Mutagenetix > Incidental Mutations

Incidental Mutation 'R1982:Cd84'

219861

Institutional Source

Beutler Lab

Gene Symbol

Cd84

Ensembl Gene

ENSMUSG00000038147

Gene Name

CD84 antigen

Synonyms

CDw84, A130013D22Rik, SLAMF5

MMRRC Submission

039994-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1982 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

171839697-171890718 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

C to A at 171884585 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000122951 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000042302] [ENSMUST00000136479] [ENSMUST00000136479] [ENSMUST00000136479] [ENSMUST00000155802]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000042302
AA Change: A256E

PolyPhen 2 Score 0.844 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000047024
Gene: ENSMUSG00000038147
AA Change: A256E

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
IG	26	126	3.16e-1	SMART
IG_like	137	208	1.02e1	SMART
transmembrane domain	220	242	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000136479

SMART Domains

Protein: ENSMUSP00000122951
Gene: ENSMUSG00000038147

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
IG	26	126	3.16e-1	SMART
IG_like	137	208	1.02e1	SMART
transmembrane domain	220	242	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000136479

SMART Domains

Protein: ENSMUSP00000122951
Gene: ENSMUSG00000038147

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
IG	26	126	3.16e-1	SMART
IG_like	137	208	1.02e1	SMART
transmembrane domain	220	242	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000136479

SMART Domains

Protein: ENSMUSP00000122951
Gene: ENSMUSG00000038147

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
IG	26	126	3.16e-1	SMART
IG_like	137	208	1.02e1	SMART
transmembrane domain	220	242	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000155802
AA Change: A256E

PolyPhen 2 Score 0.844 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000120881
Gene: ENSMUSG00000038147
AA Change: A256E

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
IG	26	126	3.16e-1	SMART
IG_like	137	208	1.02e1	SMART
transmembrane domain	220	242	N/A	INTRINSIC

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a membrane glycoprotein that is a member of the signaling lymphocyte activation molecule (SLAM) family. This family forms a subset of the larger CD2 cell-surface receptor Ig superfamily. The encoded protein is a homophilic adhesion molecule that is expressed in numerous immune cells types and is involved in regulating receptor-mediated signaling in those cells. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a knock-out allele of this gene show defects in T follicular helper function and germinal center formation. Mice homozygous for a different knock-out allele display normal platelet physiology and thrombus formation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 89 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930415L06Rik	A	T	X: 89,931,445	V382E	probably damaging	Het
Aatk	G	T	11: 120,013,514	P252Q	probably damaging	Het
Adamts4	T	C	1: 171,258,934	V765A	probably benign	Het
Agfg2	A	T	5: 137,664,253	V184E	possibly damaging	Het
Alas1	A	T	9: 106,238,185	I48N	probably damaging	Het
Anks1	T	C	17: 27,985,121	V181A	probably damaging	Het
Anxa8	A	T	14: 34,096,570	R261S	probably damaging	Het
Aqp4	T	C	18: 15,393,551	D291G	probably damaging	Het
Atrn	A	G	2: 130,970,222	R696G	probably benign	Het
Barx2	A	C	9: 31,913,012	I27S	probably damaging	Het
Btnl1	A	T	17: 34,379,751	I114L	possibly damaging	Het
Casq1	C	T	1: 172,215,530	A200T	probably damaging	Het
Ccdc33	T	A	9: 58,117,168	E225D	probably benign	Het
Ceacam9	T	G	7: 16,725,307	L177R	probably benign	Het
Cenpi	T	A	X: 134,318,033	F161L	possibly damaging	Het
Cep63	T	C	9: 102,602,880	K251E	probably damaging	Het
Cetn3	A	G	13: 81,784,697	E25G	probably damaging	Het
Crybg3	T	C	16: 59,544,125	D2378G	possibly damaging	Het
Ddx19b	T	C	8: 111,009,343	T357A	possibly damaging	Het
Dpep2	A	C	8: 105,989,455	Y266*	probably null	Het
Dqx1	G	A	6: 83,058,577	D24N	probably damaging	Het
Dsg4	A	T	18: 20,471,212	Y912F	probably damaging	Het
Fam71f2	A	G	6: 29,285,922	T69A	probably benign	Het
Fezf2	G	T	14: 12,344,405	P261T	probably benign	Het
Fmo1	T	C	1: 162,839,756	I163M	possibly damaging	Het
Gatad2a	G	A	8: 69,913,132	R428*	probably null	Het
Gfpt1	T	A	6: 87,054,630	F85I	possibly damaging	Het
Gimap7	A	T	6: 48,724,241	I254F	possibly damaging	Het
Glcci1	T	C	6: 8,592,980	S261P	probably damaging	Het
Glis3	A	T	19: 28,531,274	F437I	probably damaging	Het
Glp1r	C	A	17: 30,925,627	S258*	probably null	Het
Gm13023	C	A	4: 143,795,150	H445Q	probably benign	Het
Gm7030	T	A	17: 36,128,722	D122V	probably damaging	Het
Gpt2	C	T	8: 85,516,203	A288V	possibly damaging	Het
Grin2c	G	T	11: 115,260,905	S76R	possibly damaging	Het
Guf1	T	A	5: 69,567,226	Y447*	probably null	Het
Hectd1	A	C	12: 51,785,841	L916V	probably damaging	Het
Hnf4g	A	G	3: 3,638,208	K96E	probably damaging	Het
Hsh2d	G	A	8: 72,200,460	D229N	probably benign	Het
Ifi207	T	G	1: 173,735,239	M114L	probably benign	Het
Ifi35	A	T	11: 101,458,286	E252V	probably damaging	Het
Igsf9b	G	A	9: 27,322,239	R345H	possibly damaging	Het
Itih3	T	C	14: 30,923,583		probably benign	Het
Kcnh8	GAGACCAACGAGCAGCTGATGCTTCAGA	GAGA	17: 52,725,906	74	probably benign	Het
Kidins220	A	T	12: 25,051,194	M1252L	probably benign	Het
Kifap3	T	A	1: 163,862,022	L525*	probably null	Het
Limk2	A	T	11: 3,355,461	D35E	probably benign	Het
Lrrc37a	G	A	11: 103,498,966	P1878S	probably benign	Het
Mansc4	T	A	6: 147,075,675	I148F	probably benign	Het
Mei1	A	G	15: 82,103,312	N859S	probably benign	Het
Mib1	A	G	18: 10,812,064	D987G	probably damaging	Het
Mroh8	A	G	2: 157,271,975	V132A	possibly damaging	Het
Npnt	T	C	3: 132,948,132	I29M	probably benign	Het
Nrap	T	C	19: 56,384,105	D138G	probably damaging	Het
Olfr1	A	T	11: 73,395,092	I310N	probably benign	Het
Olfr5	T	C	7: 6,480,932	M75V	probably benign	Het
Olfr512	A	G	7: 108,713,695	Y102C	probably damaging	Het
Olfr91	T	A	17: 37,093,808	E22V	probably damaging	Het
Osbpl5	A	C	7: 143,741,671		probably null	Het
Pcna-ps2	T	C	19: 9,283,683	V102A	possibly damaging	Het
Pik3c2g	T	C	6: 139,622,548	S221P	probably damaging	Het
Plppr3	A	G	10: 79,866,425	I271T	probably damaging	Het
Prkar1b	C	T	5: 139,127,643	A41T	probably benign	Het
Prkcsh	A	G	9: 22,012,868	D458G	probably damaging	Het
Prr14	G	T	7: 127,475,490	R398L	possibly damaging	Het
Ptafr	A	G	4: 132,579,985	R229G	probably damaging	Het
Rbp3	T	C	14: 33,954,545	F150S	probably damaging	Het
Rel	C	T	11: 23,742,761	G424D	probably benign	Het
Rlf	T	C	4: 121,150,112	Y557C	probably damaging	Het
Samt3	A	C	X: 86,047,134	M211L	probably benign	Het
Selenop	A	T	15: 3,275,694	I111F	probably damaging	Het
Slc2a2	G	A	3: 28,717,441	M173I	probably benign	Het
Slc43a1	G	T	2: 84,856,889	G361V	possibly damaging	Het
Slit2	G	A	5: 48,249,836	V870M	probably damaging	Het
Ssxb10	A	G	X: 8,331,019	D77G	probably benign	Het
Stk32b	T	A	5: 37,649,114	I29F	probably damaging	Het
Stra6l	T	A	4: 45,867,237	C161*	probably null	Het
Tecpr2	T	A	12: 110,954,785	M1264K	probably benign	Het
Tfap2c	A	T	2: 172,557,236	I468F	probably damaging	Het
Ticam1	C	T	17: 56,271,555	R180H	probably damaging	Het
Tlr4	T	A	4: 66,841,035	N688K	probably benign	Het
Tmem35b	A	T	4: 127,126,053		probably benign	Het
Ugt2b34	T	C	5: 86,906,313	E203G	probably damaging	Het
Vegfa	A	C	17: 46,018,860	*393G	probably null	Het
Vmn2r16	T	C	5: 109,364,024	V699A	probably benign	Het
Zfp324	T	C	7: 12,971,218	S445P	probably damaging	Het
Zfp982	T	A	4: 147,512,592	C135*	probably null	Het
Zfp990	A	C	4: 145,536,869	N146H	probably damaging	Het
Zfyve26	A	G	12: 79,255,243	Y431H	possibly damaging	Het

Other mutations in Cd84

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00509:Cd84	APN	1	171852137	critical splice donor site	probably null
IGL01371:Cd84	APN	1	171886370	missense	probably benign	0.36
IGL03035:Cd84	APN	1	171852034	missense	probably damaging	0.99
IGL03098:Cd84	APN	1	171872700	missense	possibly damaging	0.78
R0511:Cd84	UTSW	1	171872927	missense	probably benign	0.00
R1244:Cd84	UTSW	1	171851830	missense	probably damaging	0.99
R1438:Cd84	UTSW	1	171852118	missense	probably damaging	1.00
R1459:Cd84	UTSW	1	171851943	missense	probably benign	0.02
R1654:Cd84	UTSW	1	171884606	missense	possibly damaging	0.69
R1658:Cd84	UTSW	1	171872750	missense	possibly damaging	0.78
R1659:Cd84	UTSW	1	171872750	missense	possibly damaging	0.78
R1765:Cd84	UTSW	1	171872750	missense	possibly damaging	0.78
R1771:Cd84	UTSW	1	171872750	missense	possibly damaging	0.78
R1776:Cd84	UTSW	1	171872750	missense	possibly damaging	0.78
R1799:Cd84	UTSW	1	171872750	missense	possibly damaging	0.78
R1815:Cd84	UTSW	1	171872750	missense	possibly damaging	0.78
R1816:Cd84	UTSW	1	171872750	missense	possibly damaging	0.78
R1990:Cd84	UTSW	1	171872750	missense	possibly damaging	0.78
R2056:Cd84	UTSW	1	171872750	missense	possibly damaging	0.78
R2057:Cd84	UTSW	1	171872750	missense	possibly damaging	0.78
R2058:Cd84	UTSW	1	171872750	missense	possibly damaging	0.78
R2098:Cd84	UTSW	1	171885581	missense	probably benign	0.07
R4674:Cd84	UTSW	1	171873320	missense	possibly damaging	0.82
R4675:Cd84	UTSW	1	171873320	missense	possibly damaging	0.82
R4806:Cd84	UTSW	1	171852121	missense	probably benign	0.00
R4828:Cd84	UTSW	1	171872748	missense	probably damaging	0.97
R4908:Cd84	UTSW	1	171872865	missense	probably damaging	0.96
R5366:Cd84	UTSW	1	171873305	missense	probably damaging	1.00
R5725:Cd84	UTSW	1	171873361	missense	probably benign	0.00
R5883:Cd84	UTSW	1	171872838	missense	possibly damaging	0.58
R6722:Cd84	UTSW	1	171872777	missense	probably damaging	0.98
R6966:Cd84	UTSW	1	171886409	missense	possibly damaging	0.93
R7513:Cd84	UTSW	1	171884618	missense	probably benign	0.01
R7733:Cd84	UTSW	1	171840659	start codon destroyed	probably null	1.00
R9123:Cd84	UTSW	1	171884586	critical splice acceptor site	probably null
R9134:Cd84	UTSW	1	171851846	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTCCCAATGTGCTTCAGGTG -3'
(R):5'- CCAACAGAGGGTAATTGTTGCC -3'

Sequencing Primer
(F):5'- ATCACACCTGTAATCCTTCGGATGG -3'
(R):5'- GGTAATTGTTGCCCAAGCC -3'

Posted On

2014-08-25