Incidental Mutation 'R0136:Slc12a8'
ID21984
Institutional Source Beutler Lab
Gene Symbol Slc12a8
Ensembl Gene ENSMUSG00000035506
Gene Namesolute carrier family 12 (potassium/chloride transporters), member 8
Synonyms
MMRRC Submission 038421-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0136 (G1)
Quality Score225
Status Validated (trace)
Chromosome16
Chromosomal Location33517328-33664135 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 33608213 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 297 (D297G)
Ref Sequence ENSEMBL: ENSMUSP00000113164 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059056] [ENSMUST00000117134] [ENSMUST00000119173] [ENSMUST00000121925] [ENSMUST00000122314] [ENSMUST00000122427]
Predicted Effect probably damaging
Transcript: ENSMUST00000059056
AA Change: D297G

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000062337
Gene: ENSMUSG00000035506
AA Change: D297G

DomainStartEndE-ValueType
Pfam:AA_permease_2 38 410 4e-24 PFAM
Pfam:AA_permease 43 409 5.3e-51 PFAM
low complexity region 481 496 N/A INTRINSIC
transmembrane domain 585 607 N/A INTRINSIC
transmembrane domain 612 634 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000117134
AA Change: D51G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000112925
Gene: ENSMUSG00000035506
AA Change: D51G

DomainStartEndE-ValueType
Pfam:AA_permease 1 163 3.5e-22 PFAM
low complexity region 235 250 N/A INTRINSIC
transmembrane domain 339 361 N/A INTRINSIC
transmembrane domain 366 388 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000119173
AA Change: D266G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000113633
Gene: ENSMUSG00000035506
AA Change: D266G

DomainStartEndE-ValueType
Pfam:AA_permease_2 7 266 4.2e-15 PFAM
Pfam:AA_permease 12 267 1.9e-37 PFAM
transmembrane domain 295 317 N/A INTRINSIC
low complexity region 401 416 N/A INTRINSIC
transmembrane domain 505 527 N/A INTRINSIC
transmembrane domain 532 554 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000121925
AA Change: D297G

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000112439
Gene: ENSMUSG00000035506
AA Change: D297G

DomainStartEndE-ValueType
Pfam:AA_permease_2 38 409 2.4e-23 PFAM
Pfam:AA_permease 43 409 5e-50 PFAM
low complexity region 481 496 N/A INTRINSIC
transmembrane domain 585 607 N/A INTRINSIC
transmembrane domain 612 634 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000122314
AA Change: D51G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113901
Gene: ENSMUSG00000035506
AA Change: D51G

DomainStartEndE-ValueType
Pfam:AA_permease 1 163 3.3e-22 PFAM
low complexity region 235 250 N/A INTRINSIC
transmembrane domain 339 361 N/A INTRINSIC
transmembrane domain 366 388 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000122427
AA Change: D297G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113164
Gene: ENSMUSG00000035506
AA Change: D297G

DomainStartEndE-ValueType
Pfam:AA_permease_2 38 386 7.7e-18 PFAM
Pfam:AA_permease 43 381 1.3e-44 PFAM
low complexity region 455 470 N/A INTRINSIC
Meta Mutation Damage Score 0.3709 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 93.3%
Validation Efficiency 89% (56/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is thought to be a candidate for psoriasis susceptibility. Several alternatively spliced transcript variants of this gene have been described, but the full-length nature of some of these variants has not been determined. [provided by RefSeq, Sep 2010]
PHENOTYPE: Mice homozygous for disruptions in this gene display a normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ap4b1 T C 3: 103,809,946 M1T probably null Het
Arg2 T C 12: 79,150,006 L167P probably damaging Het
Atxn1 A G 13: 45,567,169 S417P probably damaging Het
Baz2b A G 2: 59,901,954 V1949A probably benign Het
Bcl3 A G 7: 19,809,569 V324A probably damaging Het
Btbd10 A T 7: 113,329,878 S230T possibly damaging Het
Camta1 A G 4: 151,078,969 S1479P probably damaging Het
Cd69 C T 6: 129,270,062 S64N probably benign Het
Col5a1 T C 2: 28,024,831 L153P probably damaging Het
Crat C A 2: 30,407,030 V304L probably benign Het
Csmd3 T C 15: 47,847,131 T1687A probably benign Het
Dnah1 C T 14: 31,276,158 G2574D probably damaging Het
Fau T C 19: 6,059,180 V86A possibly damaging Het
Garem1 T G 18: 21,129,991 S589R probably damaging Het
Gbp3 T G 3: 142,564,101 probably null Het
Gin1 T A 1: 97,783,016 S141R possibly damaging Het
Gtf2h1 A T 7: 46,815,416 Q419L possibly damaging Het
Hipk3 A G 2: 104,439,293 I517T probably benign Het
Hivep2 T C 10: 14,131,878 S1407P probably benign Het
Hnrnpk G T 13: 58,395,177 D211E probably benign Het
Hnrnpul2 T C 19: 8,826,801 L588P probably damaging Het
Il18rap A T 1: 40,525,058 H112L probably benign Het
Itgb1 T G 8: 128,722,854 Y585D possibly damaging Het
Kmt2d C T 15: 98,854,278 probably benign Het
Map7d1 A T 4: 126,236,631 probably null Het
Me2 A G 18: 73,770,673 S575P probably benign Het
Med13l A G 5: 118,724,050 T353A probably benign Het
Mgat4b T C 11: 50,231,081 V143A possibly damaging Het
Mlxip T A 5: 123,442,306 W211R probably damaging Het
Morc2a T G 11: 3,685,907 probably null Het
Muc4 A T 16: 32,750,195 probably benign Het
Ndufa10 A T 1: 92,463,128 Y233* probably null Het
Nek8 C T 11: 78,171,207 S237N probably benign Het
Neto1 G A 18: 86,461,320 R211Q probably benign Het
Nfatc2ip A G 7: 126,391,335 S165P probably benign Het
Nsd2 A G 5: 33,855,536 K404E possibly damaging Het
Nsd3 G T 8: 25,659,854 E352* probably null Het
Nudt9 A G 5: 104,047,106 T23A probably benign Het
Olfr394 T C 11: 73,887,785 M196V probably benign Het
Olfr394 C T 11: 73,887,830 V181I probably benign Het
Olfr983 A G 9: 40,092,019 *312Q probably null Het
Patj C A 4: 98,667,648 Q297K probably damaging Het
Pelo A T 13: 115,088,903 C40* probably null Het
Pnpla3 G A 15: 84,174,478 probably null Het
Pramel1 C A 4: 143,397,446 N230K probably damaging Het
Psg20 A C 7: 18,682,507 L228R probably damaging Het
Rsph10b T C 5: 143,959,821 F44L probably benign Het
Sept2 G A 1: 93,507,050 G358R possibly damaging Het
Slamf7 G A 1: 171,648,931 probably benign Het
Slc17a5 G A 9: 78,578,674 A43V probably damaging Het
Slc22a1 A T 17: 12,662,596 F335L probably benign Het
Slc26a5 T C 5: 21,834,347 N216S probably damaging Het
Snrnp27 T C 6: 86,676,205 S144G probably benign Het
Spata20 T A 11: 94,480,609 D643V probably damaging Het
Spata24 T C 18: 35,660,462 K99R probably damaging Het
Taar5 A G 10: 23,971,709 Y335C probably damaging Het
Tpr A G 1: 150,430,595 H1540R probably benign Het
Vmn1r27 A G 6: 58,215,719 F100S possibly damaging Het
Vmn2r37 A T 7: 9,217,783 Y360* probably null Het
Ybx1 C A 4: 119,282,354 R36L possibly damaging Het
Zfp369 A G 13: 65,297,202 K720E probably benign Het
Zfp599 A G 9: 22,249,742 S376P probably benign Het
Zic2 A G 14: 122,476,541 E289G probably damaging Het
Zzef1 T C 11: 72,821,851 V199A probably benign Het
Other mutations in Slc12a8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00938:Slc12a8 APN 16 33540897 missense probably damaging 1.00
IGL01701:Slc12a8 APN 16 33540910 missense probably damaging 1.00
IGL02024:Slc12a8 APN 16 33608198 missense probably damaging 1.00
IGL02223:Slc12a8 APN 16 33624690 missense probably damaging 1.00
IGL02637:Slc12a8 APN 16 33534960 missense probably benign 0.05
IGL03248:Slc12a8 APN 16 33551027 missense probably damaging 1.00
R0436:Slc12a8 UTSW 16 33551085 missense probably damaging 1.00
R0586:Slc12a8 UTSW 16 33658230 missense possibly damaging 0.87
R0669:Slc12a8 UTSW 16 33550904 missense possibly damaging 0.91
R0780:Slc12a8 UTSW 16 33646665 splice site probably null
R1170:Slc12a8 UTSW 16 33662977 missense probably damaging 1.00
R1383:Slc12a8 UTSW 16 33534987 missense probably damaging 1.00
R1707:Slc12a8 UTSW 16 33551007 missense probably damaging 1.00
R2917:Slc12a8 UTSW 16 33550926 missense probably damaging 1.00
R4092:Slc12a8 UTSW 16 33617121 missense probably damaging 1.00
R4532:Slc12a8 UTSW 16 33551033 missense probably damaging 1.00
R4604:Slc12a8 UTSW 16 33608159 missense probably damaging 1.00
R4638:Slc12a8 UTSW 16 33590323 missense possibly damaging 0.95
R4908:Slc12a8 UTSW 16 33606259 splice site probably null
R5148:Slc12a8 UTSW 16 33624918 missense probably benign 0.00
R5186:Slc12a8 UTSW 16 33617208 missense probably damaging 1.00
R5711:Slc12a8 UTSW 16 33590309 missense probably damaging 1.00
R5760:Slc12a8 UTSW 16 33624785 nonsense probably null
R6122:Slc12a8 UTSW 16 33625014 missense probably damaging 0.99
R6592:Slc12a8 UTSW 16 33617256 critical splice donor site probably null
R6995:Slc12a8 UTSW 16 33534893 nonsense probably null
R7602:Slc12a8 UTSW 16 33625124 missense probably benign 0.00
R7772:Slc12a8 UTSW 16 33550965 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGGTCCAACACATGACTGGGTAATTC -3'
(R):5'- TGCACATTCTCCATATGCCAGCAC -3'

Sequencing Primer
(F):5'- GATTAAAACCACTGCTACCTTGG -3'
(R):5'- CCCAAAACCTCCAACTTGGTC -3'
Posted On2013-04-12