Mutagenetix > Incidental Mutation

Incidental Mutation 'R2011:Prkg1'

219826

Institutional Source

Beutler Lab

Gene Symbol

Prkg1

Ensembl Gene

ENSMUSG00000052920

Gene Name

protein kinase, cGMP-dependent, type I

Synonyms

Prkgr1b, Prkg1b

MMRRC Submission

040020-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.728) question?

Stock #

R2011 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

30567551-31765033 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 31664142 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 47 (D47G)

Ref Sequence

ENSEMBL: ENSMUSP00000073268 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000065067] [ENSMUST00000073581]

AlphaFold

P0C605

Predicted Effect

probably benign
Transcript: ENSMUST00000065067

SMART Domains

Protein: ENSMUSP00000067576
Gene: ENSMUSG00000052920

Domain	Start	End	E-Value	Type
coiled coil region	5	49	N/A	INTRINSIC
cNMP	103	216	6.37e-27	SMART
cNMP	221	343	1.23e-33	SMART
S_TKc	360	619	5.25e-91	SMART
S_TK_X	620	671	1.55e-10	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000073581
AA Change: D47G

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000073268
Gene: ENSMUSG00000052920
AA Change: D47G

Domain	Start	End	E-Value	Type
coiled coil region	10	62	N/A	INTRINSIC
cNMP	118	231	6.37e-27	SMART
cNMP	236	358	1.23e-33	SMART
S_TKc	375	634	5.25e-91	SMART
S_TK_X	635	686	1.55e-10	SMART

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.2%
20x: 95.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mammals have three different isoforms of cyclic GMP-dependent protein kinase (Ialpha, Ibeta, and II). These PRKG isoforms act as key mediators of the nitric oxide/cGMP signaling pathway and are important components of many signal transduction processes in diverse cell types. This PRKG1 gene on human chromosome 10 encodes the soluble Ialpha and Ibeta isoforms of PRKG by alternative transcript splicing. A separate gene on human chromosome 4, PRKG2, encodes the membrane-bound PRKG isoform II. The PRKG1 proteins play a central role in regulating cardiovascular and neuronal functions in addition to relaxing smooth muscle tone, preventing platelet aggregation, and modulating cell growth. This gene is most strongly expressed in all types of smooth muscle, platelets, cerebellar Purkinje cells, hippocampal neurons, and the lateral amygdala. Isoforms Ialpha and Ibeta have identical cGMP-binding and catalytic domains but differ in their leucine/isoleucine zipper and autoinhibitory sequences and therefore differ in their dimerization substrates and kinase enzyme activity. [provided by RefSeq, Sep 2011]
PHENOTYPE: Mutant mice exhibit abnormal smooth muscle function and penile erectile deficiency. Conditional disruption in the hippocampus results in impaired LTP. Mice homozygous for a transposon induced allele exhibit postnatal lethality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 107 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930430F08Rik	T	G	10: 100,583,958	D58A	probably damaging	Het
Abhd6	A	T	14: 8,042,742	T100S	probably benign	Het
Adam6a	T	C	12: 113,545,378	I457T	probably benign	Het
Aff3	T	C	1: 38,207,915	N863S	probably benign	Het
Agk	C	A	6: 40,376,234	D177E	probably benign	Het
Alg9	C	T	9: 50,788,200	A209V	probably damaging	Het
Arl6	A	T	16: 59,624,313	I51K	probably damaging	Het
Bpi	A	T	2: 158,261,352	H89L	probably damaging	Het
C1qtnf1	T	A	11: 118,448,284	F260Y	probably benign	Het
Cblc	T	A	7: 19,784,822	D452V	probably benign	Het
Ccar1	T	C	10: 62,776,694	T231A	probably benign	Het
Ccdc112	A	G	18: 46,287,432	L417P	probably damaging	Het
Ccdc144b	A	T	3: 36,010,678	C515*	probably null	Het
Ccdc34	G	A	2: 110,044,304	R336Q	possibly damaging	Het
CK137956	A	G	4: 127,951,036	S305P	probably benign	Het
Clip2	T	C	5: 134,503,115	D612G	probably damaging	Het
Col28a1	T	C	6: 8,059,360	T692A	probably benign	Het
Copg2	A	T	6: 30,816,741		probably null	Het
Ctnna2	T	A	6: 76,973,791	I566F	possibly damaging	Het
Cux2	C	T	5: 121,861,326	D1184N	probably benign	Het
Dclk3	A	G	9: 111,468,354	E322G	probably benign	Het
Ddx41	A	T	13: 55,534,093		probably null	Het
Dnaaf2	G	A	12: 69,196,785	P107S	probably damaging	Het
Eif2ak4	A	G	2: 118,430,947	E578G	probably damaging	Het
Exd1	A	G	2: 119,528,663		probably benign	Het
Fat2	G	A	11: 55,282,757	P2377S	probably damaging	Het
Fbxl18	T	C	5: 142,872,459	T741A	probably benign	Het
Fgr	C	A	4: 132,997,521	A311E	probably damaging	Het
Fmo4	T	C	1: 162,798,889	T363A	probably damaging	Het
Fsbp	T	C	4: 11,584,006	V235A	probably benign	Het
Gm1110	T	A	9: 26,894,258	H366L	probably benign	Het
Gm43302	T	C	5: 105,290,980	N14S	probably damaging	Het
Gm5422	A	G	10: 31,248,768		noncoding transcript	Het
Gpr21	A	G	2: 37,517,535	E31G	probably damaging	Het
Gucy1b2	G	T	14: 62,408,758	N560K	probably damaging	Het
Hmcn1	T	C	1: 150,677,334	Q2535R	probably benign	Het
Hnrnpm	A	T	17: 33,664,624	N264K	probably damaging	Het
Hyal6	A	T	6: 24,734,724	I219L	possibly damaging	Het
Ifi211	A	G	1: 173,907,603	S87P	probably damaging	Het
Il17rb	A	T	14: 29,996,840	C428*	probably null	Het
Iqca	T	C	1: 90,045,626	N808S	probably benign	Het
Kcnu1	A	G	8: 25,918,442	I94V	probably benign	Het
Lrba	A	T	3: 86,310,017	E517V	probably damaging	Het
Mcidas	A	G	13: 112,993,981	E37G	possibly damaging	Het
Med23	T	A	10: 24,879,755	F83L	possibly damaging	Het
Micu2	T	C	14: 57,954,133		probably null	Het
Mrgprx2	A	T	7: 48,482,534	C179S	probably damaging	Het
Myo6	A	G	9: 80,307,722	T1236A	probably damaging	Het
Myo7a	A	T	7: 98,054,708	V1946E	possibly damaging	Het
Nek10	A	T	14: 14,885,122	Y695F	probably damaging	Het
Nr3c2	A	T	8: 76,909,793	I508F	possibly damaging	Het
Olfr1056	A	T	2: 86,356,186	H65Q	possibly damaging	Het
Olfr1133	A	T	2: 87,645,889	I78N	probably damaging	Het
Olfr12	T	C	1: 92,620,749	V281A	probably benign	Het
Olfr307	A	T	7: 86,335,747	Y216*	probably null	Het
Olfr695	T	C	7: 106,873,427	I273V	probably benign	Het
Olfr743	T	C	14: 50,533,684	S91P	probably damaging	Het
Oxct1	T	C	15: 4,153,761	S485P	probably benign	Het
Oxt	A	G	2: 130,576,652	D61G	probably damaging	Het
P2ry10	A	C	X: 107,102,635	I59L	probably damaging	Het
Parp11	A	G	6: 127,477,891	N124S	probably benign	Het
Pcdh7	T	A	5: 57,719,629	N175K	probably damaging	Het
Pdgfrb	T	A	18: 61,061,494	S114R	probably benign	Het
Pfdn5	A	G	15: 102,326,521	N54S	possibly damaging	Het
Phc2	T	A	4: 128,723,585	V468E	probably benign	Het
Piezo2	T	C	18: 63,059,744	T1605A	probably damaging	Het
Pik3cb	A	T	9: 99,105,579	Y35*	probably null	Het
Piwil2	A	T	14: 70,426,634	M22K	probably damaging	Het
Plag1	A	G	4: 3,904,889	F101L	probably damaging	Het
Pomt2	A	G	12: 87,111,399	L680P	possibly damaging	Het
Ppp1r36	A	G	12: 76,418,926		probably null	Het
Prkag2	C	T	5: 24,871,054		probably null	Het
Prl6a1	G	A	13: 27,315,369	G45D	probably benign	Het
Rbm20	G	A	19: 53,859,428	C1135Y	probably damaging	Het
Recql5	A	T	11: 115,897,097	N465K	probably benign	Het
Rtcb	A	T	10: 85,941,933	I459N	probably damaging	Het
Rtp3	A	T	9: 110,986,034		probably benign	Het
Rundc3b	T	A	5: 8,512,409		probably null	Het
Scube3	A	G	17: 28,168,158	T877A	probably damaging	Het
Sh2d4a	A	T	8: 68,346,742	Q421L	probably benign	Het
Siglec1	A	T	2: 131,083,357	Y395N	probably damaging	Het
Slc6a1	G	T	6: 114,307,770	G263V	probably damaging	Het
Slco1c1	T	A	6: 141,555,107	F437L	probably benign	Het
Slco3a1	G	A	7: 74,346,671	A329V	probably benign	Het
Spag9	T	A	11: 94,092,375	L504*	probably null	Het
Spen	A	T	4: 141,473,329	N2662K	probably damaging	Het
Sptb	G	C	12: 76,632,472	R70G	possibly damaging	Het
Stk3	A	G	15: 35,072,498	S136P	probably damaging	Het
Synj1	A	T	16: 90,938,696	F1456L	probably damaging	Het
Tbx5	T	C	5: 119,841,906		probably null	Het
Tchh	G	A	3: 93,446,961	R1236Q	unknown	Het
Timd4	C	A	11: 46,820,030	T253K	possibly damaging	Het
Tmc6	A	G	11: 117,769,406	Y669H	probably damaging	Het
Tmem151a	C	T	19: 5,082,938	R80H	probably benign	Het
Tpgs1	T	C	10: 79,675,888	L288P	probably damaging	Het
Trhde	T	C	10: 114,498,793	I659V	probably benign	Het
Trpm7	A	T	2: 126,823,997	Y896*	probably null	Het
Ttc5	C	A	14: 50,781,550	E37*	probably null	Het
Uvrag	A	G	7: 98,939,889		probably null	Het
Vmn1r59	T	A	7: 5,454,284	D159V	probably damaging	Het
Vmn2r78	G	A	7: 86,955,079	V822M	possibly damaging	Het
Vnn1	C	A	10: 23,894,971	Y32*	probably null	Het
Wrn	A	G	8: 33,236,404	V1380A	probably benign	Het
Zc3h14	A	C	12: 98,780,268	S579R	possibly damaging	Het
Zfp277	G	A	12: 40,317,218	Q480*	probably null	Het
Zfp456	G	A	13: 67,366,874	Q238*	probably null	Het
Zranb3	T	A	1: 128,091,901	T35S	probably benign	Het

Other mutations in Prkg1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00159:Prkg1	APN	19	31302340	missense	probably benign	0.02
IGL00481:Prkg1	APN	19	30571622	missense	probably benign	0.28
IGL00517:Prkg1	APN	19	30894668	missense	probably benign
IGL00782:Prkg1	APN	19	30578753	splice site	probably benign
IGL01070:Prkg1	APN	19	30569343	splice site	probably benign
IGL01106:Prkg1	APN	19	30585278	missense	probably benign	0.05
IGL01783:Prkg1	APN	19	30624689	missense	probably damaging	1.00
IGL02135:Prkg1	APN	19	30993076	missense	probably benign	0.13
IGL02492:Prkg1	APN	19	30724202	missense	probably damaging	1.00
IGL02543:Prkg1	APN	19	30624734	missense	possibly damaging	0.62
IGL02733:Prkg1	APN	19	31302301	missense	probably damaging	1.00
IGL03129:Prkg1	APN	19	30585281	nonsense	probably null
IGL03220:Prkg1	APN	19	30569237	utr 3 prime	probably benign
R0363:Prkg1	UTSW	19	31664196	missense	probably damaging	1.00
R0693:Prkg1	UTSW	19	30594978	missense	probably benign
R1099:Prkg1	UTSW	19	30571612	missense	probably benign
R1464:Prkg1	UTSW	19	30578870	missense	probably damaging	0.99
R1464:Prkg1	UTSW	19	30578870	missense	probably damaging	0.99
R1556:Prkg1	UTSW	19	30624743	missense	probably benign
R1738:Prkg1	UTSW	19	30786922	missense	possibly damaging	0.48
R1974:Prkg1	UTSW	19	31585695	missense	probably damaging	1.00
R2207:Prkg1	UTSW	19	30578860	missense	probably damaging	1.00
R2270:Prkg1	UTSW	19	30578631	missense	probably benign	0.27
R3009:Prkg1	UTSW	19	31664112	missense	possibly damaging	0.74
R4078:Prkg1	UTSW	19	31585578	missense	probably damaging	1.00
R4355:Prkg1	UTSW	19	30569229	utr 3 prime	probably benign
R4652:Prkg1	UTSW	19	30595012	missense	probably damaging	1.00
R4669:Prkg1	UTSW	19	31664239	missense	probably damaging	0.98
R4684:Prkg1	UTSW	19	31664179	nonsense	probably null
R4789:Prkg1	UTSW	19	31585645	missense	probably damaging	0.97
R4826:Prkg1	UTSW	19	31764606	missense	possibly damaging	0.93
R4936:Prkg1	UTSW	19	30586375	missense	probably benign	0.37
R5625:Prkg1	UTSW	19	31764762	missense	possibly damaging	0.95
R5819:Prkg1	UTSW	19	31585672	missense	probably benign	0.02
R5855:Prkg1	UTSW	19	30894694	missense	possibly damaging	0.93
R5882:Prkg1	UTSW	19	31585697	missense	probably damaging	1.00
R5965:Prkg1	UTSW	19	30724156	splice site	probably null
R5968:Prkg1	UTSW	19	30592924	missense	probably damaging	1.00
R6310:Prkg1	UTSW	19	30569251	missense	probably damaging	1.00
R6433:Prkg1	UTSW	19	30781346	missense	probably benign	0.21
R6702:Prkg1	UTSW	19	30993084	missense	probably benign	0.00
R6750:Prkg1	UTSW	19	31764561	missense	probably benign	0.41
R6894:Prkg1	UTSW	19	30624774	nonsense	probably null
R7155:Prkg1	UTSW	19	31302301	missense	probably damaging	1.00
R7165:Prkg1	UTSW	19	30585199	missense	probably damaging	1.00
R7238:Prkg1	UTSW	19	30624690	missense	probably damaging	1.00
R7428:Prkg1	UTSW	19	30578835	missense	probably damaging	1.00
R7748:Prkg1	UTSW	19	30993091	missense	possibly damaging	0.90
R7804:Prkg1	UTSW	19	30578632	missense	probably benign	0.00
R7804:Prkg1	UTSW	19	30624770	missense	possibly damaging	0.92
R7893:Prkg1	UTSW	19	30586367	missense	probably damaging	0.99
R8304:Prkg1	UTSW	19	30724184	missense	possibly damaging	0.75
R8497:Prkg1	UTSW	19	31302309	missense	probably damaging	1.00
R8676:Prkg1	UTSW	19	31764746	missense	probably damaging	0.98
R9318:Prkg1	UTSW	19	30571638	missense	probably benign	0.09
R9694:Prkg1	UTSW	19	30786971	missense	possibly damaging	0.84
X0011:Prkg1	UTSW	19	30993121	missense	probably damaging	1.00
Z1177:Prkg1	UTSW	19	31302373	missense	probably damaging	0.97

Predicted Primers

PCR Primer
(F):5'- TAACCCTGCTTACTGTGGGC -3'
(R):5'- CTTTAGGGAAAGTTGATCCGAGAGG -3'

Sequencing Primer
(F):5'- CTCTTGGGGTAGAAGGGCAG -3'
(R):5'- GAGGAAGCCCCAAGACGC -3'

Posted On

2014-08-25