,539,877 probably benign Het
Akap6 T A 12: 52,938,475 V897E probably damaging Het
Als2 A T 1: 59,215,169 L343Q probably benign Het
Arhgap5 A G 12: 52,542,593 I1275M probably damaging Het
Arnt C T 3: 95,448,393 S16L possibly damaging Het
Bglap3 C T 3: 88,376,993 probably benign Het
Blnk T C 19: 40,940,165 probably benign Het
C1qtnf4 T C 2: 90,889,659 M92T probably damaging Het
C77080 A G 4: 129,226,017 probably benign Het
Ccdc177 G A 12: 80,758,712 R263C unknown Het
Ccdc83 T A 7: 90,244,154 S132C probably damaging Het
Cdc7 A G 5: 106,973,074 probably benign Het
Cgnl1 T A 9: 71,725,535 N178I probably benign Het
Col27a1 C T 4: 63,273,117 probably benign Het
Col5a1 A T 2: 27,986,754 M822L unknown Het
Coro7 T C 16: 4,633,756 I451V probably benign Het
Csmd3 T C 15: 48,673,531 T92A probably damaging Het
Ddc A G 11: 11,815,292 V460A possibly damaging Het
Ddx4 C T 13: 112,600,013 V608I probably damaging Het
Ddx60 A T 8: 61,972,206 H676L possibly damaging Het
Dmtf1 T C 5: 9,148,989 E48G probably benign Het
Dpf3 T A 12: 83,325,035 probably null Het
Dydc2 A G 14: 41,061,903 C88R probably benign Het
Elovl4 A G 9: 83,780,719 Y163H probably damaging Het
Enpp2 T C 15: 54,882,982 D296G probably damaging Het
Fam83h G T 15: 76,006,570 probably benign Het
Fbf1 T A 11: 116,151,491 Q511L possibly damaging Het
Fhdc1 A T 3: 84,454,851 L323Q probably damaging Het
Fmnl2 T A 2: 53,105,576 V437D possibly damaging Het
Foxo3 A G 10: 42,197,262 S420P probably benign Het
Foxp4 C T 17: 47,875,871 R378Q unknown Het
Garem2 G T 5: 30,117,174 G844* probably null Het
Glmp T C 3: 88,327,870 L269S probably damaging Het
Gm2000 T G 1: 156,366,447 *124G probably null Het
Gm9915 T C 1: 42,230,721 noncoding transcript Het
Gnb4 A T 3: 32,598,141 D27E probably damaging Het
Gnb5 A G 9: 75,344,650 probably null Het
Gpr161 T G 1: 165,306,358 V63G probably damaging Het
Gsk3a T A 7: 25,229,721 probably benign Het
Hapln2 T C 3: 88,024,120 probably null Het
Incenp G T 19: 9,885,487 T401N unknown Het
Kalrn A G 16: 33,977,524 probably null Het
Kcnq3 A G 15: 66,028,623 probably null Het
Kif21b T C 1: 136,171,156 V1394A probably damaging Het
Klhl23 T C 2: 69,833,686 C460R probably damaging Het
L3mbtl1 G A 2: 162,959,572 A291T probably damaging Het
Lcp1 T C 14: 75,200,506 S119P probably damaging Het
Ldhc A G 7: 46,869,751 I133V probably benign Het
Lmntd2 G A 7: 141,212,059 probably benign Het
Lpl A T 8: 68,896,802 K327* probably null Het
Lrp1b T C 2: 40,875,069 D2801G probably damaging Het
Mppe1 C A 18: 67,229,772 A131S probably benign Het
Msh3 T A 13: 92,249,820 probably benign Het
Msh5 A G 17: 35,033,600 I377T probably damaging Het
Myo1e T C 9: 70,368,773 F757L probably benign Het
Myof A T 19: 37,945,634 D955E probably damaging Het
Nckap1 C T 2: 80,517,942 S889N probably benign Het
Ncor2 T C 5: 125,038,918 D858G probably damaging Het
Neb A T 2: 52,263,905 V2398D possibly damaging Het
Nefl C G 14: 68,086,672 T453R probably benign Het
Nlrp4f T C 13: 65,194,091 Y580C probably damaging Het
Nme8 A C 13: 19,652,322 L228R probably damaging Het
Numa1 C T 7: 102,009,322 A1605V probably damaging Het
Ofd1 T C X: 166,427,214 Y205C probably benign Het
Olfr1047 T A 2: 86,228,252 T240S probably damaging Het
Olfr1283 C T 2: 111,369,076 S148L probably benign Het
Olfr1532-ps1 G A 7: 106,914,246 G16D probably damaging Het
Olfr693 T A 7: 106,677,670 N272I probably damaging Het
Olfr972 T A 9: 39,873,938 I221N probably damaging Het
Pclo A G 5: 14,713,473 T3987A unknown Het
Pdgfrb G A 18: 61,066,494 probably benign Het
Pdxk G A 10: 78,441,154 T270I probably damaging Het
Pex5 T C 6: 124,414,405 E10G probably damaging Het
Pik3c2g T A 6: 139,900,386 probably null Het
Pkhd1 T A 1: 20,381,523 I2183F probably damaging Het
Plppr2 T C 9: 21,941,126 V102A probably damaging Het
Plxnd1 T C 6: 115,962,517 T1449A probably damaging Het
Pnkd T A 1: 74,285,910 probably null Het
Pom121l2 A G 13: 21,983,472 I638V probably damaging Het
Prag1 A G 8: 36,129,160 probably null Het
Ranbp10 A G 8: 105,786,708 F191L probably damaging Het
Rapgef1 T C 2: 29,733,711 L824P probably damaging Het
Rec8 T C 14: 55,624,142 L418P probably damaging Het
Rimbp2 T A 5: 128,797,241 N429Y probably damaging Het
Rpe65 C A 3: 159,615,670 T373K probably benign Het
Rrn3 T C 16: 13,789,074 S151P probably damaging Het
Scn7a A G 2: 66,684,289 V1047A possibly damaging Het
Scn9a G T 2: 66,515,380 P1123Q probably damaging Het
Secisbp2l T C 2: 125,747,510 D706G probably damaging Het
Serpina5 A T 12: 104,103,857 T338S probably benign Het
Sez6 G A 11: 77,954,068 probably null Het
Shisa4 C T 1: 135,372,274 G157D probably damaging Het
Slc1a7 G T 4: 107,968,585 D14Y probably benign Het
Slc25a11 A C 11: 70,646,173 L51V probably benign Het
Slit3 A G 11: 35,630,841 probably null Het
Spata13 G T 14: 60,691,463 G157W probably damaging Het
Spta1 T C 1: 174,240,367 V2120A possibly damaging Het
Srpr T C 9: 35,213,538 probably null Het
Syt6 A G 3: 103,587,420 I234V probably benign Het
Thada G T 17: 84,310,042 P1349T probably damaging Het
Tmem161a C T 8: 70,176,909 R58W probably damaging Het
Top3b A G 16: 16,883,519 I232V probably damaging Het
Tspan1 T A 4: 116,163,629 Q197L possibly damaging Het
Ttc28 A C 5: 111,235,635 Y1334S probably benign Het
Ubxn6 G T 17: 56,073,077 N28K possibly damaging Het
Uggt1 T C 1: 36,151,781 D1366G probably damaging Het
Ugp2 A G 11: 21,328,942 S415P probably damaging Het
Vcan A T 13: 89,689,038 S2796T probably damaging Het
Vipr2 T C 12: 116,136,206 V231A probably benign Het
Vmn1r176 T C 7: 23,834,948 N260S probably benign Het
Vmn1r59 A T 7: 5,454,039 Y241N probably damaging Het
Vmn2r67 A T 7: 85,151,805 Y308N probably benign Het
Vmn2r75 A T 7: 86,148,262 M781K probably damaging Het
Vwa3a A T 7: 120,780,171 I500F probably damaging Het
Zfp609 A G 9: 65,795,277 V31A probably damaging Het
Zfp689 G T 7: 127,444,787 Q224K probably damaging Het
Zfp81 A T 17: 33,335,501 L113H probably benign Het
Other mutations in Nf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00225:Nf1 APN 11 79395905 missense probably damaging 0.99
IGL00801:Nf1 APN 11 79428700 splice site probably benign
IGL00823:Nf1 APN 11 79565517 missense probably damaging 1.00
IGL00945:Nf1 APN 11 79469803 missense probably damaging 0.99
IGL00960:Nf1 APN 11 79445121 missense probably damaging 1.00
IGL01118:Nf1 APN 11 79546986 missense probably damaging 0.99
IGL01604:Nf1 APN 11 79441709 splice site probably benign
IGL01637:Nf1 APN 11 79547120 missense probably damaging 1.00
IGL01659:Nf1 APN 11 79559449 missense probably benign
IGL01764:Nf1 APN 11 79384187 missense probably benign
IGL01772:Nf1 APN 11 79390249 missense probably damaging 1.00
IGL02047:Nf1 APN 11 79425535 missense probably benign 0.04
IGL02052:Nf1 APN 11 79412727 missense probably damaging 1.00
IGL02071:Nf1 APN 11 79444121 missense possibly damaging 0.96
IGL02312:Nf1 APN 11 79444648 missense possibly damaging 0.95
IGL02341:Nf1 APN 11 79564926 missense probably benign 0.33
IGL02390:Nf1 APN 11 79565935 missense possibly damaging 0.64
IGL02390:Nf1 APN 11 79411676 splice site probably benign
IGL02475:Nf1 APN 11 79535667 missense probably damaging 1.00
IGL02567:Nf1 APN 11 79547143 missense probably damaging 1.00
IGL02571:Nf1 APN 11 79428627 missense probably damaging 1.00
IGL02664:Nf1 APN 11 79444598 critical splice acceptor site probably null
IGL02664:Nf1 APN 11 79444599 critical splice acceptor site probably null
IGL02992:Nf1 APN 11 79434933 splice site probably benign
IGL03006:Nf1 APN 11 79545431 missense probably damaging 1.00
IGL03216:Nf1 APN 11 79564895 missense probably benign 0.17
Diesel UTSW 11 79556723 missense probably damaging 0.96
Eyecandy UTSW 11 79545465 missense probably damaging 1.00
Franklin UTSW 11 79473320 splice site probably null
Gasoline UTSW 11 79556789 missense probably benign 0.17
hancock UTSW 11 79536850 missense probably benign
independence UTSW 11 79454310 intron probably benign
jackson UTSW 11 79447572 missense probably damaging 1.00
Jefferson UTSW 11 79446864 missense probably damaging 1.00
Phyletic_dwarf UTSW 11 79454189 missense probably damaging 1.00
responsibility UTSW 11 79565975 missense probably damaging 0.99
weepy UTSW 11 79546986 missense probably damaging 1.00
C9142:Nf1 UTSW 11 79556731 missense probably damaging 0.98
I2289:Nf1 UTSW 11 79547776 missense probably damaging 1.00
R0055:Nf1 UTSW 11 79471551 missense probably damaging 1.00
R0055:Nf1 UTSW 11 79471551 missense probably damaging 1.00
R0081:Nf1 UTSW 11 79453979 splice site probably benign
R0115:Nf1 UTSW 11 79468876 critical splice donor site probably null
R0144:Nf1 UTSW 11 79547127 missense probably damaging 1.00
R0196:Nf1 UTSW 11 79468769 missense possibly damaging 0.94
R0196:Nf1 UTSW 11 79578272 missense probably damaging 1.00
R0217:Nf1 UTSW 11 79428574 splice site probably benign
R0238:Nf1 UTSW 11 79418574 missense possibly damaging 0.89
R0238:Nf1 UTSW 11 79418574 missense possibly damaging 0.89
R0239:Nf1 UTSW 11 79418574 missense possibly damaging 0.89
R0239:Nf1 UTSW 11 79418574 missense possibly damaging 0.89
R0255:Nf1 UTSW 11 79408699 splice site probably null
R0362:Nf1 UTSW 11 79536878 missense probably damaging 1.00
R0364:Nf1 UTSW 11 79441957 nonsense probably null
R0464:Nf1 UTSW 11 79556789 missense probably benign 0.17
R0511:Nf1 UTSW 11 79438769 missense probably benign 0.01
R0549:Nf1 UTSW 11 79468771 missense probably damaging 0.99
R0585:Nf1 UTSW 11 79568701 missense probably damaging 0.99
R0636:Nf1 UTSW 11 79535703 missense probably damaging 0.99
R0924:Nf1 UTSW 11 79453866 missense probably damaging 0.98
R0942:Nf1 UTSW 11 79438711 missense probably benign 0.00
R1022:Nf1 UTSW 11 79547033 missense probably damaging 1.00
R1024:Nf1 UTSW 11 79547033 missense probably damaging 1.00
R1350:Nf1 UTSW 11 79412687 missense probably damaging 1.00
R1365:Nf1 UTSW 11 79547885 splice site probably null
R1395:Nf1 UTSW 11 79535983 missense possibly damaging 0.49
R1467:Nf1 UTSW 11 79428626 missense possibly damaging 0.88
R1467:Nf1 UTSW 11 79428626 missense possibly damaging 0.88
R1477:Nf1 UTSW 11 79395859 nonsense probably null
R1508:Nf1 UTSW 11 79440909 missense probably damaging 1.00
R1512:Nf1 UTSW 11 79390369 missense probably damaging 1.00
R1605:Nf1 UTSW 11 79440923 missense probably benign 0.01
R1680:Nf1 UTSW 11 79550998 nonsense probably null
R1704:Nf1 UTSW 11 79463301 splice site probably null
R1707:Nf1 UTSW 11 79535604 missense probably damaging 1.00
R1741:Nf1 UTSW 11 79443931 missense probably benign
R1761:Nf1 UTSW 11 79384265 missense probably damaging 1.00
R1800:Nf1 UTSW 11 79553968 missense possibly damaging 0.94
R1873:Nf1 UTSW 11 79547161 missense probably damaging 1.00
R1966:Nf1 UTSW 11 79411564 missense possibly damaging 0.72
R1967:Nf1 UTSW 11 79412745 missense probably damaging 0.96
R2059:Nf1 UTSW 11 79556723 missense probably damaging 0.96
R2105:Nf1 UTSW 11 79469826 missense possibly damaging 0.50
R2151:Nf1 UTSW 11 79447570 missense possibly damaging 0.94
R2211:Nf1 UTSW 11 79444064 missense probably benign 0.39
R2497:Nf1 UTSW 11 79443884 missense probably damaging 1.00
R2899:Nf1 UTSW 11 79412758 missense possibly damaging 0.93
R3086:Nf1 UTSW 11 79546986 missense probably damaging 1.00
R3120:Nf1 UTSW 11 79564899 missense probably damaging 0.99
R3744:Nf1 UTSW 11 79548747 missense probably benign 0.23
R3801:Nf1 UTSW 11 79559521 missense probably null 0.98
R3804:Nf1 UTSW 11 79559521 missense probably null 0.98
R4212:Nf1 UTSW 11 79469798 missense probably damaging 1.00
R4298:Nf1 UTSW 11 79384244 missense probably damaging 1.00
R4578:Nf1 UTSW 11 79445759 missense probably damaging 1.00
R4579:Nf1 UTSW 11 79468757 missense probably damaging 1.00
R4587:Nf1 UTSW 11 79536037 critical splice donor site probably null
R4793:Nf1 UTSW 11 79447572 missense probably damaging 1.00
R4834:Nf1 UTSW 11 79546297 missense probably damaging 1.00
R4863:Nf1 UTSW 11 79409409 missense probably damaging 1.00
R4967:Nf1 UTSW 11 79565553 critical splice donor site probably null
R4971:Nf1 UTSW 11 79444643 missense probably damaging 1.00
R5034:Nf1 UTSW 11 79444150 missense probably damaging 0.98
R5036:Nf1 UTSW 11 79446864 missense probably damaging 1.00
R5207:Nf1 UTSW 11 79454189 missense probably damaging 1.00
R5348:Nf1 UTSW 11 79564899 missense probably damaging 1.00
R5356:Nf1 UTSW 11 79473456 missense possibly damaging 0.94
R5444:Nf1 UTSW 11 79443959 missense possibly damaging 0.94
R5533:Nf1 UTSW 11 79445789 missense probably damaging 0.99
R5918:Nf1 UTSW 11 79569222 intron probably benign
R5978:Nf1 UTSW 11 79540419 missense probably damaging 1.00
R6140:Nf1 UTSW 11 79473320 splice site probably null
R6195:Nf1 UTSW 11 79565975 missense probably damaging 0.99
R6216:Nf1 UTSW 11 79411607 missense possibly damaging 0.93
R6233:Nf1 UTSW 11 79565975 missense probably damaging 0.99
R6257:Nf1 UTSW 11 79549491 missense probably damaging 1.00
R6258:Nf1 UTSW 11 79565755 splice site probably null
R6756:Nf1 UTSW 11 79444587 splice site probably null
R6878:Nf1 UTSW 11 79434882 missense probably damaging 1.00
R6959:Nf1 UTSW 11 79549468 missense probably damaging 0.98
R7007:Nf1 UTSW 11 79447023 splice site probably null
R7066:Nf1 UTSW 11 79556720 missense probably damaging 1.00
R7099:Nf1 UTSW 11 79570330 missense probably benign 0.08
R7213:Nf1 UTSW 11 79469819 missense probably benign 0.23
R7326:Nf1 UTSW 11 79564943 missense probably benign
R7348:Nf1 UTSW 11 79536850 missense probably benign
R7380:Nf1 UTSW 11 79546276 missense probably damaging 1.00
R7407:Nf1 UTSW 11 79448143 missense probably damaging 1.00
R7412:Nf1 UTSW 11 79473414 missense probably damaging 1.00
R7545:Nf1 UTSW 11 79409524 missense probably benign
R7567:Nf1 UTSW 11 79547226 missense probably damaging 0.99
R7574:Nf1 UTSW 11 79408769 missense probably null 0.99
R7616:Nf1 UTSW 11 79384266 missense probably damaging 0.97
R7713:Nf1 UTSW 11 79425606 missense probably benign
R7737:Nf1 UTSW 11 79545488 missense probably benign 0.33
R7869:Nf1 UTSW 11 79418588 missense probably damaging 1.00
R7905:Nf1 UTSW 11 79547112 missense possibly damaging 0.80
R8232:Nf1 UTSW 11 79578331 missense probably damaging 0.96
R8244:Nf1 UTSW 11 79440924 missense probably benign
R8397:Nf1 UTSW 11 79547692 missense probably damaging 1.00
R8436:Nf1 UTSW 11 79458883 missense probably damaging 0.99
R8492:Nf1 UTSW 11 79408422 missense probably benign 0.06
R8719:Nf1 UTSW 11 79390293 missense possibly damaging 0.86
R8735:Nf1 UTSW 11 79454310 intron probably benign
R8795:Nf1 UTSW 11 79425616 missense probably damaging 1.00
R8797:Nf1 UTSW 11 79475885 critical splice donor site probably benign
R8809:Nf1 UTSW 11 79547138 missense probably damaging 0.99
R8812:Nf1 UTSW 11 79546354 missense probably damaging 0.96
R8815:Nf1 UTSW 11 79441665 missense probably damaging 1.00
R8828:Nf1 UTSW 11 79395853 critical splice acceptor site probably null
R8894:Nf1 UTSW 11 79445793 missense probably damaging 1.00
R9051:Nf1 UTSW 11 79473342 missense probably damaging 1.00
R9103:Nf1 UTSW 11 79559506 missense probably damaging 0.99
R9142:Nf1 UTSW 11 79471489 missense probably damaging 1.00
R9142:Nf1 UTSW 11 79475862 missense probably damaging 1.00
R9170:Nf1 UTSW 11 79545465 missense probably damaging 1.00
R9201:Nf1 UTSW 11 79570330 missense probably benign 0.08
R9267:Nf1 UTSW 11 79440890 missense possibly damaging 0.72
R9309:Nf1 UTSW 11 79468769 missense possibly damaging 0.94
R9340:Nf1 UTSW 11 79556803 missense possibly damaging 0.90
R9398:Nf1 UTSW 11 79547192 missense probably damaging 0.99
R9471:Nf1 UTSW 11 79545369 missense probably damaging 0.99
R9630:Nf1 UTSW 11 79411644 missense probably damaging 1.00
R9664:Nf1 UTSW 11 79443907 missense probably damaging 1.00
X0052:Nf1 UTSW 11 79559416 missense probably damaging 0.99
Z1177:Nf1 UTSW 11 79564925 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTGGGGTTCTAGTACTGGAAAAC -3'
(R):5'- CACAGCAATTAAGTCTTGGGG -3'

Sequencing Primer
(F):5'- CGAGAAGGAAAATTTCTGTGCG -3'
(R):5'- GTCTTGGGGGAATTTTACTACTAAC -3'
Posted On 2014-08-25