Mutagenetix > Incidental Mutation

Incidental Mutation 'R1970:Arhgap5'

219769

Institutional Source

Beutler Lab

Gene Symbol

Arhgap5

Ensembl Gene

ENSMUSG00000035133

Gene Name

Rho GTPase activating protein 5

Synonyms

p190B, p190-B

MMRRC Submission

039983-MU

Accession Numbers

Genbank: NM_009706; MGI: 1332637

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1970 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

52503972-52571975 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 52542593 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Methionine at position 1275 (I1275M)

Ref Sequence

ENSEMBL: ENSMUSP00000151809 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000110725] [ENSMUST00000217820] [ENSMUST00000219443]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000110725
AA Change: I1275M

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000106353
Gene: ENSMUSG00000035133
AA Change: I1275M

Domain	Start	End	E-Value	Type
Pfam:Ras	142	248	5.3e-7	PFAM
FF	269	325	6.03e-12	SMART
FF	367	420	4.61e-8	SMART
FF	427	482	2.22e-10	SMART
FF	483	537	3.89e-6	SMART
low complexity region	1035	1053	N/A	INTRINSIC
low complexity region	1224	1247	N/A	INTRINSIC
RhoGAP	1273	1447	1.03e-73	SMART
low complexity region	1479	1496	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000217820
AA Change: I13M

PolyPhen 2 Score 0.866 (Sensitivity: 0.83; Specificity: 0.93)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000218755

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000218869

Predicted Effect

probably damaging
Transcript: ENSMUST00000219443
AA Change: I1275M

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

Meta Mutation Damage Score

0.3757

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.8%
20x: 94.2%

Validation Efficiency

97% (121/125)

MGI Phenotype

Strain: 2179998
Lethality: D1-D2
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rho GTPase activating protein 5 negatively regulates RHO GTPases, a family which may mediate cytoskeleton changes by stimulating the hydrolysis of bound GTP. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes die at birth, are 30% smaller, do not inflate their lungs, and show a small thymus, abnormal adipocyte differentiation and brain defects in the corpus callosum, anterior commissure and lateral ventricles. Mutant MEFs show impaired adipogenesis but undergo myogenesis in response to IGF-1. [provided by MGI curators]

Allele List at MGI

All alleles(4) : Targeted, knock-out(1) Gene trapped(3)

Other mutations in this stock

Total: 121 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca17	A	T	17: 24,307,575	H578Q	probably benign	Het
Abcc12	A	G	8: 86,527,281	I958T	probably benign	Het
Abcg5	AATCATTTG	AG	17: 84,673,602		probably null	Het
Acap2	A	G	16: 31,133,527		probably null	Het
Adgrb1	T	C	15: 74,539,877		probably benign	Het
Akap6	T	A	12: 52,938,475	V897E	probably damaging	Het
Als2	A	T	1: 59,215,169	L343Q	probably benign	Het
Arnt	C	T	3: 95,448,393	S16L	possibly damaging	Het
Bglap3	C	T	3: 88,376,993		probably benign	Het
Blnk	T	C	19: 40,940,165		probably benign	Het
C1qtnf4	T	C	2: 90,889,659	M92T	probably damaging	Het
C77080	A	G	4: 129,226,017		probably benign	Het
Ccdc177	G	A	12: 80,758,712	R263C	unknown	Het
Ccdc83	T	A	7: 90,244,154	S132C	probably damaging	Het
Cdc7	A	G	5: 106,973,074		probably benign	Het
Cgnl1	T	A	9: 71,725,535	N178I	probably benign	Het
Col27a1	C	T	4: 63,273,117		probably benign	Het
Col5a1	A	T	2: 27,986,754	M822L	unknown	Het
Coro7	T	C	16: 4,633,756	I451V	probably benign	Het
Csmd3	T	C	15: 48,673,531	T92A	probably damaging	Het
Ddc	A	G	11: 11,815,292	V460A	possibly damaging	Het
Ddx4	C	T	13: 112,600,013	V608I	probably damaging	Het
Ddx60	A	T	8: 61,972,206	H676L	possibly damaging	Het
Dmtf1	T	C	5: 9,148,989	E48G	probably benign	Het
Dpf3	T	A	12: 83,325,035		probably null	Het
Dydc2	A	G	14: 41,061,903	C88R	probably benign	Het
Elovl4	A	G	9: 83,780,719	Y163H	probably damaging	Het
Enpp2	T	C	15: 54,882,982	D296G	probably damaging	Het
Fam83h	G	T	15: 76,006,570		probably benign	Het
Fbf1	T	A	11: 116,151,491	Q511L	possibly damaging	Het
Fhdc1	A	T	3: 84,454,851	L323Q	probably damaging	Het
Fmnl2	T	A	2: 53,105,576	V437D	possibly damaging	Het
Foxo3	A	G	10: 42,197,262	S420P	probably benign	Het
Foxp4	C	T	17: 47,875,871	R378Q	unknown	Het
Garem2	G	T	5: 30,117,174	G844*	probably null	Het
Glmp	T	C	3: 88,327,870	L269S	probably damaging	Het
Gm2000	T	G	1: 156,366,447	*124G	probably null	Het
Gm9915	T	C	1: 42,230,721		noncoding transcript	Het
Gnb4	A	T	3: 32,598,141	D27E	probably damaging	Het
Gnb5	A	G	9: 75,344,650		probably null	Het
Gpr161	T	G	1: 165,306,358	V63G	probably damaging	Het
Gsk3a	T	A	7: 25,229,721		probably benign	Het
Hapln2	T	C	3: 88,024,120		probably null	Het
Incenp	G	T	19: 9,885,487	T401N	unknown	Het
Kalrn	A	G	16: 33,977,524		probably null	Het
Kcnq3	A	G	15: 66,028,623		probably null	Het
Kif21b	T	C	1: 136,171,156	V1394A	probably damaging	Het
Klhl23	T	C	2: 69,833,686	C460R	probably damaging	Het
L3mbtl1	G	A	2: 162,959,572	A291T	probably damaging	Het
Lcp1	T	C	14: 75,200,506	S119P	probably damaging	Het
Ldhc	A	G	7: 46,869,751	I133V	probably benign	Het
Lmntd2	G	A	7: 141,212,059		probably benign	Het
Lpl	A	T	8: 68,896,802	K327*	probably null	Het
Lrp1b	T	C	2: 40,875,069	D2801G	probably damaging	Het
Mppe1	C	A	18: 67,229,772	A131S	probably benign	Het
Msh3	T	A	13: 92,249,820		probably benign	Het
Msh5	A	G	17: 35,033,600	I377T	probably damaging	Het
Myo1e	T	C	9: 70,368,773	F757L	probably benign	Het
Myof	A	T	19: 37,945,634	D955E	probably damaging	Het
Nckap1	C	T	2: 80,517,942	S889N	probably benign	Het
Ncor2	T	C	5: 125,038,918	D858G	probably damaging	Het
Neb	A	T	2: 52,263,905	V2398D	possibly damaging	Het
Nefl	C	G	14: 68,086,672	T453R	probably benign	Het
Nf1	A	G	11: 79,553,961	N371D	probably benign	Het
Nlrp4f	T	C	13: 65,194,091	Y580C	probably damaging	Het
Nme8	A	C	13: 19,652,322	L228R	probably damaging	Het
Numa1	C	T	7: 102,009,322	A1605V	probably damaging	Het
Ofd1	T	C	X: 166,427,214	Y205C	probably benign	Het
Olfr1047	T	A	2: 86,228,252	T240S	probably damaging	Het
Olfr1283	C	T	2: 111,369,076	S148L	probably benign	Het
Olfr1532-ps1	G	A	7: 106,914,246	G16D	probably damaging	Het
Olfr693	T	A	7: 106,677,670	N272I	probably damaging	Het
Olfr972	T	A	9: 39,873,938	I221N	probably damaging	Het
Pclo	A	G	5: 14,713,473	T3987A	unknown	Het
Pdgfrb	G	A	18: 61,066,494		probably benign	Het
Pdxk	G	A	10: 78,441,154	T270I	probably damaging	Het
Pex5	T	C	6: 124,414,405	E10G	probably damaging	Het
Pik3c2g	T	A	6: 139,900,386		probably null	Het
Pkhd1	T	A	1: 20,381,523	I2183F	probably damaging	Het
Plppr2	T	C	9: 21,941,126	V102A	probably damaging	Het
Plxnd1	T	C	6: 115,962,517	T1449A	probably damaging	Het
Pnkd	T	A	1: 74,285,910		probably null	Het
Pom121l2	A	G	13: 21,983,472	I638V	probably damaging	Het
Prag1	A	G	8: 36,129,160		probably null	Het
Ranbp10	A	G	8: 105,786,708	F191L	probably damaging	Het
Rapgef1	T	C	2: 29,733,711	L824P	probably damaging	Het
Rec8	T	C	14: 55,624,142	L418P	probably damaging	Het
Rimbp2	T	A	5: 128,797,241	N429Y	probably damaging	Het
Rpe65	C	A	3: 159,615,670	T373K	probably benign	Het
Rrn3	T	C	16: 13,789,074	S151P	probably damaging	Het
Scn7a	A	G	2: 66,684,289	V1047A	possibly damaging	Het
Scn9a	G	T	2: 66,515,380	P1123Q	probably damaging	Het
Secisbp2l	T	C	2: 125,747,510	D706G	probably damaging	Het
Serpina5	A	T	12: 104,103,857	T338S	probably benign	Het
Sez6	G	A	11: 77,954,068		probably null	Het
Shisa4	C	T	1: 135,372,274	G157D	probably damaging	Het
Slc1a7	G	T	4: 107,968,585	D14Y	probably benign	Het
Slc25a11	A	C	11: 70,646,173	L51V	probably benign	Het
Slit3	A	G	11: 35,630,841		probably null	Het
Spata13	G	T	14: 60,691,463	G157W	probably damaging	Het
Spta1	T	C	1: 174,240,367	V2120A	possibly damaging	Het
Srpr	T	C	9: 35,213,538		probably null	Het
Syt6	A	G	3: 103,587,420	I234V	probably benign	Het
Thada	G	T	17: 84,310,042	P1349T	probably damaging	Het
Tmem161a	C	T	8: 70,176,909	R58W	probably damaging	Het
Top3b	A	G	16: 16,883,519	I232V	probably damaging	Het
Tspan1	T	A	4: 116,163,629	Q197L	possibly damaging	Het
Ttc28	A	C	5: 111,235,635	Y1334S	probably benign	Het
Ubxn6	G	T	17: 56,073,077	N28K	possibly damaging	Het
Uggt1	T	C	1: 36,151,781	D1366G	probably damaging	Het
Ugp2	A	G	11: 21,328,942	S415P	probably damaging	Het
Vcan	A	T	13: 89,689,038	S2796T	probably damaging	Het
Vipr2	T	C	12: 116,136,206	V231A	probably benign	Het
Vmn1r176	T	C	7: 23,834,948	N260S	probably benign	Het
Vmn1r59	A	T	7: 5,454,039	Y241N	probably damaging	Het
Vmn2r67	A	T	7: 85,151,805	Y308N	probably benign	Het
Vmn2r75	A	T	7: 86,148,262	M781K	probably damaging	Het
Vwa3a	A	T	7: 120,780,171	I500F	probably damaging	Het
Zfp609	A	G	9: 65,795,277	V31A	probably damaging	Het
Zfp689	G	T	7: 127,444,787	Q224K	probably damaging	Het
Zfp81	A	T	17: 33,335,501	L113H	probably benign	Het

Other mutations in Arhgap5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00679:Arhgap5	APN	12	52517281	missense	probably damaging	0.98
IGL00823:Arhgap5	APN	12	52518742	missense	possibly damaging	0.84
IGL01161:Arhgap5	APN	12	52516860	missense	probably damaging	1.00
IGL01360:Arhgap5	APN	12	52518240	missense	probably damaging	1.00
IGL01910:Arhgap5	APN	12	52516861	missense	probably benign	0.33
IGL02417:Arhgap5	APN	12	52518353	missense	probably damaging	0.99
IGL02448:Arhgap5	APN	12	52562340	missense	probably damaging	0.97
IGL02813:Arhgap5	APN	12	52516965	missense	probably benign	0.20
IGL03398:Arhgap5	APN	12	52517311	missense	probably damaging	0.99
Decline	UTSW	12	52516582	nonsense	probably null
Pass	UTSW	12	52516507	missense	possibly damaging	0.82
3-1:Arhgap5	UTSW	12	52518882	missense	possibly damaging	0.54
R0039:Arhgap5	UTSW	12	52518735	nonsense	probably null
R0088:Arhgap5	UTSW	12	52516548	missense	probably damaging	1.00
R0104:Arhgap5	UTSW	12	52516717	missense	probably damaging	1.00
R0111:Arhgap5	UTSW	12	52559960	splice site	probably benign
R0356:Arhgap5	UTSW	12	52516308	missense	probably damaging	1.00
R0616:Arhgap5	UTSW	12	52517065	missense	possibly damaging	0.79
R0707:Arhgap5	UTSW	12	52518168	missense	probably damaging	1.00
R0718:Arhgap5	UTSW	12	52516507	missense	possibly damaging	0.82
R0849:Arhgap5	UTSW	12	52519623	missense	probably benign	0.01
R0975:Arhgap5	UTSW	12	52517144	missense	possibly damaging	0.61
R1326:Arhgap5	UTSW	12	52518370	missense	possibly damaging	0.80
R1421:Arhgap5	UTSW	12	52516848	missense	probably damaging	1.00
R1422:Arhgap5	UTSW	12	52519514	missense	probably damaging	1.00
R1625:Arhgap5	UTSW	12	52517376	missense	probably benign
R1711:Arhgap5	UTSW	12	52519345	missense	probably damaging	1.00
R2004:Arhgap5	UTSW	12	52518034	missense	probably benign	0.05
R2356:Arhgap5	UTSW	12	52519147	missense	probably benign	0.00
R3792:Arhgap5	UTSW	12	52519888	missense	probably benign	0.21
R3808:Arhgap5	UTSW	12	52567187	missense	possibly damaging	0.72
R4458:Arhgap5	UTSW	12	52517957	missense	probably benign
R4703:Arhgap5	UTSW	12	52517583	missense	probably damaging	0.99
R4736:Arhgap5	UTSW	12	52519077	missense	probably benign	0.00
R4737:Arhgap5	UTSW	12	52519077	missense	probably benign	0.00
R4740:Arhgap5	UTSW	12	52519077	missense	probably benign	0.00
R4768:Arhgap5	UTSW	12	52557492	missense	probably damaging	1.00
R4806:Arhgap5	UTSW	12	52518703	missense	probably damaging	0.99
R4817:Arhgap5	UTSW	12	52519209	missense	possibly damaging	0.71
R5586:Arhgap5	UTSW	12	52519912	missense	possibly damaging	0.95
R5681:Arhgap5	UTSW	12	52519779	missense	probably benign	0.21
R5683:Arhgap5	UTSW	12	52519586	missense	probably benign
R5911:Arhgap5	UTSW	12	52518742	missense	possibly damaging	0.84
R6448:Arhgap5	UTSW	12	52517663	missense	probably benign	0.11
R6887:Arhgap5	UTSW	12	52519144	missense	probably benign
R6988:Arhgap5	UTSW	12	52518125	missense	possibly damaging	0.94
R7009:Arhgap5	UTSW	12	52519639	missense	probably benign	0.03
R7013:Arhgap5	UTSW	12	52518326	missense	probably benign	0.05
R7239:Arhgap5	UTSW	12	52517376	missense	probably benign
R7310:Arhgap5	UTSW	12	52542487	critical splice acceptor site	probably null
R7339:Arhgap5	UTSW	12	52517698	missense	possibly damaging	0.64
R7375:Arhgap5	UTSW	12	52516582	nonsense	probably null
R7421:Arhgap5	UTSW	12	52518000	missense	probably benign	0.42
R7442:Arhgap5	UTSW	12	52516956	missense	probably benign	0.25
R7842:Arhgap5	UTSW	12	52518697	missense	possibly damaging	0.78
R8079:Arhgap5	UTSW	12	52567205	missense	probably benign
R8241:Arhgap5	UTSW	12	52518315	missense	probably benign	0.00
R8419:Arhgap5	UTSW	12	52518789	missense	probably damaging	1.00
R9138:Arhgap5	UTSW	12	52562363	missense	probably benign	0.05
X0018:Arhgap5	UTSW	12	52518397	missense	probably damaging	1.00
Z1176:Arhgap5	UTSW	12	52518463	missense	possibly damaging	0.94

Predicted Primers

PCR Primer
(F):5'- AGGGCTGATATTACTAGGCATTTG -3'
(R):5'- TGCAGAGTGACTAAGATGACAC -3'

Sequencing Primer
(F):5'- CTGATATTACTAGGCATTTGGGTTG -3'
(R):5'- TGACTAAGATGACACTAAGTAATGGG -3'

Posted On

2014-08-25