Incidental Mutation 'R2012:Aox3'
ID219836
Institutional Source Beutler Lab
Gene Symbol Aox3
Ensembl Gene ENSMUSG00000064294
Gene Namealdehyde oxidase 3
SynonymsAOH1, 1200011D03Rik
MMRRC Submission 040021-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2012 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location58113130-58200698 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 58138232 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 202 (Y202F)
Ref Sequence ENSEMBL: ENSMUSP00000140140 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040999] [ENSMUST00000162011]
Predicted Effect probably benign
Transcript: ENSMUST00000040999
AA Change: Y202F

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000049391
Gene: ENSMUSG00000064294
AA Change: Y202F

DomainStartEndE-ValueType
Pfam:Fer2 12 82 1.4e-9 PFAM
Pfam:Fer2_2 91 165 1e-29 PFAM
Pfam:FAD_binding_5 239 419 1e-44 PFAM
CO_deh_flav_C 426 530 9.26e-24 SMART
Ald_Xan_dh_C 594 697 2.27e-41 SMART
Pfam:Ald_Xan_dh_C2 708 1241 8.7e-183 PFAM
low complexity region 1275 1286 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162011
AA Change: Y202F

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000140140
Gene: ENSMUSG00000064294
AA Change: Y202F

DomainStartEndE-ValueType
Pfam:Fer2 12 82 3.6e-8 PFAM
Pfam:Fer2_2 91 166 2.5e-29 PFAM
transmembrane domain 242 264 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 92.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 109 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam22 A T 5: 8,117,634 S675R probably damaging Het
Akap5 A T 12: 76,329,348 H518L possibly damaging Het
Ankfn1 T C 11: 89,405,597 D102G probably damaging Het
Arhgef37 G A 18: 61,504,356 L412F possibly damaging Het
B4galt3 C T 1: 171,272,548 P121L probably damaging Het
BC034090 C T 1: 155,221,432 R640Q probably damaging Het
Bhmt A T 13: 93,625,392 Y128N probably damaging Het
Bin3 A G 14: 70,134,773 E173G probably damaging Het
C1qtnf1 T A 11: 118,448,284 F260Y probably benign Het
Ccdc14 G T 16: 34,690,722 G22V possibly damaging Het
Ccnc A T 4: 21,741,955 I135L possibly damaging Het
Chd3 T C 11: 69,349,052 D1650G probably benign Het
Cherp A C 8: 72,474,769 N14K probably damaging Het
Clint1 C T 11: 45,894,092 T306I possibly damaging Het
Cyb5r1 T A 1: 134,407,577 Y85N probably damaging Het
D830013O20Rik A G 12: 73,371,388 noncoding transcript Het
Dapk1 A T 13: 60,721,857 K304N probably damaging Het
Dnah6 T A 6: 73,067,466 N3169Y probably damaging Het
Dync2h1 A T 9: 7,169,589 I296K probably benign Het
Elp2 A T 18: 24,631,458 T621S probably benign Het
Eml6 G T 11: 29,831,128 Q635K possibly damaging Het
Exph5 G A 9: 53,367,166 M192I possibly damaging Het
Fmnl2 A G 2: 53,105,537 E424G probably damaging Het
Gas6 C T 8: 13,468,266 V523M probably damaging Het
Ggn A T 7: 29,173,763 probably null Het
Gimap8 A G 6: 48,656,353 T369A probably damaging Het
Gm13101 A T 4: 143,966,067 D121E probably benign Het
Grm5 T C 7: 88,074,872 I790T probably damaging Het
Gtpbp6 G A 5: 110,104,924 A354V probably damaging Het
Habp4 G A 13: 64,170,181 probably null Het
Has2 A G 15: 56,667,868 W484R probably damaging Het
Herc4 G T 10: 63,244,038 probably benign Het
Igf2 C A 7: 142,654,399 E106D probably damaging Het
Il17rb A T 14: 29,996,840 C428* probably null Het
Ipo11 A T 13: 106,919,622 N47K probably benign Het
Itga4 T G 2: 79,277,794 S197A probably damaging Het
Itpr1 T A 6: 108,440,536 M1788K probably benign Het
Kbtbd3 C T 9: 4,330,919 T431I probably benign Het
Kif5a A T 10: 127,239,175 V523E probably benign Het
Klhl41 A T 2: 69,683,496 D573V possibly damaging Het
Kndc1 C A 7: 139,921,280 H828Q possibly damaging Het
Leng8 T A 7: 4,143,610 V407D probably damaging Het
Mamdc2 C T 19: 23,310,851 E608K probably benign Het
Mcf2 T A X: 60,077,214 R850S probably damaging Het
Mmp2 A G 8: 92,850,203 N618S probably benign Het
Morn5 A T 2: 36,052,938 M17L probably benign Het
Nme8 T C 13: 19,696,883 N26S probably damaging Het
Nostrin C A 2: 69,144,767 probably null Het
Npy4r T A 14: 34,147,197 I45F possibly damaging Het
Olfr1163 A G 2: 88,070,719 V221A probably benign Het
Olfr1242 A G 2: 89,493,998 F105L probably benign Het
Olfr170 C T 16: 19,606,131 C179Y probably benign Het
Olfr263 T A 13: 21,133,489 M238K probably benign Het
Olfr317 T C 11: 58,732,388 Y259C possibly damaging Het
Olfr339 A G 2: 36,421,919 I174V probably benign Het
Olfr532 T A 7: 140,419,111 I221F probably damaging Het
Oxt A G 2: 130,576,652 D61G probably damaging Het
Patl1 T C 19: 11,939,817 L676P probably damaging Het
Pcdhb20 G A 18: 37,505,074 G218R probably damaging Het
Pdgfrb T A 18: 61,061,494 S114R probably benign Het
Pfdn5 A G 15: 102,326,521 N54S possibly damaging Het
Phldb1 G T 9: 44,728,036 T15N possibly damaging Het
Pink1 A C 4: 138,318,005 S253A probably null Het
Plag1 A T 4: 3,904,870 L107Q probably damaging Het
Pld5 C A 1: 175,964,013 V476L probably benign Het
Prrt2 C T 7: 127,019,409 A295T probably damaging Het
Ptgs1 A G 2: 36,237,656 I76V probably benign Het
Ptprz1 A G 6: 23,001,027 T1039A probably benign Het
Rbm20 G A 19: 53,859,428 C1135Y probably damaging Het
Recql5 A T 11: 115,897,097 N465K probably benign Het
Rgs12 A G 5: 35,030,528 S510G probably benign Het
Satb1 G A 17: 51,782,788 Q344* probably null Het
Sdr16c5 A G 4: 3,996,244 I283T probably benign Het
Serpinb3c T C 1: 107,271,844 S316G possibly damaging Het
Siglec1 A T 2: 131,083,357 Y395N probably damaging Het
Simc1 A G 13: 54,503,888 I5V probably benign Het
Slc27a2 T C 2: 126,553,615 V154A probably damaging Het
Slc27a5 A G 7: 12,997,707 L119S probably damaging Het
Slc35g2 T A 9: 100,553,067 T184S possibly damaging Het
Slc4a7 C T 14: 14,733,727 R46* probably null Het
Smcr8 T C 11: 60,778,184 F53L probably damaging Het
Spag9 T A 11: 94,092,375 L504* probably null Het
Spata31d1a A G 13: 59,702,556 I586T possibly damaging Het
Spata31d1c A T 13: 65,035,227 E194D possibly damaging Het
Spats2 A G 15: 99,178,494 E151G probably damaging Het
Sugp2 T A 8: 70,243,211 L278Q possibly damaging Het
Sult2a7 T A 7: 14,473,397 probably benign Het
Syde2 G T 3: 145,988,408 G137V possibly damaging Het
Synj1 A T 16: 90,938,696 F1456L probably damaging Het
Szt2 A G 4: 118,363,665 probably benign Het
Timd4 C A 11: 46,820,030 T253K possibly damaging Het
Tlr3 G T 8: 45,402,786 T119N possibly damaging Het
Tmc6 A G 11: 117,769,406 Y669H probably damaging Het
Tmem221 T C 8: 71,555,814 E194G probably benign Het
Tmem232 C A 17: 65,500,172 V9F probably benign Het
Tpm1 G A 9: 67,033,965 Q135* probably null Het
Trank1 A G 9: 111,365,028 T707A probably benign Het
Trpm7 A T 2: 126,823,997 Y896* probably null Het
Tuba4a A T 1: 75,216,339 Y210* probably null Het
Vegfa T G 17: 46,025,358 I279L probably benign Het
Vmn2r54 T A 7: 12,615,877 T593S probably damaging Het
Vmn2r93 A G 17: 18,316,578 I508V probably benign Het
Vps33a G T 5: 123,531,181 probably null Het
Wasl T A 6: 24,624,361 N231I probably damaging Het
Zbtb39 A G 10: 127,742,834 N426D probably benign Het
Zcchc6 A G 13: 59,811,538 V372A probably damaging Het
Zeb2 T G 2: 44,997,950 H350P probably damaging Het
Zfp112 T C 7: 24,125,300 F231S possibly damaging Het
Zfp180 T C 7: 24,104,518 S121P probably benign Het
Other mutations in Aox3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01599:Aox3 APN 1 58169794 missense probably damaging 1.00
IGL01747:Aox3 APN 1 58159658 missense probably damaging 0.97
IGL01883:Aox3 APN 1 58138283 missense probably damaging 1.00
IGL01911:Aox3 APN 1 58152560 missense probably benign 0.04
IGL02017:Aox3 APN 1 58120992 missense probably damaging 1.00
IGL02120:Aox3 APN 1 58127650 missense probably benign 0.00
IGL02466:Aox3 APN 1 58158272 missense probably benign 0.28
IGL02545:Aox3 APN 1 58183486 missense probably damaging 1.00
IGL02572:Aox3 APN 1 58158367 missense probably damaging 1.00
IGL02746:Aox3 APN 1 58183542 missense possibly damaging 0.83
IGL02808:Aox3 APN 1 58142700 missense probably damaging 0.99
IGL02812:Aox3 APN 1 58165896 missense probably benign 0.00
IGL02982:Aox3 APN 1 58127687 missense probably benign 0.00
IGL03056:Aox3 APN 1 58159021 critical splice donor site probably null
IGL03182:Aox3 APN 1 58165887 missense probably benign 0.02
IGL03234:Aox3 APN 1 58152686 missense probably benign
IGL03374:Aox3 APN 1 58171848 missense probably damaging 1.00
amber UTSW 1 58171891 nonsense probably null
R0071:Aox3 UTSW 1 58171891 nonsense probably null
R0071:Aox3 UTSW 1 58171891 nonsense probably null
R0135:Aox3 UTSW 1 58125088 splice site probably benign
R0332:Aox3 UTSW 1 58142751 missense probably benign 0.00
R0626:Aox3 UTSW 1 58172299 missense possibly damaging 0.94
R1325:Aox3 UTSW 1 58176567 nonsense probably null
R1435:Aox3 UTSW 1 58163446 critical splice donor site probably null
R1438:Aox3 UTSW 1 58153178 missense probably benign
R1567:Aox3 UTSW 1 58194693 missense probably damaging 0.96
R1575:Aox3 UTSW 1 58152554 missense probably benign 0.04
R1759:Aox3 UTSW 1 58170646 splice site probably null
R1785:Aox3 UTSW 1 58169843 missense probably damaging 1.00
R1786:Aox3 UTSW 1 58169843 missense probably damaging 1.00
R1921:Aox3 UTSW 1 58180651 missense probably damaging 1.00
R1984:Aox3 UTSW 1 58153061 missense possibly damaging 0.88
R2080:Aox3 UTSW 1 58186280 missense probably benign 0.06
R2121:Aox3 UTSW 1 58152549 splice site probably benign
R2126:Aox3 UTSW 1 58158216 missense probably benign 0.25
R2130:Aox3 UTSW 1 58169843 missense probably damaging 1.00
R2131:Aox3 UTSW 1 58169843 missense probably damaging 1.00
R2132:Aox3 UTSW 1 58169843 missense probably damaging 1.00
R2133:Aox3 UTSW 1 58169843 missense probably damaging 1.00
R2385:Aox3 UTSW 1 58138289 missense probably damaging 1.00
R2495:Aox3 UTSW 1 58188408 missense probably damaging 0.99
R4200:Aox3 UTSW 1 58188378 missense probably damaging 1.00
R4231:Aox3 UTSW 1 58114885 missense probably benign 0.12
R4591:Aox3 UTSW 1 58152656 missense probably damaging 0.99
R4627:Aox3 UTSW 1 58125035 missense probably damaging 0.98
R4831:Aox3 UTSW 1 58152566 missense probably damaging 0.97
R4864:Aox3 UTSW 1 58176487 missense probably damaging 1.00
R4976:Aox3 UTSW 1 58188524 critical splice donor site probably null
R5007:Aox3 UTSW 1 58163424 missense probably benign
R5119:Aox3 UTSW 1 58188524 critical splice donor site probably null
R5175:Aox3 UTSW 1 58172328 missense probably benign 0.01
R5360:Aox3 UTSW 1 58146508 missense probably damaging 1.00
R5784:Aox3 UTSW 1 58153499 missense probably benign 0.00
R6050:Aox3 UTSW 1 58180655 missense possibly damaging 0.93
R6056:Aox3 UTSW 1 58169859 missense probably damaging 1.00
R6162:Aox3 UTSW 1 58159731 missense possibly damaging 0.75
R6181:Aox3 UTSW 1 58158946 missense probably benign 0.03
R6374:Aox3 UTSW 1 58172161 missense probably benign 0.11
R6662:Aox3 UTSW 1 58118615 missense probably damaging 1.00
R6809:Aox3 UTSW 1 58118681 missense probably damaging 0.99
R6810:Aox3 UTSW 1 58141431 missense probably benign 0.00
R6821:Aox3 UTSW 1 58150388 missense probably benign 0.04
R7039:Aox3 UTSW 1 58176555 missense probably damaging 1.00
R7116:Aox3 UTSW 1 58153530 missense probably benign 0.01
R7146:Aox3 UTSW 1 58158529 intron probably null
R7163:Aox3 UTSW 1 58119512 missense probably damaging 0.99
R7243:Aox3 UTSW 1 58138307 missense unknown
R7319:Aox3 UTSW 1 58152602 missense probably benign 0.04
R7423:Aox3 UTSW 1 58121069 missense possibly damaging 0.80
R7664:Aox3 UTSW 1 58119539 missense probably damaging 1.00
R7709:Aox3 UTSW 1 58180651 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGCTTTCTGCAGCCCTGT -3'
(R):5'- GCTCTGGAGGGCTACATAGTAC -3'

Sequencing Primer
(F):5'- TGCAGCCCTGTCTTATTCTC -3'
(R):5'- GGGCTACATAGTACAAAGTGACCC -3'
Posted On2014-08-25