Incidental Mutation 'R2011:Sptb'
ID219766
Institutional Source Beutler Lab
Gene Symbol Sptb
Ensembl Gene ENSMUSG00000021061
Gene Namespectrin beta, erythrocytic
SynonymsLOC383567, spectrin R, D330027P03Rik, brain erythroid spectrin (235E), Spnb-1, Spnb1
MMRRC Submission 040020-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.835) question?
Stock #R2011 (G1)
Quality Score182
Status Not validated
Chromosome12
Chromosomal Location76580488-76710547 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 76632472 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 70 (R70G)
Ref Sequence ENSEMBL: ENSMUSP00000129782 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021458] [ENSMUST00000166101]
Predicted Effect possibly damaging
Transcript: ENSMUST00000021458
AA Change: R70G

PolyPhen 2 Score 0.503 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000021458
Gene: ENSMUSG00000021061
AA Change: R70G

DomainStartEndE-ValueType
CH 56 156 2.73e-26 SMART
CH 175 273 4.57e-28 SMART
SPEC 305 411 2.71e0 SMART
SPEC 425 525 4.65e-23 SMART
SPEC 531 634 4.51e-21 SMART
SPEC 640 740 3.02e-31 SMART
SPEC 746 845 1.47e-20 SMART
SPEC 851 951 1.04e-20 SMART
SPEC 957 1058 7.22e-20 SMART
SPEC 1064 1165 2.06e-24 SMART
SPEC 1171 1271 3.84e-15 SMART
SPEC 1277 1376 2.22e-20 SMART
SPEC 1382 1475 5.04e-10 SMART
SPEC 1481 1581 3.58e-24 SMART
SPEC 1587 1687 4.11e-24 SMART
SPEC 1693 1794 2.91e-24 SMART
SPEC 1800 1900 7.8e-16 SMART
SPEC 1906 2006 3.16e-25 SMART
SPEC 2012 2193 4.32e-9 SMART
PH 2180 2291 8.98e-16 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000166101
AA Change: R70G

PolyPhen 2 Score 0.951 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000129782
Gene: ENSMUSG00000021061
AA Change: R70G

DomainStartEndE-ValueType
CH 56 156 2.73e-26 SMART
CH 175 273 4.57e-28 SMART
SPEC 305 411 2.71e0 SMART
SPEC 425 525 4.65e-23 SMART
SPEC 531 634 4.51e-21 SMART
SPEC 640 740 3.02e-31 SMART
SPEC 746 845 1.47e-20 SMART
SPEC 851 951 1.04e-20 SMART
SPEC 957 1058 7.22e-20 SMART
SPEC 1064 1165 2.06e-24 SMART
SPEC 1171 1271 3.84e-15 SMART
SPEC 1277 1376 2.22e-20 SMART
SPEC 1382 1475 5.87e-11 SMART
SPEC 1481 1581 3.58e-24 SMART
SPEC 1587 1687 4.11e-24 SMART
SPEC 1693 1794 2.91e-24 SMART
SPEC 1800 1900 7.8e-16 SMART
SPEC 1906 2006 3.16e-25 SMART
SPEC 2012 2117 1.16e-9 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes a member of the spectrin gene family. Spectrin proteins, along with ankyrin, play a role in cell membrane organization and stability. The protein encoded by this locus functions in stability of erythrocyte membranes, and mutations in this gene have been associated with spherocytosis type 2, hereditary elliptocytosis, and neonatal hemolytic anemia. Alternatively spliced transcript variants have been described. [provided by RefSeq, Nov 2009]
PHENOTYPE: Homozygotes for a spontaneous mutation exhibit a severe microcytic anemia with erythrocyte fragility, hepatomegaly, and jaundice. Mutants die within a few days of birth. Heterozygotes are mildly anemic. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 107 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430F08Rik T G 10: 100,583,958 D58A probably damaging Het
Abhd6 A T 14: 8,042,742 T100S probably benign Het
Adam6a T C 12: 113,545,378 I457T probably benign Het
Aff3 T C 1: 38,207,915 N863S probably benign Het
Agk C A 6: 40,376,234 D177E probably benign Het
Alg9 C T 9: 50,788,200 A209V probably damaging Het
Arl6 A T 16: 59,624,313 I51K probably damaging Het
Bpi A T 2: 158,261,352 H89L probably damaging Het
C1qtnf1 T A 11: 118,448,284 F260Y probably benign Het
Cblc T A 7: 19,784,822 D452V probably benign Het
Ccar1 T C 10: 62,776,694 T231A probably benign Het
Ccdc112 A G 18: 46,287,432 L417P probably damaging Het
Ccdc144b A T 3: 36,010,678 C515* probably null Het
Ccdc34 G A 2: 110,044,304 R336Q possibly damaging Het
CK137956 A G 4: 127,951,036 S305P probably benign Het
Clip2 T C 5: 134,503,115 D612G probably damaging Het
Col28a1 T C 6: 8,059,360 T692A probably benign Het
Copg2 A T 6: 30,816,741 probably null Het
Ctnna2 T A 6: 76,973,791 I566F possibly damaging Het
Cux2 C T 5: 121,861,326 D1184N probably benign Het
Dclk3 A G 9: 111,468,354 E322G probably benign Het
Ddx41 A T 13: 55,534,093 probably null Het
Dnaaf2 G A 12: 69,196,785 P107S probably damaging Het
Eif2ak4 A G 2: 118,430,947 E578G probably damaging Het
Exd1 A G 2: 119,528,663 probably benign Het
Fat2 G A 11: 55,282,757 P2377S probably damaging Het
Fbxl18 T C 5: 142,872,459 T741A probably benign Het
Fgr C A 4: 132,997,521 A311E probably damaging Het
Fmo4 T C 1: 162,798,889 T363A probably damaging Het
Fsbp T C 4: 11,584,006 V235A probably benign Het
Gm1110 T A 9: 26,894,258 H366L probably benign Het
Gm43302 T C 5: 105,290,980 N14S probably damaging Het
Gm5422 A G 10: 31,248,768 noncoding transcript Het
Gpr21 A G 2: 37,517,535 E31G probably damaging Het
Gucy1b2 G T 14: 62,408,758 N560K probably damaging Het
Hmcn1 T C 1: 150,677,334 Q2535R probably benign Het
Hnrnpm A T 17: 33,664,624 N264K probably damaging Het
Hyal6 A T 6: 24,734,724 I219L possibly damaging Het
Ifi211 A G 1: 173,907,603 S87P probably damaging Het
Il17rb A T 14: 29,996,840 C428* probably null Het
Iqca T C 1: 90,045,626 N808S probably benign Het
Kcnu1 A G 8: 25,918,442 I94V probably benign Het
Lrba A T 3: 86,310,017 E517V probably damaging Het
Mcidas A G 13: 112,993,981 E37G possibly damaging Het
Med23 T A 10: 24,879,755 F83L possibly damaging Het
Micu2 T C 14: 57,954,133 probably null Het
Mrgprx2 A T 7: 48,482,534 C179S probably damaging Het
Myo6 A G 9: 80,307,722 T1236A probably damaging Het
Myo7a A T 7: 98,054,708 V1946E possibly damaging Het
Nek10 A T 14: 14,885,122 Y695F probably damaging Het
Nr3c2 A T 8: 76,909,793 I508F possibly damaging Het
Olfr1056 A T 2: 86,356,186 H65Q possibly damaging Het
Olfr1133 A T 2: 87,645,889 I78N probably damaging Het
Olfr12 T C 1: 92,620,749 V281A probably benign Het
Olfr307 A T 7: 86,335,747 Y216* probably null Het
Olfr695 T C 7: 106,873,427 I273V probably benign Het
Olfr743 T C 14: 50,533,684 S91P probably damaging Het
Oxct1 T C 15: 4,153,761 S485P probably benign Het
Oxt A G 2: 130,576,652 D61G probably damaging Het
P2ry10 A C X: 107,102,635 I59L probably damaging Het
Parp11 A G 6: 127,477,891 N124S probably benign Het
Pcdh7 T A 5: 57,719,629 N175K probably damaging Het
Pdgfrb T A 18: 61,061,494 S114R probably benign Het
Pfdn5 A G 15: 102,326,521 N54S possibly damaging Het
Phc2 T A 4: 128,723,585 V468E probably benign Het
Piezo2 T C 18: 63,059,744 T1605A probably damaging Het
Pik3cb A T 9: 99,105,579 Y35* probably null Het
Piwil2 A T 14: 70,426,634 M22K probably damaging Het
Plag1 A G 4: 3,904,889 F101L probably damaging Het
Pomt2 A G 12: 87,111,399 L680P possibly damaging Het
Ppp1r36 A G 12: 76,418,926 probably null Het
Prkag2 C T 5: 24,871,054 probably null Het
Prkg1 T C 19: 31,664,142 D47G possibly damaging Het
Prl6a1 G A 13: 27,315,369 G45D probably benign Het
Rbm20 G A 19: 53,859,428 C1135Y probably damaging Het
Recql5 A T 11: 115,897,097 N465K probably benign Het
Rtcb A T 10: 85,941,933 I459N probably damaging Het
Rtp3 A T 9: 110,986,034 probably benign Het
Rundc3b T A 5: 8,512,409 probably null Het
Scube3 A G 17: 28,168,158 T877A probably damaging Het
Sh2d4a A T 8: 68,346,742 Q421L probably benign Het
Siglec1 A T 2: 131,083,357 Y395N probably damaging Het
Slc6a1 G T 6: 114,307,770 G263V probably damaging Het
Slco1c1 T A 6: 141,555,107 F437L probably benign Het
Slco3a1 G A 7: 74,346,671 A329V probably benign Het
Spag9 T A 11: 94,092,375 L504* probably null Het
Spen A T 4: 141,473,329 N2662K probably damaging Het
Stk3 A G 15: 35,072,498 S136P probably damaging Het
Synj1 A T 16: 90,938,696 F1456L probably damaging Het
Tbx5 T C 5: 119,841,906 probably null Het
Tchh G A 3: 93,446,961 R1236Q unknown Het
Timd4 C A 11: 46,820,030 T253K possibly damaging Het
Tmc6 A G 11: 117,769,406 Y669H probably damaging Het
Tmem151a C T 19: 5,082,938 R80H probably benign Het
Tpgs1 T C 10: 79,675,888 L288P probably damaging Het
Trhde T C 10: 114,498,793 I659V probably benign Het
Trpm7 A T 2: 126,823,997 Y896* probably null Het
Ttc5 C A 14: 50,781,550 E37* probably null Het
Uvrag A G 7: 98,939,889 probably null Het
Vmn1r59 T A 7: 5,454,284 D159V probably damaging Het
Vmn2r78 G A 7: 86,955,079 V822M possibly damaging Het
Vnn1 C A 10: 23,894,971 Y32* probably null Het
Wrn A G 8: 33,236,404 V1380A probably benign Het
Zc3h14 A C 12: 98,780,268 S579R possibly damaging Het
Zfp277 G A 12: 40,317,218 Q480* probably null Het
Zfp456 G A 13: 67,366,874 Q238* probably null Het
Zranb3 T A 1: 128,091,901 T35S probably benign Het
Other mutations in Sptb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Sptb APN 12 76621331 missense probably benign 0.00
IGL00160:Sptb APN 12 76623169 missense probably damaging 1.00
IGL00229:Sptb APN 12 76620753 missense probably benign 0.20
IGL00820:Sptb APN 12 76632477 missense probably damaging 1.00
IGL01309:Sptb APN 12 76587463 missense probably benign 0.16
IGL01408:Sptb APN 12 76613147 missense possibly damaging 0.93
IGL01450:Sptb APN 12 76624240 missense possibly damaging 0.89
IGL01455:Sptb APN 12 76612912 missense probably damaging 1.00
IGL01457:Sptb APN 12 76612555 splice site probably benign
IGL01680:Sptb APN 12 76630682 missense probably damaging 1.00
IGL02070:Sptb APN 12 76605539 missense possibly damaging 0.82
IGL02346:Sptb APN 12 76621014 missense probably damaging 1.00
IGL02452:Sptb APN 12 76609036 critical splice donor site probably null
IGL02515:Sptb APN 12 76606487 missense possibly damaging 0.51
IGL02545:Sptb APN 12 76607980 critical splice donor site probably null
IGL02644:Sptb APN 12 76605617 missense probably damaging 1.00
IGL02878:Sptb APN 12 76620753 missense probably benign 0.20
IGL03007:Sptb APN 12 76621341 missense probably damaging 1.00
IGL03220:Sptb APN 12 76612910 missense probably benign 0.06
IGL03343:Sptb APN 12 76583556 unclassified probably benign
IGL03098:Sptb UTSW 12 76621499 missense probably damaging 1.00
PIT4472001:Sptb UTSW 12 76620686 missense probably damaging 1.00
R0047:Sptb UTSW 12 76622950 missense probably damaging 0.99
R0365:Sptb UTSW 12 76600383 missense probably benign 0.12
R0373:Sptb UTSW 12 76621371 missense probably benign 0.03
R0704:Sptb UTSW 12 76583594 missense probably damaging 0.99
R1005:Sptb UTSW 12 76601859 critical splice donor site probably null
R1109:Sptb UTSW 12 76603603 missense probably damaging 1.00
R1264:Sptb UTSW 12 76612607 missense probably damaging 1.00
R1358:Sptb UTSW 12 76621321 frame shift probably null
R1358:Sptb UTSW 12 76621326 missense probably damaging 1.00
R1459:Sptb UTSW 12 76611883 missense probably benign 0.01
R1518:Sptb UTSW 12 76604024 missense possibly damaging 0.95
R1628:Sptb UTSW 12 76583848 missense probably damaging 1.00
R1668:Sptb UTSW 12 76621169 missense probably benign
R1677:Sptb UTSW 12 76629649 missense probably damaging 1.00
R1687:Sptb UTSW 12 76603699 missense possibly damaging 0.95
R1695:Sptb UTSW 12 76620867 missense probably benign 0.10
R1708:Sptb UTSW 12 76612574 missense probably damaging 1.00
R1761:Sptb UTSW 12 76612608 missense probably damaging 0.96
R1925:Sptb UTSW 12 76622253 missense probably damaging 1.00
R2373:Sptb UTSW 12 76621161 missense probably damaging 1.00
R2517:Sptb UTSW 12 76649869 missense possibly damaging 0.55
R2918:Sptb UTSW 12 76598758 missense probably damaging 0.97
R2961:Sptb UTSW 12 76603582 missense probably benign 0.19
R3409:Sptb UTSW 12 76610815 missense possibly damaging 0.78
R3410:Sptb UTSW 12 76610815 missense possibly damaging 0.78
R3411:Sptb UTSW 12 76610815 missense possibly damaging 0.78
R3744:Sptb UTSW 12 76600400 missense probably benign
R4112:Sptb UTSW 12 76597779 missense probably damaging 0.99
R4177:Sptb UTSW 12 76613179 missense probably benign 0.25
R4194:Sptb UTSW 12 76613010 missense probably benign 0.44
R4301:Sptb UTSW 12 76612697 missense probably damaging 1.00
R4555:Sptb UTSW 12 76612851 missense probably benign 0.03
R4619:Sptb UTSW 12 76583807 nonsense probably null
R4620:Sptb UTSW 12 76583807 nonsense probably null
R4625:Sptb UTSW 12 76587326 splice site probably null
R4728:Sptb UTSW 12 76583379 missense probably benign 0.00
R4751:Sptb UTSW 12 76627110 missense probably benign 0.07
R4810:Sptb UTSW 12 76623197 nonsense probably null
R4888:Sptb UTSW 12 76609037 missense probably benign 0.00
R4894:Sptb UTSW 12 76624994 critical splice donor site probably null
R5114:Sptb UTSW 12 76609278 missense probably damaging 1.00
R5191:Sptb UTSW 12 76612834 missense probably benign 0.12
R5479:Sptb UTSW 12 76599851 missense probably benign 0.04
R5646:Sptb UTSW 12 76587441 missense probably benign
R5725:Sptb UTSW 12 76623114 missense probably benign 0.25
R5727:Sptb UTSW 12 76623114 missense probably benign 0.25
R5797:Sptb UTSW 12 76603699 missense possibly damaging 0.95
R5874:Sptb UTSW 12 76598727 missense possibly damaging 0.91
R5952:Sptb UTSW 12 76632384 missense probably benign 0.02
R5956:Sptb UTSW 12 76604168 missense probably benign
R6298:Sptb UTSW 12 76620654 critical splice donor site probably null
R6470:Sptb UTSW 12 76612829 missense probably damaging 1.00
R6477:Sptb UTSW 12 76606392 missense probably damaging 1.00
R6736:Sptb UTSW 12 76613180 missense possibly damaging 0.49
R6854:Sptb UTSW 12 76603480 missense probably damaging 1.00
R6969:Sptb UTSW 12 76608007 missense probably damaging 1.00
R6987:Sptb UTSW 12 76613247 missense probably benign 0.00
R7023:Sptb UTSW 12 76625088 missense probably damaging 1.00
R7366:Sptb UTSW 12 76604194 missense probably damaging 1.00
R7379:Sptb UTSW 12 76610877 missense probably damaging 1.00
R7389:Sptb UTSW 12 76624229 missense probably damaging 0.98
R7392:Sptb UTSW 12 76624229 missense probably damaging 0.98
R7477:Sptb UTSW 12 76628565 missense probably damaging 1.00
R7653:Sptb UTSW 12 76628497 missense probably benign 0.06
R7684:Sptb UTSW 12 76612195 missense probably benign 0.06
R7733:Sptb UTSW 12 76597921 splice site probably null
R7846:Sptb UTSW 12 76608526 nonsense probably null
R8048:Sptb UTSW 12 76628559 missense probably benign 0.02
R8261:Sptb UTSW 12 76621262 missense probably benign 0.06
R8324:Sptb UTSW 12 76619162 missense possibly damaging 0.73
R8512:Sptb UTSW 12 76602052 missense possibly damaging 0.51
R8515:Sptb UTSW 12 76612041 missense probably benign 0.10
X0057:Sptb UTSW 12 76630739 missense probably benign
Z1176:Sptb UTSW 12 76620733 nonsense probably null
Z1177:Sptb UTSW 12 76583584 missense probably damaging 1.00
Z1177:Sptb UTSW 12 76606445 missense probably benign 0.22
Predicted Primers PCR Primer
(F):5'- AGCCAAGGCCTTTCCTCAAG -3'
(R):5'- GACTTGCAGGGTTGGCATATACC -3'

Sequencing Primer
(F):5'- AAGGCCTTTCCTCAAGAGGTG -3'
(R):5'- GGTTGGCATATACCCCCAGAAATG -3'
Posted On2014-08-25