Mutagenetix > Incidental Mutation

Incidental Mutation 'R0136:Garem1'

21986

Institutional Source

Beutler Lab

Gene Symbol

Garem1

Ensembl Gene

ENSMUSG00000042680

Gene Name

GRB2 associated regulator of MAPK1 subtype 1

Synonyms

Garem, Fam59a, LOC381126

MMRRC Submission

038421-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.209) question?

Stock #

R0136 (G1)

Quality Score

225

Status

Validated (trace)

Chromosome

Chromosomal Location

21127201-21300138 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 21129991 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Arginine at position 589 (S589R)

Ref Sequence

ENSEMBL: ENSMUSP00000048914 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000049260]

AlphaFold

Q3UFT3

Predicted Effect

probably damaging
Transcript: ENSMUST00000049260
AA Change: S589R

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000048914
Gene: ENSMUSG00000042680
AA Change: S589R

Domain	Start	End	E-Value	Type
Pfam:CABIT	32	318	3.4e-79	PFAM
low complexity region	484	499	N/A	INTRINSIC
low complexity region	512	518	N/A	INTRINSIC
PDB:2DKZ\|A	795	874	2e-40	PDB
Blast:SAM	808	875	2e-36	BLAST
SCOP:d1kw4a_	812	873	4e-4	SMART

Meta Mutation Damage Score

0.0646

Coding Region Coverage

1x: 99.0%
3x: 98.3%
10x: 96.5%
20x: 93.3%

Validation Efficiency

89% (56/63)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an adaptor protein which functions in the epidermal growth factor (EGF) receptor-mediated signaling pathway. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ap4b1	T	C	3: 103,809,946	M1T	probably null	Het
Arg2	T	C	12: 79,150,006	L167P	probably damaging	Het
Atxn1	A	G	13: 45,567,169	S417P	probably damaging	Het
Baz2b	A	G	2: 59,901,954	V1949A	probably benign	Het
Bcl3	A	G	7: 19,809,569	V324A	probably damaging	Het
Btbd10	A	T	7: 113,329,878	S230T	possibly damaging	Het
Camta1	A	G	4: 151,078,969	S1479P	probably damaging	Het
Cd69	C	T	6: 129,270,062	S64N	probably benign	Het
Col5a1	T	C	2: 28,024,831	L153P	probably damaging	Het
Crat	C	A	2: 30,407,030	V304L	probably benign	Het
Csmd3	T	C	15: 47,847,131	T1687A	probably benign	Het
Dnah1	C	T	14: 31,276,158	G2574D	probably damaging	Het
Fau	T	C	19: 6,059,180	V86A	possibly damaging	Het
Gbp3	T	G	3: 142,564,101		probably null	Het
Gin1	T	A	1: 97,783,016	S141R	possibly damaging	Het
Gtf2h1	A	T	7: 46,815,416	Q419L	possibly damaging	Het
Hipk3	A	G	2: 104,439,293	I517T	probably benign	Het
Hivep2	T	C	10: 14,131,878	S1407P	probably benign	Het
Hnrnpk	G	T	13: 58,395,177	D211E	probably benign	Het
Hnrnpul2	T	C	19: 8,826,801	L588P	probably damaging	Het
Il18rap	A	T	1: 40,525,058	H112L	probably benign	Het
Itgb1	T	G	8: 128,722,854	Y585D	possibly damaging	Het
Kmt2d	C	T	15: 98,854,278		probably benign	Het
Map7d1	A	T	4: 126,236,631		probably null	Het
Me2	A	G	18: 73,770,673	S575P	probably benign	Het
Med13l	A	G	5: 118,724,050	T353A	probably benign	Het
Mgat4b	T	C	11: 50,231,081	V143A	possibly damaging	Het
Mlxip	T	A	5: 123,442,306	W211R	probably damaging	Het
Morc2a	T	G	11: 3,685,907		probably null	Het
Muc4	A	T	16: 32,750,195		probably benign	Het
Ndufa10	A	T	1: 92,463,128	Y233*	probably null	Het
Nek8	C	T	11: 78,171,207	S237N	probably benign	Het
Neto1	G	A	18: 86,461,320	R211Q	probably benign	Het
Nfatc2ip	A	G	7: 126,391,335	S165P	probably benign	Het
Nsd2	A	G	5: 33,855,536	K404E	possibly damaging	Het
Nsd3	G	T	8: 25,659,854	E352*	probably null	Het
Nudt9	A	G	5: 104,047,106	T23A	probably benign	Het
Olfr394	T	C	11: 73,887,785	M196V	probably benign	Het
Olfr394	C	T	11: 73,887,830	V181I	probably benign	Het
Olfr983	A	G	9: 40,092,019	*312Q	probably null	Het
Patj	C	A	4: 98,667,648	Q297K	probably damaging	Het
Pelo	A	T	13: 115,088,903	C40*	probably null	Het
Pnpla3	G	A	15: 84,174,478		probably null	Het
Pramel1	C	A	4: 143,397,446	N230K	probably damaging	Het
Psg20	A	C	7: 18,682,507	L228R	probably damaging	Het
Rsph10b	T	C	5: 143,959,821	F44L	probably benign	Het
Sept2	G	A	1: 93,507,050	G358R	possibly damaging	Het
Slamf7	G	A	1: 171,648,931		probably benign	Het
Slc12a8	A	G	16: 33,608,213	D297G	probably damaging	Het
Slc17a5	G	A	9: 78,578,674	A43V	probably damaging	Het
Slc22a1	A	T	17: 12,662,596	F335L	probably benign	Het
Slc26a5	T	C	5: 21,834,347	N216S	probably damaging	Het
Snrnp27	T	C	6: 86,676,205	S144G	probably benign	Het
Spata20	T	A	11: 94,480,609	D643V	probably damaging	Het
Spata24	T	C	18: 35,660,462	K99R	probably damaging	Het
Taar5	A	G	10: 23,971,709	Y335C	probably damaging	Het
Tpr	A	G	1: 150,430,595	H1540R	probably benign	Het
Vmn1r27	A	G	6: 58,215,719	F100S	possibly damaging	Het
Vmn2r37	A	T	7: 9,217,783	Y360*	probably null	Het
Ybx1	C	A	4: 119,282,354	R36L	possibly damaging	Het
Zfp369	A	G	13: 65,297,202	K720E	probably benign	Het
Zfp599	A	G	9: 22,249,742	S376P	probably benign	Het
Zic2	A	G	14: 122,476,541	E289G	probably damaging	Het
Zzef1	T	C	11: 72,821,851	V199A	probably benign	Het

Other mutations in Garem1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00504:Garem1	APN	18	21148657	missense	probably damaging	1.00
IGL01588:Garem1	APN	18	21129797	missense	probably damaging	0.99
IGL02171:Garem1	APN	18	21129241	missense	probably damaging	0.98
IGL02270:Garem1	APN	18	21148450	missense	probably damaging	1.00
IGL03149:Garem1	APN	18	21131466	missense	probably damaging	1.00
R0285:Garem1	UTSW	18	21129612	missense	probably benign
R0361:Garem1	UTSW	18	21299744	nonsense	probably null
R1068:Garem1	UTSW	18	21168755	missense	probably benign	0.00
R1537:Garem1	UTSW	18	21168874	splice site	probably null
R1726:Garem1	UTSW	18	21148262	missense	probably damaging	0.99
R1826:Garem1	UTSW	18	21129452	missense	probably benign	0.00
R2140:Garem1	UTSW	18	21129374	missense	probably damaging	1.00
R3714:Garem1	UTSW	18	21148890	missense	probably damaging	1.00
R3937:Garem1	UTSW	18	21148806	nonsense	probably null
R4362:Garem1	UTSW	18	21236115	missense	possibly damaging	0.62
R4441:Garem1	UTSW	18	21168750	missense	possibly damaging	0.92
R4747:Garem1	UTSW	18	21129943	missense	probably benign
R4814:Garem1	UTSW	18	21148116	missense	probably damaging	1.00
R4831:Garem1	UTSW	18	21129768	missense	probably benign	0.01
R4838:Garem1	UTSW	18	21147893	missense	probably benign	0.00
R5805:Garem1	UTSW	18	21148435	missense	probably benign	0.04
R5963:Garem1	UTSW	18	21129430	missense	probably benign	0.45
R5982:Garem1	UTSW	18	21148351	missense	possibly damaging	0.64
R6134:Garem1	UTSW	18	21129824	missense	probably benign	0.00
R6242:Garem1	UTSW	18	21129172	missense	possibly damaging	0.72
R6453:Garem1	UTSW	18	21148739	missense	probably damaging	0.99
R6485:Garem1	UTSW	18	21129837	missense	probably benign	0.00
R6596:Garem1	UTSW	18	21148739	missense	probably damaging	0.99
R6662:Garem1	UTSW	18	21148247	missense	probably benign	0.45
R6883:Garem1	UTSW	18	21129712	missense	probably benign
R6937:Garem1	UTSW	18	21147770	missense	probably benign	0.00
R7027:Garem1	UTSW	18	21129994	missense	probably benign
R7256:Garem1	UTSW	18	21148754	missense	probably damaging	1.00
R7534:Garem1	UTSW	18	21299916	start gained	probably benign
R7620:Garem1	UTSW	18	21129841	missense	probably benign
R7869:Garem1	UTSW	18	21299700	missense	probably damaging	1.00
R7963:Garem1	UTSW	18	21148787	missense	probably damaging	0.98
R8058:Garem1	UTSW	18	21148564	missense	probably damaging	1.00
R8953:Garem1	UTSW	18	21131331	critical splice donor site	probably null
R9273:Garem1	UTSW	18	21148217	missense	probably damaging	0.99
R9411:Garem1	UTSW	18	21236000	critical splice donor site	probably null
R9475:Garem1	UTSW	18	21148313	missense	probably benign	0.00
Z1176:Garem1	UTSW	18	21129792	missense	probably damaging	1.00
Z1176:Garem1	UTSW	18	21148325	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCGGATCGAGCAGAAAGTCACTCC -3'
(R):5'- GCAGACATTGCTCTTATGTTGGCCC -3'

Sequencing Primer
(F):5'- AGAAAGTCACTCCTTGTCTGG -3'
(R):5'- ACCTCCCAAGGCTAAGGTTA -3'

Posted On

2013-04-12