Incidental Mutation 'R1970:Kalrn'
ID 219823
Institutional Source Beutler Lab
Gene Symbol Kalrn
Ensembl Gene ENSMUSG00000061751
Gene Name kalirin, RhoGEF kinase
Synonyms E530005C20Rik, LOC224126, Hapip, 2210407G14Rik
MMRRC Submission 039983-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.918) question?
Stock # R1970 (G1)
Quality Score 225
Status Not validated
Chromosome 16
Chromosomal Location 33789443-34393647 bp(-) (GRCm39)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 33797894 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000110624 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076810] [ENSMUST00000076810] [ENSMUST00000114973] [ENSMUST00000114973]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000076810
SMART Domains Protein: ENSMUSP00000076088
Gene: ENSMUSG00000061751

DomainStartEndE-ValueType
SEC14 20 159 2.22e-30 SMART
SPEC 173 289 5.32e-9 SMART
SPEC 295 397 1.19e-11 SMART
SPEC 400 515 1.83e0 SMART
SPEC 521 623 9.84e-13 SMART
SPEC 626 748 2.74e-2 SMART
SPEC 875 976 8.11e-14 SMART
SPEC 1106 1208 4.7e-10 SMART
RhoGEF 1258 1428 3.6e-56 SMART
PH 1442 1555 5.24e-8 SMART
SH3 1622 1683 1.23e-7 SMART
RhoGEF 1904 2074 1.47e-52 SMART
PH 2094 2199 9.87e-4 SMART
SH3 2295 2356 2.78e-2 SMART
IGc2 2455 2527 4.28e-12 SMART
FN3 2541 2623 3.07e-11 SMART
S_TKc 2656 2910 1.28e-71 SMART
Predicted Effect probably null
Transcript: ENSMUST00000076810
SMART Domains Protein: ENSMUSP00000076088
Gene: ENSMUSG00000061751

DomainStartEndE-ValueType
SEC14 20 159 2.22e-30 SMART
SPEC 173 289 5.32e-9 SMART
SPEC 295 397 1.19e-11 SMART
SPEC 400 515 1.83e0 SMART
SPEC 521 623 9.84e-13 SMART
SPEC 626 748 2.74e-2 SMART
SPEC 875 976 8.11e-14 SMART
SPEC 1106 1208 4.7e-10 SMART
RhoGEF 1258 1428 3.6e-56 SMART
PH 1442 1555 5.24e-8 SMART
SH3 1622 1683 1.23e-7 SMART
RhoGEF 1904 2074 1.47e-52 SMART
PH 2094 2199 9.87e-4 SMART
SH3 2295 2356 2.78e-2 SMART
IGc2 2455 2527 4.28e-12 SMART
FN3 2541 2623 3.07e-11 SMART
S_TKc 2656 2910 1.28e-71 SMART
Predicted Effect probably null
Transcript: ENSMUST00000114973
SMART Domains Protein: ENSMUSP00000110624
Gene: ENSMUSG00000061751

DomainStartEndE-ValueType
RhoGEF 235 405 1.47e-52 SMART
PH 425 530 9.87e-4 SMART
SH3 626 687 2.78e-2 SMART
IGc2 786 858 4.28e-12 SMART
FN3 872 954 3.07e-11 SMART
S_TKc 987 1241 1.28e-71 SMART
Predicted Effect probably null
Transcript: ENSMUST00000114973
SMART Domains Protein: ENSMUSP00000110624
Gene: ENSMUSG00000061751

DomainStartEndE-ValueType
RhoGEF 235 405 1.47e-52 SMART
PH 425 530 9.87e-4 SMART
SH3 626 687 2.78e-2 SMART
IGc2 786 858 4.28e-12 SMART
FN3 872 954 3.07e-11 SMART
S_TKc 987 1241 1.28e-71 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132002
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.2%
Validation Efficiency 97% (121/125)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Huntington's disease (HD), a neurodegenerative disorder characterized by loss of striatal neurons, is caused by an expansion of a polyglutamine tract in the HD protein huntingtin. This gene encodes a protein that interacts with the huntingtin-associated protein 1, which is a huntingtin binding protein that may function in vesicle trafficking. [provided by RefSeq, Apr 2016]
PHENOTYPE: Mice homozygous for a knock-out allele specific for isoform 7 exhibit decreased anxiety-related behavior, contextual conditioning, and synapse formation. Mice homozygous for another knock-out allele exhibit impaired AMPA-mediated synaptic currents and abnormal behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 121 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 A T 17: 24,526,549 (GRCm39) H578Q probably benign Het
Abcc12 A G 8: 87,253,910 (GRCm39) I958T probably benign Het
Abcg5 AATCATTTG AG 17: 84,981,030 (GRCm39) probably null Het
Acap2 A G 16: 30,952,345 (GRCm39) probably null Het
Adgrb1 T C 15: 74,411,726 (GRCm39) probably benign Het
Akap6 T A 12: 52,985,258 (GRCm39) V897E probably damaging Het
Als2 A T 1: 59,254,328 (GRCm39) L343Q probably benign Het
Arhgap5 A G 12: 52,589,376 (GRCm39) I1275M probably damaging Het
Arnt C T 3: 95,355,704 (GRCm39) S16L possibly damaging Het
Bglap3 C T 3: 88,284,300 (GRCm39) probably benign Het
Blnk T C 19: 40,928,609 (GRCm39) probably benign Het
C1qtnf4 T C 2: 90,720,003 (GRCm39) M92T probably damaging Het
Ccdc177 G A 12: 80,805,486 (GRCm39) R263C unknown Het
Ccdc83 T A 7: 89,893,362 (GRCm39) S132C probably damaging Het
Cdc7 A G 5: 107,120,940 (GRCm39) probably benign Het
Cgnl1 T A 9: 71,632,817 (GRCm39) N178I probably benign Het
Col27a1 C T 4: 63,191,354 (GRCm39) probably benign Het
Col5a1 A T 2: 27,876,766 (GRCm39) M822L unknown Het
Coro7 T C 16: 4,451,620 (GRCm39) I451V probably benign Het
Csmd3 T C 15: 48,536,927 (GRCm39) T92A probably damaging Het
Ddc A G 11: 11,765,292 (GRCm39) V460A possibly damaging Het
Ddx4 C T 13: 112,736,547 (GRCm39) V608I probably damaging Het
Ddx60 A T 8: 62,425,240 (GRCm39) H676L possibly damaging Het
Dmtf1 T C 5: 9,198,989 (GRCm39) E48G probably benign Het
Dpf3 T A 12: 83,371,809 (GRCm39) probably null Het
Dydc2 A G 14: 40,783,860 (GRCm39) C88R probably benign Het
Elovl4 A G 9: 83,662,772 (GRCm39) Y163H probably damaging Het
Enpp2 T C 15: 54,746,378 (GRCm39) D296G probably damaging Het
Fam83h G T 15: 75,878,419 (GRCm39) probably benign Het
Fbf1 T A 11: 116,042,317 (GRCm39) Q511L possibly damaging Het
Fhdc1 A T 3: 84,362,158 (GRCm39) L323Q probably damaging Het
Fmnl2 T A 2: 52,995,588 (GRCm39) V437D possibly damaging Het
Foxo3 A G 10: 42,073,258 (GRCm39) S420P probably benign Het
Foxp4 C T 17: 48,186,796 (GRCm39) R378Q unknown Het
Garem2 G T 5: 30,322,172 (GRCm39) G844* probably null Het
Glmp T C 3: 88,235,177 (GRCm39) L269S probably damaging Het
Gm9915 T C 1: 42,269,881 (GRCm39) noncoding transcript Het
Gnb4 A T 3: 32,652,290 (GRCm39) D27E probably damaging Het
Gnb5 A G 9: 75,251,932 (GRCm39) probably null Het
Gpr161 T G 1: 165,133,927 (GRCm39) V63G probably damaging Het
Gsk3a T A 7: 24,929,146 (GRCm39) probably benign Het
Hapln2 T C 3: 87,931,427 (GRCm39) probably null Het
Incenp G T 19: 9,862,851 (GRCm39) T401N unknown Het
Kcnq3 A G 15: 65,900,472 (GRCm39) probably null Het
Kif21b T C 1: 136,098,894 (GRCm39) V1394A probably damaging Het
Klhl23 T C 2: 69,664,030 (GRCm39) C460R probably damaging Het
L3mbtl1 G A 2: 162,801,492 (GRCm39) A291T probably damaging Het
Lcp1 T C 14: 75,437,946 (GRCm39) S119P probably damaging Het
Ldhc A G 7: 46,519,175 (GRCm39) I133V probably benign Het
Lmntd2 G A 7: 140,791,972 (GRCm39) probably benign Het
Lpl A T 8: 69,349,454 (GRCm39) K327* probably null Het
Lrp1b T C 2: 40,765,081 (GRCm39) D2801G probably damaging Het
Mppe1 C A 18: 67,362,843 (GRCm39) A131S probably benign Het
Msh3 T A 13: 92,386,328 (GRCm39) probably benign Het
Msh5 A G 17: 35,252,576 (GRCm39) I377T probably damaging Het
Myo1e T C 9: 70,276,055 (GRCm39) F757L probably benign Het
Myof A T 19: 37,934,082 (GRCm39) D955E probably damaging Het
Nckap1 C T 2: 80,348,286 (GRCm39) S889N probably benign Het
Ncor2 T C 5: 125,115,982 (GRCm39) D858G probably damaging Het
Neb A T 2: 52,153,917 (GRCm39) V2398D possibly damaging Het
Nefl C G 14: 68,324,121 (GRCm39) T453R probably benign Het
Nf1 A G 11: 79,444,787 (GRCm39) N371D probably benign Het
Nhsl3 A G 4: 129,119,810 (GRCm39) probably benign Het
Nlrp4f T C 13: 65,341,905 (GRCm39) Y580C probably damaging Het
Nme8 A C 13: 19,836,492 (GRCm39) L228R probably damaging Het
Numa1 C T 7: 101,658,529 (GRCm39) A1605V probably damaging Het
Ofd1 T C X: 165,210,210 (GRCm39) Y205C probably benign Het
Or2ag12 T A 7: 106,276,877 (GRCm39) N272I probably damaging Het
Or2d3b G A 7: 106,513,453 (GRCm39) G16D probably damaging Het
Or4k77 C T 2: 111,199,421 (GRCm39) S148L probably benign Het
Or8g55 T A 9: 39,785,234 (GRCm39) I221N probably damaging Het
Or8k3 T A 2: 86,058,596 (GRCm39) T240S probably damaging Het
Pclo A G 5: 14,763,487 (GRCm39) T3987A unknown Het
Pdgfrb G A 18: 61,199,566 (GRCm39) probably benign Het
Pdxk G A 10: 78,276,988 (GRCm39) T270I probably damaging Het
Pex5 T C 6: 124,391,364 (GRCm39) E10G probably damaging Het
Pik3c2g T A 6: 139,846,112 (GRCm39) probably null Het
Pkhd1 T A 1: 20,451,747 (GRCm39) I2183F probably damaging Het
Plppr2 T C 9: 21,852,422 (GRCm39) V102A probably damaging Het
Plxnd1 T C 6: 115,939,478 (GRCm39) T1449A probably damaging Het
Pnkd T A 1: 74,325,069 (GRCm39) probably null Het
Pom121l2 A G 13: 22,167,642 (GRCm39) I638V probably damaging Het
Prag1 A G 8: 36,596,314 (GRCm39) probably null Het
Ranbp10 A G 8: 106,513,340 (GRCm39) F191L probably damaging Het
Rapgef1 T C 2: 29,623,723 (GRCm39) L824P probably damaging Het
Rec8 T C 14: 55,861,599 (GRCm39) L418P probably damaging Het
Rimbp2 T A 5: 128,874,305 (GRCm39) N429Y probably damaging Het
Rpe65 C A 3: 159,321,307 (GRCm39) T373K probably benign Het
Rpl35rt T G 1: 156,194,017 (GRCm39) *124G probably null Het
Rrn3 T C 16: 13,606,938 (GRCm39) S151P probably damaging Het
Scn7a A G 2: 66,514,633 (GRCm39) V1047A possibly damaging Het
Scn9a G T 2: 66,345,724 (GRCm39) P1123Q probably damaging Het
Secisbp2l T C 2: 125,589,430 (GRCm39) D706G probably damaging Het
Serpina5 A T 12: 104,070,116 (GRCm39) T338S probably benign Het
Sez6 G A 11: 77,844,894 (GRCm39) probably null Het
Shisa4 C T 1: 135,300,012 (GRCm39) G157D probably damaging Het
Slc1a7 G T 4: 107,825,782 (GRCm39) D14Y probably benign Het
Slc25a11 A C 11: 70,536,999 (GRCm39) L51V probably benign Het
Slit3 A G 11: 35,521,668 (GRCm39) probably null Het
Spata13 G T 14: 60,928,912 (GRCm39) G157W probably damaging Het
Spta1 T C 1: 174,067,933 (GRCm39) V2120A possibly damaging Het
Srpra T C 9: 35,124,834 (GRCm39) probably null Het
Syt6 A G 3: 103,494,736 (GRCm39) I234V probably benign Het
Thada G T 17: 84,617,470 (GRCm39) P1349T probably damaging Het
Tmem161a C T 8: 70,629,559 (GRCm39) R58W probably damaging Het
Top3b A G 16: 16,701,383 (GRCm39) I232V probably damaging Het
Tspan1 T A 4: 116,020,826 (GRCm39) Q197L possibly damaging Het
Ttc28 A C 5: 111,383,501 (GRCm39) Y1334S probably benign Het
Ubxn6 G T 17: 56,380,077 (GRCm39) N28K possibly damaging Het
Uggt1 T C 1: 36,190,862 (GRCm39) D1366G probably damaging Het
Ugp2 A G 11: 21,278,942 (GRCm39) S415P probably damaging Het
Vcan A T 13: 89,837,157 (GRCm39) S2796T probably damaging Het
Vipr2 T C 12: 116,099,826 (GRCm39) V231A probably benign Het
Vmn1r176 T C 7: 23,534,373 (GRCm39) N260S probably benign Het
Vmn1r59 A T 7: 5,457,038 (GRCm39) Y241N probably damaging Het
Vmn2r67 A T 7: 84,801,013 (GRCm39) Y308N probably benign Het
Vmn2r75 A T 7: 85,797,470 (GRCm39) M781K probably damaging Het
Vwa3a A T 7: 120,379,394 (GRCm39) I500F probably damaging Het
Zfp609 A G 9: 65,702,559 (GRCm39) V31A probably damaging Het
Zfp689 G T 7: 127,043,959 (GRCm39) Q224K probably damaging Het
Zfp81 A T 17: 33,554,475 (GRCm39) L113H probably benign Het
Other mutations in Kalrn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01361:Kalrn APN 16 33,996,092 (GRCm39) splice site probably benign
IGL01364:Kalrn APN 16 34,082,999 (GRCm39) missense probably damaging 1.00
IGL01510:Kalrn APN 16 34,055,700 (GRCm39) missense possibly damaging 0.52
IGL01664:Kalrn APN 16 34,114,531 (GRCm39) missense probably damaging 1.00
IGL01934:Kalrn APN 16 34,018,882 (GRCm39) splice site probably null
IGL02059:Kalrn APN 16 34,072,711 (GRCm39) missense possibly damaging 0.95
IGL02102:Kalrn APN 16 34,040,592 (GRCm39) missense probably damaging 1.00
IGL02306:Kalrn APN 16 34,130,897 (GRCm39) missense probably damaging 0.97
IGL02328:Kalrn APN 16 34,152,594 (GRCm39) missense probably damaging 0.98
IGL02532:Kalrn APN 16 34,181,216 (GRCm39) missense probably damaging 1.00
IGL02685:Kalrn APN 16 34,334,329 (GRCm39) nonsense probably null
IGL02696:Kalrn APN 16 34,040,484 (GRCm39) missense probably damaging 1.00
IGL02708:Kalrn APN 16 34,212,420 (GRCm39) missense probably damaging 1.00
IGL02937:Kalrn APN 16 34,040,500 (GRCm39) nonsense probably null
IGL03188:Kalrn APN 16 34,134,562 (GRCm39) missense probably benign 0.01
IGL03289:Kalrn APN 16 34,205,667 (GRCm39) missense possibly damaging 0.90
IGL03408:Kalrn APN 16 34,134,546 (GRCm39) missense probably damaging 0.99
breeze UTSW 16 33,834,045 (GRCm39) missense
ethereal UTSW 16 33,795,805 (GRCm39) utr 3 prime probably benign
Feather UTSW 16 34,134,579 (GRCm39) missense probably damaging 0.99
Hidden UTSW 16 33,848,346 (GRCm39) missense probably damaging 1.00
Soulful UTSW 16 34,007,854 (GRCm39) nonsense probably null
G1Funyon:Kalrn UTSW 16 34,177,470 (GRCm39) missense probably benign 0.05
PIT4498001:Kalrn UTSW 16 33,851,952 (GRCm39) missense possibly damaging 0.81
R0019:Kalrn UTSW 16 34,018,884 (GRCm39) splice site probably benign
R0043:Kalrn UTSW 16 33,875,276 (GRCm39) missense probably damaging 1.00
R0052:Kalrn UTSW 16 34,177,541 (GRCm39) missense probably damaging 1.00
R0066:Kalrn UTSW 16 34,024,327 (GRCm39) missense probably damaging 1.00
R0098:Kalrn UTSW 16 33,795,989 (GRCm39) missense possibly damaging 0.89
R0098:Kalrn UTSW 16 33,795,989 (GRCm39) missense possibly damaging 0.89
R0111:Kalrn UTSW 16 33,851,960 (GRCm39) missense probably damaging 1.00
R0113:Kalrn UTSW 16 33,870,306 (GRCm39) intron probably benign
R0183:Kalrn UTSW 16 33,991,749 (GRCm39) splice site probably null
R0422:Kalrn UTSW 16 34,134,643 (GRCm39) missense probably damaging 0.99
R0498:Kalrn UTSW 16 33,875,261 (GRCm39) missense possibly damaging 0.61
R0614:Kalrn UTSW 16 33,814,040 (GRCm39) splice site probably benign
R0656:Kalrn UTSW 16 33,852,837 (GRCm39) missense probably damaging 1.00
R0671:Kalrn UTSW 16 33,936,778 (GRCm39) missense probably benign 0.04
R0707:Kalrn UTSW 16 33,830,951 (GRCm39) missense possibly damaging 0.88
R0709:Kalrn UTSW 16 33,855,924 (GRCm39) missense probably damaging 1.00
R0834:Kalrn UTSW 16 33,870,289 (GRCm39) missense possibly damaging 0.94
R0976:Kalrn UTSW 16 34,205,760 (GRCm39) missense probably damaging 1.00
R1297:Kalrn UTSW 16 33,836,868 (GRCm39) missense probably damaging 0.99
R1355:Kalrn UTSW 16 33,795,954 (GRCm39) missense possibly damaging 0.74
R1370:Kalrn UTSW 16 33,795,954 (GRCm39) missense possibly damaging 0.74
R1389:Kalrn UTSW 16 33,809,173 (GRCm39) missense probably benign 0.01
R1398:Kalrn UTSW 16 34,033,190 (GRCm39) missense probably damaging 1.00
R1427:Kalrn UTSW 16 33,796,124 (GRCm39) missense probably damaging 1.00
R1458:Kalrn UTSW 16 33,994,857 (GRCm39) missense probably damaging 1.00
R1470:Kalrn UTSW 16 34,007,841 (GRCm39) missense probably damaging 1.00
R1470:Kalrn UTSW 16 34,007,841 (GRCm39) missense probably damaging 1.00
R1557:Kalrn UTSW 16 34,134,648 (GRCm39) missense possibly damaging 0.92
R1559:Kalrn UTSW 16 33,830,918 (GRCm39) missense possibly damaging 0.92
R1654:Kalrn UTSW 16 33,796,108 (GRCm39) missense probably damaging 1.00
R1703:Kalrn UTSW 16 34,025,696 (GRCm39) missense probably damaging 1.00
R1759:Kalrn UTSW 16 34,181,320 (GRCm39) missense probably damaging 0.97
R1764:Kalrn UTSW 16 34,033,243 (GRCm39) missense probably damaging 1.00
R1824:Kalrn UTSW 16 34,114,585 (GRCm39) missense probably damaging 1.00
R1845:Kalrn UTSW 16 34,177,331 (GRCm39) missense probably damaging 0.99
R1850:Kalrn UTSW 16 33,796,293 (GRCm39) missense probably damaging 0.98
R1921:Kalrn UTSW 16 34,212,463 (GRCm39) missense probably benign 0.02
R1922:Kalrn UTSW 16 34,212,463 (GRCm39) missense probably benign 0.02
R1991:Kalrn UTSW 16 33,796,108 (GRCm39) missense probably damaging 1.00
R1992:Kalrn UTSW 16 33,796,108 (GRCm39) missense probably damaging 1.00
R2001:Kalrn UTSW 16 33,848,415 (GRCm39) missense probably damaging 1.00
R2025:Kalrn UTSW 16 34,010,106 (GRCm39) missense probably damaging 0.96
R2048:Kalrn UTSW 16 34,072,680 (GRCm39) missense probably benign 0.18
R2076:Kalrn UTSW 16 34,152,513 (GRCm39) missense probably benign 0.15
R2118:Kalrn UTSW 16 34,152,600 (GRCm39) missense possibly damaging 0.84
R2136:Kalrn UTSW 16 34,128,094 (GRCm39) missense possibly damaging 0.82
R2145:Kalrn UTSW 16 33,829,632 (GRCm39) unclassified probably benign
R2193:Kalrn UTSW 16 33,810,180 (GRCm39) missense possibly damaging 0.72
R2195:Kalrn UTSW 16 33,810,180 (GRCm39) missense possibly damaging 0.72
R2234:Kalrn UTSW 16 33,996,632 (GRCm39) splice site probably null
R2404:Kalrn UTSW 16 33,810,180 (GRCm39) missense possibly damaging 0.72
R2405:Kalrn UTSW 16 33,810,180 (GRCm39) missense possibly damaging 0.72
R2408:Kalrn UTSW 16 33,810,180 (GRCm39) missense possibly damaging 0.72
R2411:Kalrn UTSW 16 33,810,180 (GRCm39) missense possibly damaging 0.72
R2570:Kalrn UTSW 16 34,130,865 (GRCm39) missense probably damaging 1.00
R2903:Kalrn UTSW 16 33,810,180 (GRCm39) missense possibly damaging 0.72
R2904:Kalrn UTSW 16 33,810,180 (GRCm39) missense possibly damaging 0.72
R2924:Kalrn UTSW 16 33,810,180 (GRCm39) missense possibly damaging 0.72
R3411:Kalrn UTSW 16 34,032,642 (GRCm39) missense probably benign 0.07
R3693:Kalrn UTSW 16 34,177,685 (GRCm39) missense probably damaging 1.00
R3709:Kalrn UTSW 16 34,212,400 (GRCm39) splice site probably null
R3788:Kalrn UTSW 16 34,040,610 (GRCm39) missense probably damaging 1.00
R3833:Kalrn UTSW 16 33,860,259 (GRCm39) nonsense probably null
R3871:Kalrn UTSW 16 34,024,226 (GRCm39) splice site probably null
R3934:Kalrn UTSW 16 34,130,901 (GRCm39) missense probably benign 0.34
R4033:Kalrn UTSW 16 33,810,180 (GRCm39) missense possibly damaging 0.72
R4056:Kalrn UTSW 16 34,134,579 (GRCm39) missense probably damaging 0.99
R4057:Kalrn UTSW 16 34,134,579 (GRCm39) missense probably damaging 0.99
R4303:Kalrn UTSW 16 34,055,761 (GRCm39) missense probably damaging 1.00
R4402:Kalrn UTSW 16 33,810,180 (GRCm39) missense possibly damaging 0.72
R4444:Kalrn UTSW 16 33,810,180 (GRCm39) missense possibly damaging 0.72
R4482:Kalrn UTSW 16 33,810,180 (GRCm39) missense possibly damaging 0.72
R4487:Kalrn UTSW 16 33,810,180 (GRCm39) missense possibly damaging 0.72
R4558:Kalrn UTSW 16 33,807,578 (GRCm39) missense possibly damaging 0.46
R4572:Kalrn UTSW 16 34,212,412 (GRCm39) missense probably damaging 0.98
R4583:Kalrn UTSW 16 34,055,637 (GRCm39) missense probably damaging 1.00
R4604:Kalrn UTSW 16 34,334,296 (GRCm39) missense possibly damaging 0.46
R4620:Kalrn UTSW 16 33,849,075 (GRCm39) missense probably damaging 0.99
R4651:Kalrn UTSW 16 33,996,761 (GRCm39) missense probably damaging 1.00
R4703:Kalrn UTSW 16 34,024,327 (GRCm39) missense probably damaging 1.00
R4704:Kalrn UTSW 16 34,024,327 (GRCm39) missense probably damaging 1.00
R4705:Kalrn UTSW 16 34,024,327 (GRCm39) missense probably damaging 1.00
R4760:Kalrn UTSW 16 34,018,857 (GRCm39) missense probably damaging 1.00
R4793:Kalrn UTSW 16 33,810,180 (GRCm39) missense possibly damaging 0.72
R4794:Kalrn UTSW 16 33,810,180 (GRCm39) missense possibly damaging 0.72
R4811:Kalrn UTSW 16 34,177,339 (GRCm39) missense probably damaging 1.00
R4816:Kalrn UTSW 16 34,334,389 (GRCm39) unclassified probably benign
R4888:Kalrn UTSW 16 33,991,700 (GRCm39) missense probably damaging 1.00
R4952:Kalrn UTSW 16 34,177,785 (GRCm39) splice site probably null
R5030:Kalrn UTSW 16 33,796,112 (GRCm39) missense probably benign 0.00
R5045:Kalrn UTSW 16 34,134,722 (GRCm39) nonsense probably null
R5117:Kalrn UTSW 16 33,853,971 (GRCm39) critical splice acceptor site probably null
R5289:Kalrn UTSW 16 34,072,711 (GRCm39) missense possibly damaging 0.95
R5426:Kalrn UTSW 16 34,083,023 (GRCm39) missense probably damaging 1.00
R5432:Kalrn UTSW 16 33,873,992 (GRCm39) missense probably damaging 1.00
R5611:Kalrn UTSW 16 33,996,150 (GRCm39) missense probably damaging 1.00
R5629:Kalrn UTSW 16 33,860,304 (GRCm39) missense possibly damaging 0.77
R5635:Kalrn UTSW 16 33,834,454 (GRCm39) missense probably damaging 1.00
R5713:Kalrn UTSW 16 33,836,949 (GRCm39) missense probably benign
R5716:Kalrn UTSW 16 33,807,546 (GRCm39) missense probably benign 0.01
R5772:Kalrn UTSW 16 33,796,190 (GRCm39) missense probably damaging 1.00
R5797:Kalrn UTSW 16 34,032,619 (GRCm39) missense probably damaging 0.98
R5835:Kalrn UTSW 16 33,807,461 (GRCm39) missense probably benign 0.28
R5895:Kalrn UTSW 16 33,795,805 (GRCm39) utr 3 prime probably benign
R5924:Kalrn UTSW 16 34,064,203 (GRCm39) missense probably damaging 1.00
R5999:Kalrn UTSW 16 34,177,713 (GRCm39) missense probably damaging 1.00
R6010:Kalrn UTSW 16 33,830,950 (GRCm39) missense probably benign 0.06
R6052:Kalrn UTSW 16 34,181,255 (GRCm39) missense probably damaging 1.00
R6122:Kalrn UTSW 16 33,805,561 (GRCm39) missense possibly damaging 0.82
R6128:Kalrn UTSW 16 34,033,255 (GRCm39) missense probably damaging 0.99
R6136:Kalrn UTSW 16 34,177,481 (GRCm39) missense probably damaging 1.00
R6178:Kalrn UTSW 16 33,874,009 (GRCm39) missense possibly damaging 0.88
R6229:Kalrn UTSW 16 33,875,441 (GRCm39) missense probably damaging 1.00
R6376:Kalrn UTSW 16 33,796,361 (GRCm39) missense probably benign
R6397:Kalrn UTSW 16 33,813,355 (GRCm39) missense probably damaging 1.00
R6429:Kalrn UTSW 16 34,152,534 (GRCm39) missense possibly damaging 0.85
R6473:Kalrn UTSW 16 34,025,672 (GRCm39) missense probably damaging 1.00
R6481:Kalrn UTSW 16 34,181,354 (GRCm39) missense probably damaging 1.00
R6597:Kalrn UTSW 16 34,003,117 (GRCm39) missense probably damaging 1.00
R6736:Kalrn UTSW 16 34,038,293 (GRCm39) missense probably damaging 1.00
R6808:Kalrn UTSW 16 33,848,346 (GRCm39) missense probably damaging 1.00
R6897:Kalrn UTSW 16 33,796,073 (GRCm39) missense probably damaging 0.99
R6955:Kalrn UTSW 16 34,040,506 (GRCm39) missense probably damaging 1.00
R7060:Kalrn UTSW 16 34,177,418 (GRCm39) missense probably damaging 0.99
R7064:Kalrn UTSW 16 34,038,261 (GRCm39) missense probably damaging 1.00
R7132:Kalrn UTSW 16 34,076,597 (GRCm39) missense unknown
R7154:Kalrn UTSW 16 34,032,527 (GRCm39) critical splice donor site probably null
R7181:Kalrn UTSW 16 33,983,447 (GRCm39) missense probably benign 0.00
R7234:Kalrn UTSW 16 33,996,792 (GRCm39) missense possibly damaging 0.63
R7235:Kalrn UTSW 16 33,996,131 (GRCm39) missense probably benign 0.18
R7504:Kalrn UTSW 16 34,076,603 (GRCm39) missense unknown
R7563:Kalrn UTSW 16 34,212,464 (GRCm39) missense probably damaging 0.97
R7612:Kalrn UTSW 16 34,134,582 (GRCm39) missense possibly damaging 0.68
R7772:Kalrn UTSW 16 33,851,952 (GRCm39) missense probably benign 0.04
R7796:Kalrn UTSW 16 34,007,854 (GRCm39) nonsense probably null
R7867:Kalrn UTSW 16 33,810,161 (GRCm39) missense possibly damaging 0.94
R7869:Kalrn UTSW 16 33,809,217 (GRCm39) missense probably damaging 0.98
R7914:Kalrn UTSW 16 33,849,122 (GRCm39) missense probably benign
R8080:Kalrn UTSW 16 33,796,038 (GRCm39) missense possibly damaging 0.83
R8147:Kalrn UTSW 16 33,875,414 (GRCm39) missense probably benign
R8239:Kalrn UTSW 16 33,870,153 (GRCm39) missense noncoding transcript
R8281:Kalrn UTSW 16 33,855,431 (GRCm39) nonsense probably null
R8294:Kalrn UTSW 16 33,853,954 (GRCm39) missense probably benign 0.12
R8301:Kalrn UTSW 16 34,177,470 (GRCm39) missense probably benign 0.05
R8686:Kalrn UTSW 16 34,181,305 (GRCm39) missense probably damaging 1.00
R8693:Kalrn UTSW 16 33,854,884 (GRCm39) missense probably damaging 1.00
R8798:Kalrn UTSW 16 33,803,225 (GRCm39) missense possibly damaging 0.65
R8878:Kalrn UTSW 16 34,025,696 (GRCm39) missense probably damaging 1.00
R8878:Kalrn UTSW 16 34,018,830 (GRCm39) missense probably benign 0.05
R8880:Kalrn UTSW 16 34,038,305 (GRCm39) missense probably damaging 1.00
R8883:Kalrn UTSW 16 33,814,025 (GRCm39) missense probably damaging 1.00
R8887:Kalrn UTSW 16 34,047,496 (GRCm39) missense probably benign 0.22
R9048:Kalrn UTSW 16 33,854,854 (GRCm39) missense possibly damaging 0.84
R9111:Kalrn UTSW 16 34,181,371 (GRCm39) missense probably damaging 0.96
R9317:Kalrn UTSW 16 33,834,045 (GRCm39) missense
R9424:Kalrn UTSW 16 33,809,188 (GRCm39) missense probably benign 0.06
R9442:Kalrn UTSW 16 33,916,249 (GRCm39) start codon destroyed probably null 0.56
R9445:Kalrn UTSW 16 33,805,600 (GRCm39) missense probably benign 0.13
R9515:Kalrn UTSW 16 33,854,864 (GRCm39) missense probably damaging 1.00
R9516:Kalrn UTSW 16 33,854,864 (GRCm39) missense probably damaging 1.00
R9625:Kalrn UTSW 16 33,849,197 (GRCm39) critical splice acceptor site probably null
R9645:Kalrn UTSW 16 34,032,583 (GRCm39) missense probably benign 0.01
RF014:Kalrn UTSW 16 33,860,303 (GRCm39) missense probably benign 0.01
Z1177:Kalrn UTSW 16 33,855,876 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCACTTAGGTAGAGTGAAAGTC -3'
(R):5'- AGCTATGTGCATGGGTCATTTC -3'

Sequencing Primer
(F):5'- CCCTAGCAGTAGTGATGCATGTC -3'
(R):5'- ATGTGCATGGGTCATTTCTCTATTTC -3'
Posted On 2014-08-25