Incidental Mutation 'R1970:Vcan'
ID 219786
Institutional Source Beutler Lab
Gene Symbol Vcan
Ensembl Gene ENSMUSG00000021614
Gene Name versican
Synonyms PG-M, hdf, heart defect, Cspg2, DPEAAE, 5430420N07Rik
MMRRC Submission 039983-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1970 (G1)
Quality Score 225
Status Validated
Chromosome 13
Chromosomal Location 89803431-89890628 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 89837157 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 2796 (S2796T)
Ref Sequence ENSEMBL: ENSMUSP00000105173 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109543] [ENSMUST00000109544] [ENSMUST00000109546] [ENSMUST00000159910]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000109543
SMART Domains Protein: ENSMUSP00000105170
Gene: ENSMUSG00000021614

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IG 29 148 1.4e-7 SMART
LINK 148 245 1.4e-53 SMART
LINK 249 347 8.8e-60 SMART
EGF 351 384 2.72e-7 SMART
EGF_CA 386 422 1.16e-10 SMART
CLECT 428 549 3.08e-34 SMART
CCP 555 611 1.04e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109544
SMART Domains Protein: ENSMUSP00000105171
Gene: ENSMUSG00000021614

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IG 29 148 1.4e-7 SMART
LINK 148 245 1.4e-53 SMART
LINK 249 347 8.8e-60 SMART
low complexity region 728 743 N/A INTRINSIC
low complexity region 1205 1219 N/A INTRINSIC
EGF 1311 1344 2.72e-7 SMART
EGF_CA 1346 1382 1.16e-10 SMART
CLECT 1388 1509 3.08e-34 SMART
CCP 1515 1571 1.04e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109546
AA Change: S2796T

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000105173
Gene: ENSMUSG00000021614
AA Change: S2796T

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IG 29 148 1.4e-7 SMART
LINK 148 245 1.4e-53 SMART
LINK 249 347 8.8e-60 SMART
low complexity region 728 743 N/A INTRINSIC
low complexity region 1205 1219 N/A INTRINSIC
low complexity region 1322 1333 N/A INTRINSIC
low complexity region 1546 1569 N/A INTRINSIC
low complexity region 1837 1852 N/A INTRINSIC
low complexity region 2013 2026 N/A INTRINSIC
low complexity region 2354 2367 N/A INTRINSIC
low complexity region 2468 2482 N/A INTRINSIC
low complexity region 2719 2728 N/A INTRINSIC
EGF 3050 3083 2.72e-7 SMART
EGF_CA 3085 3121 1.16e-10 SMART
CLECT 3127 3248 3.08e-34 SMART
CCP 3254 3310 1.04e-8 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000159910
AA Change: S1836T

PolyPhen 2 Score 0.841 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000125446
Gene: ENSMUSG00000021614
AA Change: S1836T

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IG 29 148 1.4e-7 SMART
LINK 148 245 1.4e-53 SMART
LINK 249 347 8.8e-60 SMART
low complexity region 362 373 N/A INTRINSIC
low complexity region 586 609 N/A INTRINSIC
low complexity region 877 892 N/A INTRINSIC
low complexity region 1053 1066 N/A INTRINSIC
low complexity region 1394 1407 N/A INTRINSIC
low complexity region 1508 1522 N/A INTRINSIC
low complexity region 1759 1768 N/A INTRINSIC
EGF 2090 2123 2.72e-7 SMART
EGF_CA 2125 2161 1.16e-10 SMART
CLECT 2167 2288 3.08e-34 SMART
CCP 2294 2350 1.04e-8 SMART
Meta Mutation Damage Score 0.0712 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.2%
Validation Efficiency 97% (121/125)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the aggrecan/versican proteoglycan family. The protein encoded is a large chondroitin sulfate proteoglycan and is a major component of the extracellular matrix. This protein is involved in cell adhesion, proliferation, proliferation, migration and angiogenesis and plays a central role in tissue morphogenesis and maintenance. Mutations in this gene are the cause of Wagner syndrome type 1. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2009]
PHENOTYPE: Homozygotes for an insertional mutation exhibit anterior-posterior segmental defects of the heart, lack endocardial cushions of the conus and atrioventricular region, and die and around embryonic day 10.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 121 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 A T 17: 24,526,549 (GRCm39) H578Q probably benign Het
Abcc12 A G 8: 87,253,910 (GRCm39) I958T probably benign Het
Abcg5 AATCATTTG AG 17: 84,981,030 (GRCm39) probably null Het
Acap2 A G 16: 30,952,345 (GRCm39) probably null Het
Adgrb1 T C 15: 74,411,726 (GRCm39) probably benign Het
Akap6 T A 12: 52,985,258 (GRCm39) V897E probably damaging Het
Als2 A T 1: 59,254,328 (GRCm39) L343Q probably benign Het
Arhgap5 A G 12: 52,589,376 (GRCm39) I1275M probably damaging Het
Arnt C T 3: 95,355,704 (GRCm39) S16L possibly damaging Het
Bglap3 C T 3: 88,284,300 (GRCm39) probably benign Het
Blnk T C 19: 40,928,609 (GRCm39) probably benign Het
C1qtnf4 T C 2: 90,720,003 (GRCm39) M92T probably damaging Het
Ccdc177 G A 12: 80,805,486 (GRCm39) R263C unknown Het
Ccdc83 T A 7: 89,893,362 (GRCm39) S132C probably damaging Het
Cdc7 A G 5: 107,120,940 (GRCm39) probably benign Het
Cgnl1 T A 9: 71,632,817 (GRCm39) N178I probably benign Het
Col27a1 C T 4: 63,191,354 (GRCm39) probably benign Het
Col5a1 A T 2: 27,876,766 (GRCm39) M822L unknown Het
Coro7 T C 16: 4,451,620 (GRCm39) I451V probably benign Het
Csmd3 T C 15: 48,536,927 (GRCm39) T92A probably damaging Het
Ddc A G 11: 11,765,292 (GRCm39) V460A possibly damaging Het
Ddx4 C T 13: 112,736,547 (GRCm39) V608I probably damaging Het
Ddx60 A T 8: 62,425,240 (GRCm39) H676L possibly damaging Het
Dmtf1 T C 5: 9,198,989 (GRCm39) E48G probably benign Het
Dpf3 T A 12: 83,371,809 (GRCm39) probably null Het
Dydc2 A G 14: 40,783,860 (GRCm39) C88R probably benign Het
Elovl4 A G 9: 83,662,772 (GRCm39) Y163H probably damaging Het
Enpp2 T C 15: 54,746,378 (GRCm39) D296G probably damaging Het
Fam83h G T 15: 75,878,419 (GRCm39) probably benign Het
Fbf1 T A 11: 116,042,317 (GRCm39) Q511L possibly damaging Het
Fhdc1 A T 3: 84,362,158 (GRCm39) L323Q probably damaging Het
Fmnl2 T A 2: 52,995,588 (GRCm39) V437D possibly damaging Het
Foxo3 A G 10: 42,073,258 (GRCm39) S420P probably benign Het
Foxp4 C T 17: 48,186,796 (GRCm39) R378Q unknown Het
Garem2 G T 5: 30,322,172 (GRCm39) G844* probably null Het
Glmp T C 3: 88,235,177 (GRCm39) L269S probably damaging Het
Gm9915 T C 1: 42,269,881 (GRCm39) noncoding transcript Het
Gnb4 A T 3: 32,652,290 (GRCm39) D27E probably damaging Het
Gnb5 A G 9: 75,251,932 (GRCm39) probably null Het
Gpr161 T G 1: 165,133,927 (GRCm39) V63G probably damaging Het
Gsk3a T A 7: 24,929,146 (GRCm39) probably benign Het
Hapln2 T C 3: 87,931,427 (GRCm39) probably null Het
Incenp G T 19: 9,862,851 (GRCm39) T401N unknown Het
Kalrn A G 16: 33,797,894 (GRCm39) probably null Het
Kcnq3 A G 15: 65,900,472 (GRCm39) probably null Het
Kif21b T C 1: 136,098,894 (GRCm39) V1394A probably damaging Het
Klhl23 T C 2: 69,664,030 (GRCm39) C460R probably damaging Het
L3mbtl1 G A 2: 162,801,492 (GRCm39) A291T probably damaging Het
Lcp1 T C 14: 75,437,946 (GRCm39) S119P probably damaging Het
Ldhc A G 7: 46,519,175 (GRCm39) I133V probably benign Het
Lmntd2 G A 7: 140,791,972 (GRCm39) probably benign Het
Lpl A T 8: 69,349,454 (GRCm39) K327* probably null Het
Lrp1b T C 2: 40,765,081 (GRCm39) D2801G probably damaging Het
Mppe1 C A 18: 67,362,843 (GRCm39) A131S probably benign Het
Msh3 T A 13: 92,386,328 (GRCm39) probably benign Het
Msh5 A G 17: 35,252,576 (GRCm39) I377T probably damaging Het
Myo1e T C 9: 70,276,055 (GRCm39) F757L probably benign Het
Myof A T 19: 37,934,082 (GRCm39) D955E probably damaging Het
Nckap1 C T 2: 80,348,286 (GRCm39) S889N probably benign Het
Ncor2 T C 5: 125,115,982 (GRCm39) D858G probably damaging Het
Neb A T 2: 52,153,917 (GRCm39) V2398D possibly damaging Het
Nefl C G 14: 68,324,121 (GRCm39) T453R probably benign Het
Nf1 A G 11: 79,444,787 (GRCm39) N371D probably benign Het
Nhsl3 A G 4: 129,119,810 (GRCm39) probably benign Het
Nlrp4f T C 13: 65,341,905 (GRCm39) Y580C probably damaging Het
Nme8 A C 13: 19,836,492 (GRCm39) L228R probably damaging Het
Numa1 C T 7: 101,658,529 (GRCm39) A1605V probably damaging Het
Ofd1 T C X: 165,210,210 (GRCm39) Y205C probably benign Het
Or2ag12 T A 7: 106,276,877 (GRCm39) N272I probably damaging Het
Or2d3b G A 7: 106,513,453 (GRCm39) G16D probably damaging Het
Or4k77 C T 2: 111,199,421 (GRCm39) S148L probably benign Het
Or8g55 T A 9: 39,785,234 (GRCm39) I221N probably damaging Het
Or8k3 T A 2: 86,058,596 (GRCm39) T240S probably damaging Het
Pclo A G 5: 14,763,487 (GRCm39) T3987A unknown Het
Pdgfrb G A 18: 61,199,566 (GRCm39) probably benign Het
Pdxk G A 10: 78,276,988 (GRCm39) T270I probably damaging Het
Pex5 T C 6: 124,391,364 (GRCm39) E10G probably damaging Het
Pik3c2g T A 6: 139,846,112 (GRCm39) probably null Het
Pkhd1 T A 1: 20,451,747 (GRCm39) I2183F probably damaging Het
Plppr2 T C 9: 21,852,422 (GRCm39) V102A probably damaging Het
Plxnd1 T C 6: 115,939,478 (GRCm39) T1449A probably damaging Het
Pnkd T A 1: 74,325,069 (GRCm39) probably null Het
Pom121l2 A G 13: 22,167,642 (GRCm39) I638V probably damaging Het
Prag1 A G 8: 36,596,314 (GRCm39) probably null Het
Ranbp10 A G 8: 106,513,340 (GRCm39) F191L probably damaging Het
Rapgef1 T C 2: 29,623,723 (GRCm39) L824P probably damaging Het
Rec8 T C 14: 55,861,599 (GRCm39) L418P probably damaging Het
Rimbp2 T A 5: 128,874,305 (GRCm39) N429Y probably damaging Het
Rpe65 C A 3: 159,321,307 (GRCm39) T373K probably benign Het
Rpl35rt T G 1: 156,194,017 (GRCm39) *124G probably null Het
Rrn3 T C 16: 13,606,938 (GRCm39) S151P probably damaging Het
Scn7a A G 2: 66,514,633 (GRCm39) V1047A possibly damaging Het
Scn9a G T 2: 66,345,724 (GRCm39) P1123Q probably damaging Het
Secisbp2l T C 2: 125,589,430 (GRCm39) D706G probably damaging Het
Serpina5 A T 12: 104,070,116 (GRCm39) T338S probably benign Het
Sez6 G A 11: 77,844,894 (GRCm39) probably null Het
Shisa4 C T 1: 135,300,012 (GRCm39) G157D probably damaging Het
Slc1a7 G T 4: 107,825,782 (GRCm39) D14Y probably benign Het
Slc25a11 A C 11: 70,536,999 (GRCm39) L51V probably benign Het
Slit3 A G 11: 35,521,668 (GRCm39) probably null Het
Spata13 G T 14: 60,928,912 (GRCm39) G157W probably damaging Het
Spta1 T C 1: 174,067,933 (GRCm39) V2120A possibly damaging Het
Srpra T C 9: 35,124,834 (GRCm39) probably null Het
Syt6 A G 3: 103,494,736 (GRCm39) I234V probably benign Het
Thada G T 17: 84,617,470 (GRCm39) P1349T probably damaging Het
Tmem161a C T 8: 70,629,559 (GRCm39) R58W probably damaging Het
Top3b A G 16: 16,701,383 (GRCm39) I232V probably damaging Het
Tspan1 T A 4: 116,020,826 (GRCm39) Q197L possibly damaging Het
Ttc28 A C 5: 111,383,501 (GRCm39) Y1334S probably benign Het
Ubxn6 G T 17: 56,380,077 (GRCm39) N28K possibly damaging Het
Uggt1 T C 1: 36,190,862 (GRCm39) D1366G probably damaging Het
Ugp2 A G 11: 21,278,942 (GRCm39) S415P probably damaging Het
Vipr2 T C 12: 116,099,826 (GRCm39) V231A probably benign Het
Vmn1r176 T C 7: 23,534,373 (GRCm39) N260S probably benign Het
Vmn1r59 A T 7: 5,457,038 (GRCm39) Y241N probably damaging Het
Vmn2r67 A T 7: 84,801,013 (GRCm39) Y308N probably benign Het
Vmn2r75 A T 7: 85,797,470 (GRCm39) M781K probably damaging Het
Vwa3a A T 7: 120,379,394 (GRCm39) I500F probably damaging Het
Zfp609 A G 9: 65,702,559 (GRCm39) V31A probably damaging Het
Zfp689 G T 7: 127,043,959 (GRCm39) Q224K probably damaging Het
Zfp81 A T 17: 33,554,475 (GRCm39) L113H probably benign Het
Other mutations in Vcan
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00434:Vcan APN 13 89,852,821 (GRCm39) missense probably damaging 1.00
IGL00502:Vcan APN 13 89,840,438 (GRCm39) missense probably benign
IGL00504:Vcan APN 13 89,839,394 (GRCm39) missense possibly damaging 0.70
IGL00566:Vcan APN 13 89,837,098 (GRCm39) missense probably benign 0.01
IGL00701:Vcan APN 13 89,851,845 (GRCm39) missense probably benign
IGL00743:Vcan APN 13 89,873,425 (GRCm39) missense probably damaging 0.98
IGL00962:Vcan APN 13 89,810,171 (GRCm39) missense probably damaging 1.00
IGL01085:Vcan APN 13 89,828,077 (GRCm39) missense probably damaging 1.00
IGL01317:Vcan APN 13 89,839,787 (GRCm39) missense probably benign 0.00
IGL01349:Vcan APN 13 89,852,062 (GRCm39) missense probably damaging 0.98
IGL01391:Vcan APN 13 89,852,288 (GRCm39) missense probably benign 0.19
IGL01644:Vcan APN 13 89,836,794 (GRCm39) missense probably benign 0.13
IGL01657:Vcan APN 13 89,838,705 (GRCm39) missense probably damaging 1.00
IGL01707:Vcan APN 13 89,837,864 (GRCm39) missense probably damaging 1.00
IGL01764:Vcan APN 13 89,873,507 (GRCm39) missense probably damaging 1.00
IGL01920:Vcan APN 13 89,837,324 (GRCm39) missense probably benign 0.04
IGL01989:Vcan APN 13 89,837,478 (GRCm39) missense possibly damaging 0.86
IGL01999:Vcan APN 13 89,832,557 (GRCm39) missense probably damaging 1.00
IGL02083:Vcan APN 13 89,873,684 (GRCm39) missense probably damaging 1.00
IGL02160:Vcan APN 13 89,832,612 (GRCm39) missense probably damaging 1.00
IGL02217:Vcan APN 13 89,851,196 (GRCm39) missense probably damaging 1.00
IGL02522:Vcan APN 13 89,852,968 (GRCm39) missense probably benign 0.00
IGL02527:Vcan APN 13 89,838,776 (GRCm39) missense possibly damaging 0.95
IGL02926:Vcan APN 13 89,836,742 (GRCm39) missense probably damaging 0.98
IGL03061:Vcan APN 13 89,851,394 (GRCm39) missense probably benign 0.25
IGL03331:Vcan APN 13 89,810,051 (GRCm39) missense probably damaging 1.00
IGL03352:Vcan APN 13 89,853,125 (GRCm39) missense probably benign 0.00
R0041:Vcan UTSW 13 89,810,104 (GRCm39) missense probably damaging 1.00
R0102:Vcan UTSW 13 89,851,787 (GRCm39) missense probably benign 0.01
R0102:Vcan UTSW 13 89,851,787 (GRCm39) missense probably benign 0.01
R0109:Vcan UTSW 13 89,826,192 (GRCm39) critical splice donor site probably null
R0139:Vcan UTSW 13 89,839,380 (GRCm39) missense probably damaging 1.00
R0295:Vcan UTSW 13 89,860,310 (GRCm39) missense probably benign 0.06
R0375:Vcan UTSW 13 89,839,394 (GRCm39) missense probably damaging 0.99
R0379:Vcan UTSW 13 89,851,665 (GRCm39) missense probably damaging 0.99
R0457:Vcan UTSW 13 89,851,318 (GRCm39) missense possibly damaging 0.78
R0482:Vcan UTSW 13 89,826,264 (GRCm39) missense probably damaging 1.00
R0485:Vcan UTSW 13 89,852,779 (GRCm39) missense possibly damaging 0.92
R0532:Vcan UTSW 13 89,851,891 (GRCm39) missense probably damaging 0.99
R0561:Vcan UTSW 13 89,879,583 (GRCm39) missense possibly damaging 0.86
R0561:Vcan UTSW 13 89,860,372 (GRCm39) missense probably damaging 1.00
R0636:Vcan UTSW 13 89,860,386 (GRCm39) missense probably damaging 1.00
R0636:Vcan UTSW 13 89,852,825 (GRCm39) missense probably damaging 0.99
R0680:Vcan UTSW 13 89,827,941 (GRCm39) missense probably damaging 1.00
R0849:Vcan UTSW 13 89,853,072 (GRCm39) missense possibly damaging 0.75
R1006:Vcan UTSW 13 89,833,196 (GRCm39) critical splice donor site probably null
R1104:Vcan UTSW 13 89,840,529 (GRCm39) missense probably damaging 1.00
R1118:Vcan UTSW 13 89,853,782 (GRCm39) missense probably damaging 1.00
R1137:Vcan UTSW 13 89,852,422 (GRCm39) missense probably damaging 1.00
R1199:Vcan UTSW 13 89,827,913 (GRCm39) splice site probably null
R1219:Vcan UTSW 13 89,828,023 (GRCm39) missense probably damaging 1.00
R1296:Vcan UTSW 13 89,805,675 (GRCm39) missense probably damaging 1.00
R1332:Vcan UTSW 13 89,841,174 (GRCm39) missense probably damaging 1.00
R1336:Vcan UTSW 13 89,841,174 (GRCm39) missense probably damaging 1.00
R1403:Vcan UTSW 13 89,836,603 (GRCm39) missense probably benign 0.00
R1403:Vcan UTSW 13 89,836,603 (GRCm39) missense probably benign 0.00
R1546:Vcan UTSW 13 89,841,075 (GRCm39) missense probably damaging 0.99
R1604:Vcan UTSW 13 89,837,780 (GRCm39) missense probably benign 0.42
R1616:Vcan UTSW 13 89,853,782 (GRCm39) missense probably damaging 1.00
R1636:Vcan UTSW 13 89,851,786 (GRCm39) missense possibly damaging 0.90
R1654:Vcan UTSW 13 89,810,065 (GRCm39) missense probably damaging 1.00
R1680:Vcan UTSW 13 89,851,666 (GRCm39) missense probably benign 0.19
R1694:Vcan UTSW 13 89,836,602 (GRCm39) missense probably damaging 0.98
R1712:Vcan UTSW 13 89,869,894 (GRCm39) missense probably damaging 1.00
R1754:Vcan UTSW 13 89,852,854 (GRCm39) missense probably benign 0.01
R1756:Vcan UTSW 13 89,839,800 (GRCm39) missense probably benign 0.05
R1824:Vcan UTSW 13 89,853,331 (GRCm39) missense possibly damaging 0.75
R1852:Vcan UTSW 13 89,853,511 (GRCm39) missense probably damaging 0.99
R1868:Vcan UTSW 13 89,838,990 (GRCm39) missense probably benign 0.12
R1920:Vcan UTSW 13 89,841,134 (GRCm39) missense probably damaging 1.00
R1932:Vcan UTSW 13 89,853,653 (GRCm39) missense possibly damaging 0.78
R1934:Vcan UTSW 13 89,851,045 (GRCm39) missense probably damaging 1.00
R1942:Vcan UTSW 13 89,851,543 (GRCm39) missense probably benign 0.01
R1964:Vcan UTSW 13 89,840,861 (GRCm39) missense probably benign 0.02
R2045:Vcan UTSW 13 89,839,104 (GRCm39) missense probably benign 0.00
R2110:Vcan UTSW 13 89,841,422 (GRCm39) missense probably damaging 1.00
R2111:Vcan UTSW 13 89,841,422 (GRCm39) missense probably damaging 1.00
R2112:Vcan UTSW 13 89,841,422 (GRCm39) missense probably damaging 1.00
R2136:Vcan UTSW 13 89,837,856 (GRCm39) missense probably damaging 1.00
R2158:Vcan UTSW 13 89,851,648 (GRCm39) missense possibly damaging 0.68
R2376:Vcan UTSW 13 89,851,529 (GRCm39) missense possibly damaging 0.80
R2385:Vcan UTSW 13 89,837,568 (GRCm39) missense probably damaging 1.00
R2443:Vcan UTSW 13 89,852,794 (GRCm39) missense probably damaging 1.00
R2876:Vcan UTSW 13 89,852,356 (GRCm39) missense probably damaging 1.00
R3607:Vcan UTSW 13 89,851,420 (GRCm39) missense probably damaging 0.98
R4042:Vcan UTSW 13 89,840,662 (GRCm39) missense probably benign 0.35
R4043:Vcan UTSW 13 89,840,662 (GRCm39) missense probably benign 0.35
R4044:Vcan UTSW 13 89,840,662 (GRCm39) missense probably benign 0.35
R4065:Vcan UTSW 13 89,828,006 (GRCm39) missense probably damaging 1.00
R4161:Vcan UTSW 13 89,833,277 (GRCm39) missense probably damaging 1.00
R4178:Vcan UTSW 13 89,873,666 (GRCm39) missense probably damaging 1.00
R4290:Vcan UTSW 13 89,873,605 (GRCm39) missense probably damaging 1.00
R4530:Vcan UTSW 13 89,852,147 (GRCm39) missense probably damaging 0.97
R4666:Vcan UTSW 13 89,828,053 (GRCm39) missense probably damaging 1.00
R4785:Vcan UTSW 13 89,853,908 (GRCm39) missense probably damaging 1.00
R4870:Vcan UTSW 13 89,852,858 (GRCm39) missense probably benign 0.01
R4973:Vcan UTSW 13 89,836,961 (GRCm39) missense probably benign 0.30
R5037:Vcan UTSW 13 89,852,096 (GRCm39) missense probably damaging 1.00
R5104:Vcan UTSW 13 89,805,591 (GRCm39) intron probably benign
R5124:Vcan UTSW 13 89,873,636 (GRCm39) missense probably damaging 1.00
R5129:Vcan UTSW 13 89,838,359 (GRCm39) missense probably damaging 1.00
R5198:Vcan UTSW 13 89,838,991 (GRCm39) missense probably damaging 1.00
R5240:Vcan UTSW 13 89,840,651 (GRCm39) missense probably benign 0.08
R5254:Vcan UTSW 13 89,839,719 (GRCm39) missense probably damaging 0.99
R5280:Vcan UTSW 13 89,838,405 (GRCm39) missense probably benign 0.00
R5522:Vcan UTSW 13 89,839,929 (GRCm39) missense possibly damaging 0.62
R5557:Vcan UTSW 13 89,851,231 (GRCm39) missense possibly damaging 0.77
R5568:Vcan UTSW 13 89,836,790 (GRCm39) missense probably damaging 1.00
R5578:Vcan UTSW 13 89,839,622 (GRCm39) missense probably benign 0.01
R5627:Vcan UTSW 13 89,839,254 (GRCm39) frame shift probably null
R5687:Vcan UTSW 13 89,826,253 (GRCm39) missense probably damaging 1.00
R5752:Vcan UTSW 13 89,828,069 (GRCm39) missense probably damaging 1.00
R5879:Vcan UTSW 13 89,852,071 (GRCm39) missense probably damaging 0.99
R5941:Vcan UTSW 13 89,840,810 (GRCm39) missense probably damaging 0.98
R6113:Vcan UTSW 13 89,805,655 (GRCm39) nonsense probably null
R6135:Vcan UTSW 13 89,838,045 (GRCm39) missense probably benign 0.36
R6252:Vcan UTSW 13 89,839,339 (GRCm39) nonsense probably null
R6280:Vcan UTSW 13 89,873,492 (GRCm39) missense probably damaging 1.00
R6317:Vcan UTSW 13 89,839,716 (GRCm39) missense probably benign 0.22
R6327:Vcan UTSW 13 89,852,951 (GRCm39) missense probably damaging 0.99
R6460:Vcan UTSW 13 89,838,806 (GRCm39) missense possibly damaging 0.61
R6669:Vcan UTSW 13 89,852,850 (GRCm39) missense probably benign 0.21
R6744:Vcan UTSW 13 89,853,301 (GRCm39) missense probably damaging 1.00
R6819:Vcan UTSW 13 89,853,244 (GRCm39) missense probably benign 0.00
R6880:Vcan UTSW 13 89,860,500 (GRCm39) missense probably damaging 1.00
R6956:Vcan UTSW 13 89,837,550 (GRCm39) missense probably damaging 0.99
R6971:Vcan UTSW 13 89,826,252 (GRCm39) missense probably damaging 1.00
R6985:Vcan UTSW 13 89,828,075 (GRCm39) missense probably damaging 1.00
R6994:Vcan UTSW 13 89,841,526 (GRCm39) missense possibly damaging 0.94
R6997:Vcan UTSW 13 89,838,737 (GRCm39) missense probably damaging 0.98
R7029:Vcan UTSW 13 89,838,360 (GRCm39) missense probably damaging 1.00
R7066:Vcan UTSW 13 89,853,805 (GRCm39) missense probably damaging 1.00
R7156:Vcan UTSW 13 89,837,229 (GRCm39) missense possibly damaging 0.95
R7171:Vcan UTSW 13 89,873,710 (GRCm39) missense probably damaging 1.00
R7176:Vcan UTSW 13 89,837,055 (GRCm39) missense probably benign 0.01
R7229:Vcan UTSW 13 89,853,389 (GRCm39) missense possibly damaging 0.87
R7250:Vcan UTSW 13 89,879,576 (GRCm39) critical splice donor site probably null
R7250:Vcan UTSW 13 89,869,805 (GRCm39) missense probably damaging 1.00
R7262:Vcan UTSW 13 89,853,280 (GRCm39) missense possibly damaging 0.62
R7289:Vcan UTSW 13 89,840,852 (GRCm39) nonsense probably null
R7299:Vcan UTSW 13 89,853,385 (GRCm39) missense probably benign
R7301:Vcan UTSW 13 89,853,385 (GRCm39) missense probably benign
R7425:Vcan UTSW 13 89,837,951 (GRCm39) missense probably damaging 0.99
R7514:Vcan UTSW 13 89,852,237 (GRCm39) missense probably damaging 0.97
R7579:Vcan UTSW 13 89,840,577 (GRCm39) missense probably damaging 1.00
R7618:Vcan UTSW 13 89,840,342 (GRCm39) missense probably damaging 0.99
R7655:Vcan UTSW 13 89,833,233 (GRCm39) missense probably damaging 1.00
R7656:Vcan UTSW 13 89,833,233 (GRCm39) missense probably damaging 1.00
R7676:Vcan UTSW 13 89,839,908 (GRCm39) missense probably damaging 1.00
R7719:Vcan UTSW 13 89,852,738 (GRCm39) missense probably damaging 0.98
R7753:Vcan UTSW 13 89,837,442 (GRCm39) missense probably damaging 1.00
R7762:Vcan UTSW 13 89,841,056 (GRCm39) missense probably damaging 1.00
R7778:Vcan UTSW 13 89,836,773 (GRCm39) missense probably damaging 1.00
R7824:Vcan UTSW 13 89,836,773 (GRCm39) missense probably damaging 1.00
R7995:Vcan UTSW 13 89,839,977 (GRCm39) missense probably benign
R7998:Vcan UTSW 13 89,852,446 (GRCm39) missense probably damaging 1.00
R8033:Vcan UTSW 13 89,852,479 (GRCm39) missense probably benign 0.04
R8061:Vcan UTSW 13 89,805,409 (GRCm39) missense probably benign 0.45
R8103:Vcan UTSW 13 89,851,439 (GRCm39) nonsense probably null
R8103:Vcan UTSW 13 89,805,777 (GRCm39) missense probably damaging 1.00
R8124:Vcan UTSW 13 89,852,373 (GRCm39) missense possibly damaging 0.93
R8162:Vcan UTSW 13 89,853,106 (GRCm39) nonsense probably null
R8166:Vcan UTSW 13 89,840,855 (GRCm39) missense probably benign 0.02
R8274:Vcan UTSW 13 89,853,089 (GRCm39) missense probably benign 0.02
R8284:Vcan UTSW 13 89,852,454 (GRCm39) missense possibly damaging 0.68
R8417:Vcan UTSW 13 89,836,862 (GRCm39) missense probably benign 0.19
R8696:Vcan UTSW 13 89,839,217 (GRCm39) missense probably benign 0.00
R8738:Vcan UTSW 13 89,840,439 (GRCm39) missense probably benign 0.17
R8792:Vcan UTSW 13 89,840,230 (GRCm39) missense possibly damaging 0.91
R8887:Vcan UTSW 13 89,853,026 (GRCm39) missense probably benign
R9049:Vcan UTSW 13 89,826,224 (GRCm39) missense probably damaging 1.00
R9074:Vcan UTSW 13 89,839,146 (GRCm39) missense possibly damaging 0.95
R9095:Vcan UTSW 13 89,852,644 (GRCm39) missense probably benign 0.32
R9172:Vcan UTSW 13 89,828,050 (GRCm39) missense probably damaging 1.00
R9199:Vcan UTSW 13 89,838,615 (GRCm39) nonsense probably null
R9259:Vcan UTSW 13 89,838,989 (GRCm39) missense probably damaging 0.99
R9455:Vcan UTSW 13 89,837,452 (GRCm39) missense probably damaging 1.00
R9476:Vcan UTSW 13 89,851,531 (GRCm39) missense possibly damaging 0.95
R9477:Vcan UTSW 13 89,841,128 (GRCm39) missense probably damaging 1.00
R9555:Vcan UTSW 13 89,839,659 (GRCm39) missense
R9579:Vcan UTSW 13 89,837,713 (GRCm39) missense possibly damaging 0.67
R9606:Vcan UTSW 13 89,853,491 (GRCm39) missense probably damaging 1.00
R9645:Vcan UTSW 13 89,841,081 (GRCm39) missense probably benign 0.00
R9659:Vcan UTSW 13 89,839,860 (GRCm39) missense probably damaging 0.99
R9766:Vcan UTSW 13 89,839,247 (GRCm39) missense probably benign 0.00
R9778:Vcan UTSW 13 89,837,930 (GRCm39) missense probably damaging 1.00
X0058:Vcan UTSW 13 89,840,612 (GRCm39) missense probably benign 0.21
X0065:Vcan UTSW 13 89,853,868 (GRCm39) missense probably damaging 0.96
Z1176:Vcan UTSW 13 89,840,690 (GRCm39) missense probably benign 0.10
Z1177:Vcan UTSW 13 89,852,192 (GRCm39) missense probably damaging 1.00
Z1177:Vcan UTSW 13 89,851,907 (GRCm39) nonsense probably null
Z1177:Vcan UTSW 13 89,851,643 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GACATGGATGGAGGCTCTGTTC -3'
(R):5'- AGGTCCTTCATTTCAGCCAG -3'

Sequencing Primer
(F):5'- AGGCTCTGTTCTGTGGACATTTCC -3'
(R):5'- CAGCCAGAATTCTTTTCAGGAGTG -3'
Posted On 2014-08-25