Incidental Mutation 'R1970:Akap6'
ID 219771
Institutional Source Beutler Lab
Gene Symbol Akap6
Ensembl Gene ENSMUSG00000061603
Gene Name A kinase anchor protein 6
Synonyms
MMRRC Submission 039983-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.776) question?
Stock # R1970 (G1)
Quality Score 225
Status Validated
Chromosome 12
Chromosomal Location 52746166-53202382 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 52985258 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 897 (V897E)
Ref Sequence ENSEMBL: ENSMUSP00000093406 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095737] [ENSMUST00000219786]
AlphaFold E9Q9K8
Predicted Effect probably damaging
Transcript: ENSMUST00000095737
AA Change: V897E

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000093406
Gene: ENSMUSG00000061603
AA Change: V897E

DomainStartEndE-ValueType
low complexity region 34 51 N/A INTRINSIC
Blast:SPEC 66 168 2e-50 BLAST
low complexity region 441 455 N/A INTRINSIC
low complexity region 544 555 N/A INTRINSIC
low complexity region 569 587 N/A INTRINSIC
low complexity region 640 651 N/A INTRINSIC
low complexity region 694 708 N/A INTRINSIC
SPEC 779 880 1.06e-1 SMART
SPEC 959 1057 1.45e0 SMART
SPEC 1078 1185 2.56e-2 SMART
low complexity region 1316 1332 N/A INTRINSIC
low complexity region 1555 1568 N/A INTRINSIC
low complexity region 1610 1622 N/A INTRINSIC
low complexity region 1683 1698 N/A INTRINSIC
low complexity region 1737 1781 N/A INTRINSIC
low complexity region 1899 1910 N/A INTRINSIC
low complexity region 2019 2031 N/A INTRINSIC
low complexity region 2104 2115 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000219786
AA Change: V897E

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
Meta Mutation Damage Score 0.1529 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.2%
Validation Efficiency 97% (121/125)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The A-kinase anchor proteins (AKAPs) are a group of structurally diverse proteins, which have the common function of binding to the regulatory subunit of protein kinase A (PKA) and confining the holoenzyme to discrete locations within the cell. This gene encodes a member of the AKAP family. The encoded protein is highly expressed in various brain regions and cardiac and skeletal muscle. It is specifically localized to the sarcoplasmic reticulum and nuclear membrane, and is involved in anchoring PKA to the nuclear membrane or sarcoplasmic reticulum. [provided by RefSeq, Jul 2008]
PHENOTYPE: Targeted disruption of this gene results in partial embryonic lethality; surviving homozygotes display a decreased body weight, craniofacial defects and reduced viability. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 121 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 A T 17: 24,526,549 (GRCm39) H578Q probably benign Het
Abcc12 A G 8: 87,253,910 (GRCm39) I958T probably benign Het
Abcg5 AATCATTTG AG 17: 84,981,030 (GRCm39) probably null Het
Acap2 A G 16: 30,952,345 (GRCm39) probably null Het
Adgrb1 T C 15: 74,411,726 (GRCm39) probably benign Het
Als2 A T 1: 59,254,328 (GRCm39) L343Q probably benign Het
Arhgap5 A G 12: 52,589,376 (GRCm39) I1275M probably damaging Het
Arnt C T 3: 95,355,704 (GRCm39) S16L possibly damaging Het
Bglap3 C T 3: 88,284,300 (GRCm39) probably benign Het
Blnk T C 19: 40,928,609 (GRCm39) probably benign Het
C1qtnf4 T C 2: 90,720,003 (GRCm39) M92T probably damaging Het
Ccdc177 G A 12: 80,805,486 (GRCm39) R263C unknown Het
Ccdc83 T A 7: 89,893,362 (GRCm39) S132C probably damaging Het
Cdc7 A G 5: 107,120,940 (GRCm39) probably benign Het
Cgnl1 T A 9: 71,632,817 (GRCm39) N178I probably benign Het
Col27a1 C T 4: 63,191,354 (GRCm39) probably benign Het
Col5a1 A T 2: 27,876,766 (GRCm39) M822L unknown Het
Coro7 T C 16: 4,451,620 (GRCm39) I451V probably benign Het
Csmd3 T C 15: 48,536,927 (GRCm39) T92A probably damaging Het
Ddc A G 11: 11,765,292 (GRCm39) V460A possibly damaging Het
Ddx4 C T 13: 112,736,547 (GRCm39) V608I probably damaging Het
Ddx60 A T 8: 62,425,240 (GRCm39) H676L possibly damaging Het
Dmtf1 T C 5: 9,198,989 (GRCm39) E48G probably benign Het
Dpf3 T A 12: 83,371,809 (GRCm39) probably null Het
Dydc2 A G 14: 40,783,860 (GRCm39) C88R probably benign Het
Elovl4 A G 9: 83,662,772 (GRCm39) Y163H probably damaging Het
Enpp2 T C 15: 54,746,378 (GRCm39) D296G probably damaging Het
Fam83h G T 15: 75,878,419 (GRCm39) probably benign Het
Fbf1 T A 11: 116,042,317 (GRCm39) Q511L possibly damaging Het
Fhdc1 A T 3: 84,362,158 (GRCm39) L323Q probably damaging Het
Fmnl2 T A 2: 52,995,588 (GRCm39) V437D possibly damaging Het
Foxo3 A G 10: 42,073,258 (GRCm39) S420P probably benign Het
Foxp4 C T 17: 48,186,796 (GRCm39) R378Q unknown Het
Garem2 G T 5: 30,322,172 (GRCm39) G844* probably null Het
Glmp T C 3: 88,235,177 (GRCm39) L269S probably damaging Het
Gm9915 T C 1: 42,269,881 (GRCm39) noncoding transcript Het
Gnb4 A T 3: 32,652,290 (GRCm39) D27E probably damaging Het
Gnb5 A G 9: 75,251,932 (GRCm39) probably null Het
Gpr161 T G 1: 165,133,927 (GRCm39) V63G probably damaging Het
Gsk3a T A 7: 24,929,146 (GRCm39) probably benign Het
Hapln2 T C 3: 87,931,427 (GRCm39) probably null Het
Incenp G T 19: 9,862,851 (GRCm39) T401N unknown Het
Kalrn A G 16: 33,797,894 (GRCm39) probably null Het
Kcnq3 A G 15: 65,900,472 (GRCm39) probably null Het
Kif21b T C 1: 136,098,894 (GRCm39) V1394A probably damaging Het
Klhl23 T C 2: 69,664,030 (GRCm39) C460R probably damaging Het
L3mbtl1 G A 2: 162,801,492 (GRCm39) A291T probably damaging Het
Lcp1 T C 14: 75,437,946 (GRCm39) S119P probably damaging Het
Ldhc A G 7: 46,519,175 (GRCm39) I133V probably benign Het
Lmntd2 G A 7: 140,791,972 (GRCm39) probably benign Het
Lpl A T 8: 69,349,454 (GRCm39) K327* probably null Het
Lrp1b T C 2: 40,765,081 (GRCm39) D2801G probably damaging Het
Mppe1 C A 18: 67,362,843 (GRCm39) A131S probably benign Het
Msh3 T A 13: 92,386,328 (GRCm39) probably benign Het
Msh5 A G 17: 35,252,576 (GRCm39) I377T probably damaging Het
Myo1e T C 9: 70,276,055 (GRCm39) F757L probably benign Het
Myof A T 19: 37,934,082 (GRCm39) D955E probably damaging Het
Nckap1 C T 2: 80,348,286 (GRCm39) S889N probably benign Het
Ncor2 T C 5: 125,115,982 (GRCm39) D858G probably damaging Het
Neb A T 2: 52,153,917 (GRCm39) V2398D possibly damaging Het
Nefl C G 14: 68,324,121 (GRCm39) T453R probably benign Het
Nf1 A G 11: 79,444,787 (GRCm39) N371D probably benign Het
Nhsl3 A G 4: 129,119,810 (GRCm39) probably benign Het
Nlrp4f T C 13: 65,341,905 (GRCm39) Y580C probably damaging Het
Nme8 A C 13: 19,836,492 (GRCm39) L228R probably damaging Het
Numa1 C T 7: 101,658,529 (GRCm39) A1605V probably damaging Het
Ofd1 T C X: 165,210,210 (GRCm39) Y205C probably benign Het
Or2ag12 T A 7: 106,276,877 (GRCm39) N272I probably damaging Het
Or2d3b G A 7: 106,513,453 (GRCm39) G16D probably damaging Het
Or4k77 C T 2: 111,199,421 (GRCm39) S148L probably benign Het
Or8g55 T A 9: 39,785,234 (GRCm39) I221N probably damaging Het
Or8k3 T A 2: 86,058,596 (GRCm39) T240S probably damaging Het
Pclo A G 5: 14,763,487 (GRCm39) T3987A unknown Het
Pdgfrb G A 18: 61,199,566 (GRCm39) probably benign Het
Pdxk G A 10: 78,276,988 (GRCm39) T270I probably damaging Het
Pex5 T C 6: 124,391,364 (GRCm39) E10G probably damaging Het
Pik3c2g T A 6: 139,846,112 (GRCm39) probably null Het
Pkhd1 T A 1: 20,451,747 (GRCm39) I2183F probably damaging Het
Plppr2 T C 9: 21,852,422 (GRCm39) V102A probably damaging Het
Plxnd1 T C 6: 115,939,478 (GRCm39) T1449A probably damaging Het
Pnkd T A 1: 74,325,069 (GRCm39) probably null Het
Pom121l2 A G 13: 22,167,642 (GRCm39) I638V probably damaging Het
Prag1 A G 8: 36,596,314 (GRCm39) probably null Het
Ranbp10 A G 8: 106,513,340 (GRCm39) F191L probably damaging Het
Rapgef1 T C 2: 29,623,723 (GRCm39) L824P probably damaging Het
Rec8 T C 14: 55,861,599 (GRCm39) L418P probably damaging Het
Rimbp2 T A 5: 128,874,305 (GRCm39) N429Y probably damaging Het
Rpe65 C A 3: 159,321,307 (GRCm39) T373K probably benign Het
Rpl35rt T G 1: 156,194,017 (GRCm39) *124G probably null Het
Rrn3 T C 16: 13,606,938 (GRCm39) S151P probably damaging Het
Scn7a A G 2: 66,514,633 (GRCm39) V1047A possibly damaging Het
Scn9a G T 2: 66,345,724 (GRCm39) P1123Q probably damaging Het
Secisbp2l T C 2: 125,589,430 (GRCm39) D706G probably damaging Het
Serpina5 A T 12: 104,070,116 (GRCm39) T338S probably benign Het
Sez6 G A 11: 77,844,894 (GRCm39) probably null Het
Shisa4 C T 1: 135,300,012 (GRCm39) G157D probably damaging Het
Slc1a7 G T 4: 107,825,782 (GRCm39) D14Y probably benign Het
Slc25a11 A C 11: 70,536,999 (GRCm39) L51V probably benign Het
Slit3 A G 11: 35,521,668 (GRCm39) probably null Het
Spata13 G T 14: 60,928,912 (GRCm39) G157W probably damaging Het
Spta1 T C 1: 174,067,933 (GRCm39) V2120A possibly damaging Het
Srpra T C 9: 35,124,834 (GRCm39) probably null Het
Syt6 A G 3: 103,494,736 (GRCm39) I234V probably benign Het
Thada G T 17: 84,617,470 (GRCm39) P1349T probably damaging Het
Tmem161a C T 8: 70,629,559 (GRCm39) R58W probably damaging Het
Top3b A G 16: 16,701,383 (GRCm39) I232V probably damaging Het
Tspan1 T A 4: 116,020,826 (GRCm39) Q197L possibly damaging Het
Ttc28 A C 5: 111,383,501 (GRCm39) Y1334S probably benign Het
Ubxn6 G T 17: 56,380,077 (GRCm39) N28K possibly damaging Het
Uggt1 T C 1: 36,190,862 (GRCm39) D1366G probably damaging Het
Ugp2 A G 11: 21,278,942 (GRCm39) S415P probably damaging Het
Vcan A T 13: 89,837,157 (GRCm39) S2796T probably damaging Het
Vipr2 T C 12: 116,099,826 (GRCm39) V231A probably benign Het
Vmn1r176 T C 7: 23,534,373 (GRCm39) N260S probably benign Het
Vmn1r59 A T 7: 5,457,038 (GRCm39) Y241N probably damaging Het
Vmn2r67 A T 7: 84,801,013 (GRCm39) Y308N probably benign Het
Vmn2r75 A T 7: 85,797,470 (GRCm39) M781K probably damaging Het
Vwa3a A T 7: 120,379,394 (GRCm39) I500F probably damaging Het
Zfp609 A G 9: 65,702,559 (GRCm39) V31A probably damaging Het
Zfp689 G T 7: 127,043,959 (GRCm39) Q224K probably damaging Het
Zfp81 A T 17: 33,554,475 (GRCm39) L113H probably benign Het
Other mutations in Akap6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Akap6 APN 12 53,187,763 (GRCm39) missense possibly damaging 0.79
IGL00505:Akap6 APN 12 52,933,885 (GRCm39) missense possibly damaging 0.92
IGL01134:Akap6 APN 12 52,984,000 (GRCm39) missense probably damaging 0.96
IGL01458:Akap6 APN 12 52,933,601 (GRCm39) nonsense probably null
IGL01589:Akap6 APN 12 53,186,447 (GRCm39) missense probably damaging 1.00
IGL01592:Akap6 APN 12 53,188,925 (GRCm39) missense probably damaging 1.00
IGL01738:Akap6 APN 12 52,933,600 (GRCm39) missense probably damaging 0.99
IGL01867:Akap6 APN 12 52,934,791 (GRCm39) missense probably damaging 1.00
IGL02025:Akap6 APN 12 53,187,118 (GRCm39) missense probably benign
IGL02041:Akap6 APN 12 53,187,436 (GRCm39) missense probably damaging 1.00
IGL02058:Akap6 APN 12 53,187,338 (GRCm39) missense probably damaging 1.00
IGL02194:Akap6 APN 12 52,933,606 (GRCm39) missense probably benign 0.00
IGL02226:Akap6 APN 12 53,057,250 (GRCm39) splice site probably benign
IGL02323:Akap6 APN 12 53,187,212 (GRCm39) missense probably benign 0.00
IGL02449:Akap6 APN 12 53,186,971 (GRCm39) missense probably damaging 1.00
IGL02475:Akap6 APN 12 53,186,277 (GRCm39) missense probably benign 0.03
IGL02546:Akap6 APN 12 52,927,521 (GRCm39) missense probably damaging 1.00
IGL02547:Akap6 APN 12 53,187,479 (GRCm39) missense probably damaging 1.00
IGL02588:Akap6 APN 12 52,933,282 (GRCm39) nonsense probably null
IGL02608:Akap6 APN 12 53,057,389 (GRCm39) missense probably benign 0.39
IGL02884:Akap6 APN 12 52,933,405 (GRCm39) missense probably benign 0.00
IGL02945:Akap6 APN 12 52,927,620 (GRCm39) missense probably damaging 1.00
IGL03029:Akap6 APN 12 52,933,195 (GRCm39) missense probably damaging 1.00
IGL03129:Akap6 APN 12 53,187,089 (GRCm39) missense probably damaging 1.00
R0133:Akap6 UTSW 12 53,186,254 (GRCm39) nonsense probably null
R0166:Akap6 UTSW 12 53,187,707 (GRCm39) missense probably benign 0.04
R0189:Akap6 UTSW 12 53,188,037 (GRCm39) missense probably benign 0.41
R0532:Akap6 UTSW 12 52,934,766 (GRCm39) missense probably benign 0.00
R0632:Akap6 UTSW 12 52,983,931 (GRCm39) missense probably damaging 1.00
R0666:Akap6 UTSW 12 52,958,591 (GRCm39) missense probably damaging 1.00
R0723:Akap6 UTSW 12 53,188,685 (GRCm39) missense probably damaging 1.00
R0763:Akap6 UTSW 12 53,188,997 (GRCm39) missense possibly damaging 0.93
R0785:Akap6 UTSW 12 52,933,405 (GRCm39) missense probably benign 0.00
R0879:Akap6 UTSW 12 52,927,582 (GRCm39) missense probably damaging 1.00
R0880:Akap6 UTSW 12 53,186,291 (GRCm39) missense possibly damaging 0.93
R1033:Akap6 UTSW 12 53,116,005 (GRCm39) missense probably damaging 0.97
R1055:Akap6 UTSW 12 52,927,455 (GRCm39) nonsense probably null
R1199:Akap6 UTSW 12 52,842,973 (GRCm39) missense probably damaging 1.00
R1295:Akap6 UTSW 12 52,933,812 (GRCm39) missense probably damaging 1.00
R1389:Akap6 UTSW 12 53,186,303 (GRCm39) missense probably benign 0.15
R1471:Akap6 UTSW 12 53,188,279 (GRCm39) missense probably benign 0.05
R1483:Akap6 UTSW 12 52,842,870 (GRCm39) missense probably damaging 1.00
R1512:Akap6 UTSW 12 52,983,937 (GRCm39) missense probably damaging 1.00
R1648:Akap6 UTSW 12 53,188,789 (GRCm39) nonsense probably null
R1791:Akap6 UTSW 12 53,115,908 (GRCm39) missense probably damaging 1.00
R1888:Akap6 UTSW 12 53,188,958 (GRCm39) missense possibly damaging 0.88
R1888:Akap6 UTSW 12 53,188,958 (GRCm39) missense possibly damaging 0.88
R1891:Akap6 UTSW 12 53,188,958 (GRCm39) missense possibly damaging 0.88
R1899:Akap6 UTSW 12 53,188,635 (GRCm39) missense possibly damaging 0.95
R1917:Akap6 UTSW 12 53,151,395 (GRCm39) missense probably benign 0.13
R1987:Akap6 UTSW 12 53,187,578 (GRCm39) missense possibly damaging 0.78
R1988:Akap6 UTSW 12 53,187,578 (GRCm39) missense possibly damaging 0.78
R2153:Akap6 UTSW 12 53,188,187 (GRCm39) missense probably benign 0.03
R2567:Akap6 UTSW 12 52,985,156 (GRCm39) missense probably damaging 1.00
R2568:Akap6 UTSW 12 52,934,061 (GRCm39) missense possibly damaging 0.77
R3025:Akap6 UTSW 12 53,186,926 (GRCm39) missense probably benign
R3051:Akap6 UTSW 12 52,933,816 (GRCm39) missense probably damaging 1.00
R3195:Akap6 UTSW 12 53,119,240 (GRCm39) nonsense probably null
R3196:Akap6 UTSW 12 53,119,240 (GRCm39) nonsense probably null
R3426:Akap6 UTSW 12 52,934,817 (GRCm39) missense probably damaging 1.00
R3783:Akap6 UTSW 12 52,927,552 (GRCm39) missense probably damaging 1.00
R3934:Akap6 UTSW 12 53,187,227 (GRCm39) missense possibly damaging 0.92
R3936:Akap6 UTSW 12 53,187,227 (GRCm39) missense possibly damaging 0.92
R3967:Akap6 UTSW 12 53,188,236 (GRCm39) missense probably damaging 1.00
R3970:Akap6 UTSW 12 53,188,236 (GRCm39) missense probably damaging 1.00
R4042:Akap6 UTSW 12 53,186,162 (GRCm39) critical splice acceptor site probably null
R4095:Akap6 UTSW 12 53,186,245 (GRCm39) missense probably damaging 1.00
R4152:Akap6 UTSW 12 53,187,190 (GRCm39) missense probably benign 0.45
R4231:Akap6 UTSW 12 53,187,821 (GRCm39) missense probably damaging 1.00
R4232:Akap6 UTSW 12 53,186,454 (GRCm39) missense probably damaging 1.00
R4233:Akap6 UTSW 12 53,186,454 (GRCm39) missense probably damaging 1.00
R4234:Akap6 UTSW 12 53,186,454 (GRCm39) missense probably damaging 1.00
R4235:Akap6 UTSW 12 53,186,454 (GRCm39) missense probably damaging 1.00
R4236:Akap6 UTSW 12 53,186,454 (GRCm39) missense probably damaging 1.00
R4475:Akap6 UTSW 12 53,188,426 (GRCm39) missense probably benign 0.00
R4513:Akap6 UTSW 12 52,842,787 (GRCm39) missense probably benign 0.03
R4686:Akap6 UTSW 12 52,934,406 (GRCm39) frame shift probably null
R4724:Akap6 UTSW 12 52,842,668 (GRCm39) missense possibly damaging 0.80
R4782:Akap6 UTSW 12 52,934,406 (GRCm39) frame shift probably null
R4852:Akap6 UTSW 12 53,151,458 (GRCm39) missense probably damaging 1.00
R5024:Akap6 UTSW 12 53,189,345 (GRCm39) missense probably benign 0.01
R5116:Akap6 UTSW 12 53,188,298 (GRCm39) missense probably benign 0.01
R5164:Akap6 UTSW 12 53,189,249 (GRCm39) missense probably benign
R5225:Akap6 UTSW 12 52,933,329 (GRCm39) missense probably damaging 1.00
R5269:Akap6 UTSW 12 53,186,626 (GRCm39) missense probably damaging 0.99
R5352:Akap6 UTSW 12 52,842,880 (GRCm39) missense probably damaging 1.00
R5496:Akap6 UTSW 12 53,187,436 (GRCm39) missense possibly damaging 0.87
R5551:Akap6 UTSW 12 52,842,747 (GRCm39) missense probably damaging 1.00
R5997:Akap6 UTSW 12 52,984,016 (GRCm39) critical splice donor site probably null
R6137:Akap6 UTSW 12 53,187,137 (GRCm39) missense probably damaging 1.00
R6151:Akap6 UTSW 12 53,072,575 (GRCm39) missense probably damaging 1.00
R6169:Akap6 UTSW 12 53,189,141 (GRCm39) missense probably benign
R6307:Akap6 UTSW 12 53,188,351 (GRCm39) missense possibly damaging 0.85
R6351:Akap6 UTSW 12 53,188,808 (GRCm39) missense probably damaging 0.98
R6479:Akap6 UTSW 12 53,187,952 (GRCm39) missense probably damaging 1.00
R6502:Akap6 UTSW 12 53,186,998 (GRCm39) missense probably damaging 1.00
R6760:Akap6 UTSW 12 53,186,561 (GRCm39) missense probably damaging 1.00
R6778:Akap6 UTSW 12 53,072,599 (GRCm39) missense probably damaging 1.00
R6837:Akap6 UTSW 12 53,188,045 (GRCm39) missense probably damaging 1.00
R6896:Akap6 UTSW 12 52,934,277 (GRCm39) missense probably benign 0.06
R6917:Akap6 UTSW 12 53,115,951 (GRCm39) missense probably null 0.97
R6983:Akap6 UTSW 12 52,934,436 (GRCm39) missense probably damaging 1.00
R7142:Akap6 UTSW 12 52,934,147 (GRCm39) missense probably benign 0.02
R7143:Akap6 UTSW 12 52,934,147 (GRCm39) missense probably benign 0.02
R7216:Akap6 UTSW 12 53,187,240 (GRCm39) missense probably benign 0.02
R7297:Akap6 UTSW 12 52,934,147 (GRCm39) missense probably benign 0.02
R7356:Akap6 UTSW 12 52,958,647 (GRCm39) missense probably damaging 1.00
R7378:Akap6 UTSW 12 53,189,357 (GRCm39) missense probably benign 0.00
R7382:Akap6 UTSW 12 53,188,954 (GRCm39) missense probably benign 0.00
R7498:Akap6 UTSW 12 53,189,488 (GRCm39) nonsense probably null
R7542:Akap6 UTSW 12 53,116,017 (GRCm39) missense probably damaging 1.00
R7589:Akap6 UTSW 12 53,188,846 (GRCm39) nonsense probably null
R7676:Akap6 UTSW 12 52,933,633 (GRCm39) missense possibly damaging 0.94
R7814:Akap6 UTSW 12 53,187,744 (GRCm39) missense probably benign 0.28
R7971:Akap6 UTSW 12 53,186,578 (GRCm39) missense probably damaging 1.00
R8039:Akap6 UTSW 12 53,188,459 (GRCm39) missense probably benign 0.00
R8425:Akap6 UTSW 12 52,933,404 (GRCm39) missense probably benign 0.00
R8747:Akap6 UTSW 12 53,188,999 (GRCm39) missense probably benign 0.01
R8885:Akap6 UTSW 12 53,188,319 (GRCm39) missense probably benign
R8956:Akap6 UTSW 12 53,187,127 (GRCm39) missense probably benign 0.00
R8989:Akap6 UTSW 12 52,927,654 (GRCm39) missense probably damaging 1.00
R9014:Akap6 UTSW 12 53,186,403 (GRCm39) missense possibly damaging 0.60
R9031:Akap6 UTSW 12 53,188,831 (GRCm39) missense probably benign 0.36
R9216:Akap6 UTSW 12 52,927,668 (GRCm39) missense probably benign 0.05
R9220:Akap6 UTSW 12 53,187,232 (GRCm39) missense possibly damaging 0.49
R9243:Akap6 UTSW 12 53,188,035 (GRCm39) missense probably benign 0.08
R9286:Akap6 UTSW 12 53,119,254 (GRCm39) missense possibly damaging 0.90
R9347:Akap6 UTSW 12 53,115,894 (GRCm39) missense probably damaging 1.00
R9475:Akap6 UTSW 12 53,057,335 (GRCm39) missense probably damaging 1.00
R9509:Akap6 UTSW 12 53,189,021 (GRCm39) missense probably damaging 0.99
R9523:Akap6 UTSW 12 52,842,672 (GRCm39) missense probably benign 0.02
R9600:Akap6 UTSW 12 52,933,341 (GRCm39) missense probably benign 0.04
R9612:Akap6 UTSW 12 52,958,690 (GRCm39) missense probably damaging 1.00
R9627:Akap6 UTSW 12 53,151,413 (GRCm39) missense
R9666:Akap6 UTSW 12 53,188,318 (GRCm39) missense probably benign
R9784:Akap6 UTSW 12 53,187,853 (GRCm39) missense probably damaging 1.00
X0062:Akap6 UTSW 12 53,189,144 (GRCm39) missense probably benign 0.43
Z1176:Akap6 UTSW 12 53,187,227 (GRCm39) missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- GGCCCACAACTTGTGCTTTC -3'
(R):5'- CCTCTTCCTGGAAAACTTGAAAG -3'

Sequencing Primer
(F):5'- AACTTGTGCTTTCCTCTCCTTTGG -3'
(R):5'- AACTTGAAAGTTGTCGCCTTTTG -3'
Posted On 2014-08-25