Incidental Mutation 'R2011:Pdgfrb'
ID219820
Institutional Source Beutler Lab
Gene Symbol Pdgfrb
Ensembl Gene ENSMUSG00000024620
Gene Nameplatelet derived growth factor receptor, beta polypeptide
SynonymsCD140b, Pdgfr
MMRRC Submission 040020-MU
Accession Numbers

Ncbi RefSeq: NM_001146268.1, NM_008809.2; MGI:97531

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2011 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location61045150-61085061 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 61061494 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 114 (S114R)
Ref Sequence ENSEMBL: ENSMUSP00000110929 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025522] [ENSMUST00000115274]
Predicted Effect probably benign
Transcript: ENSMUST00000025522
AA Change: S110R

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000025522
Gene: ENSMUSG00000024620
AA Change: S110R

DomainStartEndE-ValueType
low complexity region 10 24 N/A INTRINSIC
IG 38 120 5.58e-2 SMART
IGc2 225 297 2.83e-12 SMART
IG_like 330 402 1.47e0 SMART
Pfam:Ig_2 415 524 5.6e-2 PFAM
transmembrane domain 534 556 N/A INTRINSIC
TyrKc 600 958 1.11e-135 SMART
low complexity region 1063 1083 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115274
AA Change: S114R

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000110929
Gene: ENSMUSG00000024620
AA Change: S114R

DomainStartEndE-ValueType
low complexity region 14 28 N/A INTRINSIC
IG 42 124 5.58e-2 SMART
IGc2 229 301 2.83e-12 SMART
IG_like 334 406 1.47e0 SMART
transmembrane domain 538 560 N/A INTRINSIC
TyrKc 604 962 1.11e-135 SMART
low complexity region 1067 1087 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype Strain: 2682393; 2135508
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cell surface tyrosine kinase receptor for members of the platelet-derived growth factor family. These growth factors are mitogens for cells of mesenchymal origin. The identity of the growth factor bound to a receptor monomer determines whether the functional receptor is a homodimer or a heterodimer, composed of both platelet-derived growth factor receptor alpha and beta polypeptides. This gene is flanked on chromosome 5 by the genes for granulocyte-macrophage colony-stimulating factor and macrophage-colony stimulating factor receptor; all three genes may be implicated in the 5-q syndrome. A translocation between chromosomes 5 and 12, that fuses this gene to that of the translocation, ETV6, leukemia gene, results in chronic myeloproliferative disorder with eosinophilia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants die perinatally with internal bleeding, thrombocytopenia, anemia and kidney defects. A frameshift mutation results in neonatal lethals with edema and hemorrhaging; several point mutations show cardiovascular abnormalities. [provided by MGI curators]
Allele List at MGI

All alleles(25) : Targeted(23) Gene trapped(2)

Other mutations in this stock
Total: 107 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430F08Rik T G 10: 100,583,958 D58A probably damaging Het
Abhd6 A T 14: 8,042,742 T100S probably benign Het
Adam6a T C 12: 113,545,378 I457T probably benign Het
Aff3 T C 1: 38,207,915 N863S probably benign Het
Agk C A 6: 40,376,234 D177E probably benign Het
Alg9 C T 9: 50,788,200 A209V probably damaging Het
Arl6 A T 16: 59,624,313 I51K probably damaging Het
Bpi A T 2: 158,261,352 H89L probably damaging Het
C1qtnf1 T A 11: 118,448,284 F260Y probably benign Het
Cblc T A 7: 19,784,822 D452V probably benign Het
Ccar1 T C 10: 62,776,694 T231A probably benign Het
Ccdc112 A G 18: 46,287,432 L417P probably damaging Het
Ccdc144b A T 3: 36,010,678 C515* probably null Het
Ccdc34 G A 2: 110,044,304 R336Q possibly damaging Het
CK137956 A G 4: 127,951,036 S305P probably benign Het
Clip2 T C 5: 134,503,115 D612G probably damaging Het
Col28a1 T C 6: 8,059,360 T692A probably benign Het
Copg2 A T 6: 30,816,741 probably null Het
Ctnna2 T A 6: 76,973,791 I566F possibly damaging Het
Cux2 C T 5: 121,861,326 D1184N probably benign Het
Dclk3 A G 9: 111,468,354 E322G probably benign Het
Ddx41 A T 13: 55,534,093 probably null Het
Dnaaf2 G A 12: 69,196,785 P107S probably damaging Het
Eif2ak4 A G 2: 118,430,947 E578G probably damaging Het
Exd1 A G 2: 119,528,663 probably benign Het
Fat2 G A 11: 55,282,757 P2377S probably damaging Het
Fbxl18 T C 5: 142,872,459 T741A probably benign Het
Fgr C A 4: 132,997,521 A311E probably damaging Het
Fmo4 T C 1: 162,798,889 T363A probably damaging Het
Fsbp T C 4: 11,584,006 V235A probably benign Het
Gm1110 T A 9: 26,894,258 H366L probably benign Het
Gm43302 T C 5: 105,290,980 N14S probably damaging Het
Gm5422 A G 10: 31,248,768 noncoding transcript Het
Gpr21 A G 2: 37,517,535 E31G probably damaging Het
Gucy1b2 G T 14: 62,408,758 N560K probably damaging Het
Hmcn1 T C 1: 150,677,334 Q2535R probably benign Het
Hnrnpm A T 17: 33,664,624 N264K probably damaging Het
Hyal6 A T 6: 24,734,724 I219L possibly damaging Het
Ifi211 A G 1: 173,907,603 S87P probably damaging Het
Il17rb A T 14: 29,996,840 C428* probably null Het
Iqca T C 1: 90,045,626 N808S probably benign Het
Kcnu1 A G 8: 25,918,442 I94V probably benign Het
Lrba A T 3: 86,310,017 E517V probably damaging Het
Mcidas A G 13: 112,993,981 E37G possibly damaging Het
Med23 T A 10: 24,879,755 F83L possibly damaging Het
Micu2 T C 14: 57,954,133 probably null Het
Mrgprx2 A T 7: 48,482,534 C179S probably damaging Het
Myo6 A G 9: 80,307,722 T1236A probably damaging Het
Myo7a A T 7: 98,054,708 V1946E possibly damaging Het
Nek10 A T 14: 14,885,122 Y695F probably damaging Het
Nr3c2 A T 8: 76,909,793 I508F possibly damaging Het
Olfr1056 A T 2: 86,356,186 H65Q possibly damaging Het
Olfr1133 A T 2: 87,645,889 I78N probably damaging Het
Olfr12 T C 1: 92,620,749 V281A probably benign Het
Olfr307 A T 7: 86,335,747 Y216* probably null Het
Olfr695 T C 7: 106,873,427 I273V probably benign Het
Olfr743 T C 14: 50,533,684 S91P probably damaging Het
Oxct1 T C 15: 4,153,761 S485P probably benign Het
Oxt A G 2: 130,576,652 D61G probably damaging Het
P2ry10 A C X: 107,102,635 I59L probably damaging Het
Parp11 A G 6: 127,477,891 N124S probably benign Het
Pcdh7 T A 5: 57,719,629 N175K probably damaging Het
Pfdn5 A G 15: 102,326,521 N54S possibly damaging Het
Phc2 T A 4: 128,723,585 V468E probably benign Het
Piezo2 T C 18: 63,059,744 T1605A probably damaging Het
Pik3cb A T 9: 99,105,579 Y35* probably null Het
Piwil2 A T 14: 70,426,634 M22K probably damaging Het
Plag1 A G 4: 3,904,889 F101L probably damaging Het
Pomt2 A G 12: 87,111,399 L680P possibly damaging Het
Ppp1r36 A G 12: 76,418,926 probably null Het
Prkag2 C T 5: 24,871,054 probably null Het
Prkg1 T C 19: 31,664,142 D47G possibly damaging Het
Prl6a1 G A 13: 27,315,369 G45D probably benign Het
Rbm20 G A 19: 53,859,428 C1135Y probably damaging Het
Recql5 A T 11: 115,897,097 N465K probably benign Het
Rtcb A T 10: 85,941,933 I459N probably damaging Het
Rtp3 A T 9: 110,986,034 probably benign Het
Rundc3b T A 5: 8,512,409 probably null Het
Scube3 A G 17: 28,168,158 T877A probably damaging Het
Sh2d4a A T 8: 68,346,742 Q421L probably benign Het
Siglec1 A T 2: 131,083,357 Y395N probably damaging Het
Slc6a1 G T 6: 114,307,770 G263V probably damaging Het
Slco1c1 T A 6: 141,555,107 F437L probably benign Het
Slco3a1 G A 7: 74,346,671 A329V probably benign Het
Spag9 T A 11: 94,092,375 L504* probably null Het
Spen A T 4: 141,473,329 N2662K probably damaging Het
Sptb G C 12: 76,632,472 R70G possibly damaging Het
Stk3 A G 15: 35,072,498 S136P probably damaging Het
Synj1 A T 16: 90,938,696 F1456L probably damaging Het
Tbx5 T C 5: 119,841,906 probably null Het
Tchh G A 3: 93,446,961 R1236Q unknown Het
Timd4 C A 11: 46,820,030 T253K possibly damaging Het
Tmc6 A G 11: 117,769,406 Y669H probably damaging Het
Tmem151a C T 19: 5,082,938 R80H probably benign Het
Tpgs1 T C 10: 79,675,888 L288P probably damaging Het
Trhde T C 10: 114,498,793 I659V probably benign Het
Trpm7 A T 2: 126,823,997 Y896* probably null Het
Ttc5 C A 14: 50,781,550 E37* probably null Het
Uvrag A G 7: 98,939,889 probably null Het
Vmn1r59 T A 7: 5,454,284 D159V probably damaging Het
Vmn2r78 G A 7: 86,955,079 V822M possibly damaging Het
Vnn1 C A 10: 23,894,971 Y32* probably null Het
Wrn A G 8: 33,236,404 V1380A probably benign Het
Zc3h14 A C 12: 98,780,268 S579R possibly damaging Het
Zfp277 G A 12: 40,317,218 Q480* probably null Het
Zfp456 G A 13: 67,366,874 Q238* probably null Het
Zranb3 T A 1: 128,091,901 T35S probably benign Het
Other mutations in Pdgfrb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00553:Pdgfrb APN 18 61068936 missense probably benign 0.20
IGL01396:Pdgfrb APN 18 61072664 missense probably damaging 1.00
IGL02377:Pdgfrb APN 18 61080332 missense probably damaging 1.00
IGL02435:Pdgfrb APN 18 61064926 critical splice donor site probably null
IGL03397:Pdgfrb APN 18 61079681 missense probably benign 0.28
R0021:Pdgfrb UTSW 18 61064926 critical splice donor site probably benign
R0021:Pdgfrb UTSW 18 61064926 critical splice donor site probably benign
R0087:Pdgfrb UTSW 18 61061513 missense probably damaging 1.00
R0119:Pdgfrb UTSW 18 61068852 missense probably benign 0.06
R0299:Pdgfrb UTSW 18 61068852 missense probably benign 0.06
R0532:Pdgfrb UTSW 18 61083265 missense probably damaging 1.00
R0570:Pdgfrb UTSW 18 61077703 missense probably benign 0.00
R0629:Pdgfrb UTSW 18 61078648 critical splice donor site probably null
R0650:Pdgfrb UTSW 18 61079708 missense probably benign 0.00
R0853:Pdgfrb UTSW 18 61080327 missense probably damaging 1.00
R1165:Pdgfrb UTSW 18 61064002 missense probably benign 0.01
R1342:Pdgfrb UTSW 18 61065880 nonsense probably null
R1740:Pdgfrb UTSW 18 61081833 missense possibly damaging 0.93
R1808:Pdgfrb UTSW 18 61068102 missense probably benign
R1864:Pdgfrb UTSW 18 61071717 missense probably benign 0.00
R1960:Pdgfrb UTSW 18 61065783 missense probably benign 0.05
R1961:Pdgfrb UTSW 18 61061505 missense possibly damaging 0.49
R1970:Pdgfrb UTSW 18 61066494 splice site probably benign
R2012:Pdgfrb UTSW 18 61061494 missense probably benign 0.01
R2018:Pdgfrb UTSW 18 61083334 missense possibly damaging 0.84
R2153:Pdgfrb UTSW 18 61072756 missense probably damaging 1.00
R2497:Pdgfrb UTSW 18 61078628 missense possibly damaging 0.58
R2846:Pdgfrb UTSW 18 61064016 missense probably benign 0.00
R3776:Pdgfrb UTSW 18 61081920 missense probably benign 0.00
R3779:Pdgfrb UTSW 18 61072666 missense probably damaging 1.00
R3816:Pdgfrb UTSW 18 61078945 missense probably damaging 1.00
R3978:Pdgfrb UTSW 18 61073685 missense probably damaging 1.00
R4259:Pdgfrb UTSW 18 61077631 missense probably benign 0.00
R4261:Pdgfrb UTSW 18 61077631 missense probably benign 0.00
R4327:Pdgfrb UTSW 18 61071720 missense possibly damaging 0.83
R4329:Pdgfrb UTSW 18 61071720 missense possibly damaging 0.83
R4598:Pdgfrb UTSW 18 61068757 missense probably benign 0.03
R4668:Pdgfrb UTSW 18 61064113 missense probably damaging 1.00
R4761:Pdgfrb UTSW 18 61079700 missense probably damaging 1.00
R4787:Pdgfrb UTSW 18 61079687 missense probably damaging 1.00
R4828:Pdgfrb UTSW 18 61073243 missense probably damaging 0.98
R5030:Pdgfrb UTSW 18 61065135 missense probably benign 0.13
R5033:Pdgfrb UTSW 18 61077668 missense probably damaging 1.00
R5447:Pdgfrb UTSW 18 61068108 missense probably damaging 1.00
R6224:Pdgfrb UTSW 18 61081939 nonsense probably null
R6807:Pdgfrb UTSW 18 61078649 critical splice donor site probably null
R6858:Pdgfrb UTSW 18 61065147 missense probably benign 0.01
R7017:Pdgfrb UTSW 18 61081004 missense probably benign 0.00
R7089:Pdgfrb UTSW 18 61073243 missense probably damaging 1.00
R7174:Pdgfrb UTSW 18 61066515 missense probably benign
R7374:Pdgfrb UTSW 18 61071708 missense possibly damaging 0.64
R7496:Pdgfrb UTSW 18 61078932 missense possibly damaging 0.71
R7565:Pdgfrb UTSW 18 61083264 missense probably damaging 1.00
R7615:Pdgfrb UTSW 18 61064046 missense probably benign 0.00
R7691:Pdgfrb UTSW 18 61061268 missense probably benign 0.05
R7884:Pdgfrb UTSW 18 61072658 missense probably damaging 1.00
X0060:Pdgfrb UTSW 18 61081976 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAGTTTGTTCTCAACATCTCCAG -3'
(R):5'- TGGAAAGAGCATGCTCCTGG -3'

Sequencing Primer
(F):5'- TGTTCTGACCTGCTCGGGC -3'
(R):5'- AGAGCATGCTCCTGGACTGAG -3'
Posted On2014-08-25