Incidental Mutation 'R1982:Ifi207'
ID 219865
Institutional Source Beutler Lab
Gene Symbol Ifi207
Ensembl Gene ENSMUSG00000073490
Gene Name interferon activated gene 207
Synonyms Pyhin-A, AI607873
MMRRC Submission 039994-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.136) question?
Stock # R1982 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 173723427-173741747 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 173735239 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Leucine at position 114 (M114L)
Ref Sequence ENSEMBL: ENSMUSP00000119350 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042610] [ENSMUST00000127730]
AlphaFold E9Q3L4
Predicted Effect probably benign
Transcript: ENSMUST00000042610
AA Change: M114L

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000048129
Gene: ENSMUSG00000073490
AA Change: M114L

PYRIN 6 84 3.2e-15 SMART
low complexity region 121 133 N/A INTRINSIC
low complexity region 136 162 N/A INTRINSIC
low complexity region 207 215 N/A INTRINSIC
internal_repeat_1 286 472 4.17e-7 PROSPERO
low complexity region 476 496 N/A INTRINSIC
internal_repeat_1 565 782 4.17e-7 PROSPERO
Pfam:HIN 788 954 4.9e-76 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127730
AA Change: M114L

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000119350
Gene: ENSMUSG00000073490
AA Change: M114L

PYRIN 6 84 3.2e-15 SMART
low complexity region 121 133 N/A INTRINSIC
low complexity region 136 155 N/A INTRINSIC
low complexity region 200 208 N/A INTRINSIC
internal_repeat_1 279 465 6.41e-7 PROSPERO
low complexity region 469 489 N/A INTRINSIC
internal_repeat_1 558 775 6.41e-7 PROSPERO
Pfam:HIN 781 948 1.8e-78 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930415L06Rik A T X: 89,931,445 V382E probably damaging Het
Aatk G T 11: 120,013,514 P252Q probably damaging Het
Adamts4 T C 1: 171,258,934 V765A probably benign Het
Agfg2 A T 5: 137,664,253 V184E possibly damaging Het
Alas1 A T 9: 106,238,185 I48N probably damaging Het
Anks1 T C 17: 27,985,121 V181A probably damaging Het
Anxa8 A T 14: 34,096,570 R261S probably damaging Het
Aqp4 T C 18: 15,393,551 D291G probably damaging Het
Atrn A G 2: 130,970,222 R696G probably benign Het
Barx2 A C 9: 31,913,012 I27S probably damaging Het
Btnl1 A T 17: 34,379,751 I114L possibly damaging Het
Casq1 C T 1: 172,215,530 A200T probably damaging Het
Ccdc33 T A 9: 58,117,168 E225D probably benign Het
Cd84 C A 1: 171,884,585 probably null Het
Ceacam9 T G 7: 16,725,307 L177R probably benign Het
Cenpi T A X: 134,318,033 F161L possibly damaging Het
Cep63 T C 9: 102,602,880 K251E probably damaging Het
Cetn3 A G 13: 81,784,697 E25G probably damaging Het
Crybg3 T C 16: 59,544,125 D2378G possibly damaging Het
Ddx19b T C 8: 111,009,343 T357A possibly damaging Het
Dpep2 A C 8: 105,989,455 Y266* probably null Het
Dqx1 G A 6: 83,058,577 D24N probably damaging Het
Dsg4 A T 18: 20,471,212 Y912F probably damaging Het
Fam71f2 A G 6: 29,285,922 T69A probably benign Het
Fezf2 G T 14: 12,344,405 P261T probably benign Het
Fmo1 T C 1: 162,839,756 I163M possibly damaging Het
Gatad2a G A 8: 69,913,132 R428* probably null Het
Gfpt1 T A 6: 87,054,630 F85I possibly damaging Het
Gimap7 A T 6: 48,724,241 I254F possibly damaging Het
Glcci1 T C 6: 8,592,980 S261P probably damaging Het
Glis3 A T 19: 28,531,274 F437I probably damaging Het
Glp1r C A 17: 30,925,627 S258* probably null Het
Gm13023 C A 4: 143,795,150 H445Q probably benign Het
Gm7030 T A 17: 36,128,722 D122V probably damaging Het
Gpt2 C T 8: 85,516,203 A288V possibly damaging Het
Grin2c G T 11: 115,260,905 S76R possibly damaging Het
Guf1 T A 5: 69,567,226 Y447* probably null Het
Hectd1 A C 12: 51,785,841 L916V probably damaging Het
Hnf4g A G 3: 3,638,208 K96E probably damaging Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Ifi35 A T 11: 101,458,286 E252V probably damaging Het
Igsf9b G A 9: 27,322,239 R345H possibly damaging Het
Itih3 T C 14: 30,923,583 probably benign Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 74 probably benign Het
Kidins220 A T 12: 25,051,194 M1252L probably benign Het
Kifap3 T A 1: 163,862,022 L525* probably null Het
Limk2 A T 11: 3,355,461 D35E probably benign Het
Lrrc37a G A 11: 103,498,966 P1878S probably benign Het
Mansc4 T A 6: 147,075,675 I148F probably benign Het
Mei1 A G 15: 82,103,312 N859S probably benign Het
Mib1 A G 18: 10,812,064 D987G probably damaging Het
Mroh8 A G 2: 157,271,975 V132A possibly damaging Het
Npnt T C 3: 132,948,132 I29M probably benign Het
Nrap T C 19: 56,384,105 D138G probably damaging Het
Olfr1 A T 11: 73,395,092 I310N probably benign Het
Olfr5 T C 7: 6,480,932 M75V probably benign Het
Olfr512 A G 7: 108,713,695 Y102C probably damaging Het
Olfr91 T A 17: 37,093,808 E22V probably damaging Het
Osbpl5 A C 7: 143,741,671 probably null Het
Pcna-ps2 T C 19: 9,283,683 V102A possibly damaging Het
Pik3c2g T C 6: 139,622,548 S221P probably damaging Het
Plppr3 A G 10: 79,866,425 I271T probably damaging Het
Prkar1b C T 5: 139,127,643 A41T probably benign Het
Prkcsh A G 9: 22,012,868 D458G probably damaging Het
Prr14 G T 7: 127,475,490 R398L possibly damaging Het
Ptafr A G 4: 132,579,985 R229G probably damaging Het
Rbp3 T C 14: 33,954,545 F150S probably damaging Het
Rel C T 11: 23,742,761 G424D probably benign Het
Rlf T C 4: 121,150,112 Y557C probably damaging Het
Samt3 A C X: 86,047,134 M211L probably benign Het
Selenop A T 15: 3,275,694 I111F probably damaging Het
Slc2a2 G A 3: 28,717,441 M173I probably benign Het
Slc43a1 G T 2: 84,856,889 G361V possibly damaging Het
Slit2 G A 5: 48,249,836 V870M probably damaging Het
Ssxb10 A G X: 8,331,019 D77G probably benign Het
Stk32b T A 5: 37,649,114 I29F probably damaging Het
Stra6l T A 4: 45,867,237 C161* probably null Het
Tecpr2 T A 12: 110,954,785 M1264K probably benign Het
Tfap2c A T 2: 172,557,236 I468F probably damaging Het
Ticam1 C T 17: 56,271,555 R180H probably damaging Het
Tlr4 T A 4: 66,841,035 N688K probably benign Het
Tmem35b A T 4: 127,126,053 probably benign Het
Ugt2b34 T C 5: 86,906,313 E203G probably damaging Het
Vegfa A C 17: 46,018,860 *393G probably null Het
Vmn2r16 T C 5: 109,364,024 V699A probably benign Het
Zfp324 T C 7: 12,971,218 S445P probably damaging Het
Zfp982 T A 4: 147,512,592 C135* probably null Het
Zfp990 A C 4: 145,536,869 N146H probably damaging Het
Zfyve26 A G 12: 79,255,243 Y431H possibly damaging Het
Other mutations in Ifi207
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01776:Ifi207 APN 1 173725044 missense probably damaging 1.00
IGL01864:Ifi207 APN 1 173736441 missense possibly damaging 0.72
IGL02293:Ifi207 APN 1 173723748 missense probably damaging 1.00
IGL02402:Ifi207 APN 1 173727593 missense probably damaging 1.00
IGL03160:Ifi207 APN 1 173735104 splice site probably benign
PIT4458001:Ifi207 UTSW 1 173735172 missense unknown
R0043:Ifi207 UTSW 1 173729112 missense possibly damaging 0.48
R0212:Ifi207 UTSW 1 173736398 missense possibly damaging 0.85
R0395:Ifi207 UTSW 1 173729865 missense possibly damaging 0.85
R0506:Ifi207 UTSW 1 173736312 missense possibly damaging 0.52
R0843:Ifi207 UTSW 1 173727577 missense probably damaging 1.00
R1302:Ifi207 UTSW 1 173735295 missense possibly damaging 0.96
R1373:Ifi207 UTSW 1 173730347 missense unknown
R1462:Ifi207 UTSW 1 173724947 missense probably damaging 1.00
R1462:Ifi207 UTSW 1 173724947 missense probably damaging 1.00
R1471:Ifi207 UTSW 1 173730063 missense unknown
R1502:Ifi207 UTSW 1 173729306 missense possibly damaging 0.56
R1533:Ifi207 UTSW 1 173727740 missense probably benign 0.30
R1831:Ifi207 UTSW 1 173732426 missense unknown
R1928:Ifi207 UTSW 1 173729645 missense possibly damaging 0.68
R2132:Ifi207 UTSW 1 173729771 missense possibly damaging 0.84
R2248:Ifi207 UTSW 1 173736470 splice site probably benign
R3703:Ifi207 UTSW 1 173727463 nonsense probably null
R3741:Ifi207 UTSW 1 173727562 missense probably damaging 1.00
R3846:Ifi207 UTSW 1 173735303 missense probably benign 0.33
R4747:Ifi207 UTSW 1 173729067 missense probably benign 0.00
R4772:Ifi207 UTSW 1 173727687 missense probably damaging 1.00
R4776:Ifi207 UTSW 1 173730056 missense unknown
R4855:Ifi207 UTSW 1 173729815 missense probably damaging 0.96
R5170:Ifi207 UTSW 1 173730498 missense unknown
R5244:Ifi207 UTSW 1 173729937 missense probably benign 0.04
R5280:Ifi207 UTSW 1 173730304 missense unknown
R5301:Ifi207 UTSW 1 173729411 missense possibly damaging 0.83
R5334:Ifi207 UTSW 1 173727531 missense probably benign 0.21
R5445:Ifi207 UTSW 1 173727797 missense probably damaging 0.99
R5691:Ifi207 UTSW 1 173732426 missense unknown
R5838:Ifi207 UTSW 1 173732387 missense unknown
R6060:Ifi207 UTSW 1 173730527 missense unknown
R6220:Ifi207 UTSW 1 173729546 missense probably damaging 0.99
R6264:Ifi207 UTSW 1 173727545 missense probably damaging 1.00
R6307:Ifi207 UTSW 1 173725053 missense probably damaging 1.00
R6326:Ifi207 UTSW 1 173729966 missense probably benign 0.01
R6394:Ifi207 UTSW 1 173729015 missense probably benign 0.43
R6532:Ifi207 UTSW 1 173729645 missense possibly damaging 0.68
R6660:Ifi207 UTSW 1 173729406 missense probably benign 0.01
R6893:Ifi207 UTSW 1 173727642 missense possibly damaging 0.95
R7190:Ifi207 UTSW 1 173730252 missense unknown
R7192:Ifi207 UTSW 1 173729018 missense not run
R7194:Ifi207 UTSW 1 173729924 missense possibly damaging 0.84
R7327:Ifi207 UTSW 1 173729015 missense probably benign 0.43
R7348:Ifi207 UTSW 1 173729196 small deletion probably benign
R7404:Ifi207 UTSW 1 173728928 missense possibly damaging 0.92
R7442:Ifi207 UTSW 1 173727431 missense probably benign 0.03
R7784:Ifi207 UTSW 1 173730132 missense unknown
R8041:Ifi207 UTSW 1 173727702 missense possibly damaging 0.78
R8116:Ifi207 UTSW 1 173730180 missense unknown
R8383:Ifi207 UTSW 1 173729204 small deletion probably benign
R8388:Ifi207 UTSW 1 173729450 frame shift probably null
R8389:Ifi207 UTSW 1 173729450 frame shift probably null
R8390:Ifi207 UTSW 1 173729450 frame shift probably null
R8399:Ifi207 UTSW 1 173730278 missense unknown
R8431:Ifi207 UTSW 1 173730504 missense unknown
R8474:Ifi207 UTSW 1 173729039 missense possibly damaging 0.63
R8505:Ifi207 UTSW 1 173729450 frame shift probably null
R9009:Ifi207 UTSW 1 173727816 missense probably damaging 0.97
R9071:Ifi207 UTSW 1 173730198 missense unknown
R9090:Ifi207 UTSW 1 173729196 small deletion probably benign
R9299:Ifi207 UTSW 1 173728995 small deletion probably benign
R9323:Ifi207 UTSW 1 173727577 missense probably damaging 1.00
R9407:Ifi207 UTSW 1 173727668 missense probably damaging 1.00
RF009:Ifi207 UTSW 1 173728992 missense probably benign 0.00
RF011:Ifi207 UTSW 1 173729121 missense not run
RF032:Ifi207 UTSW 1 173735157 small deletion probably benign
X0003:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0004:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0005:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0009:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0010:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0011:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0012:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0013:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0014:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0017:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0018:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0019:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0020:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0021:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0022:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0023:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0024:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0025:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0026:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0027:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0028:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0033:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0034:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0035:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0036:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0037:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0038:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0039:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0040:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0050:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0052:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0053:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0054:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0057:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0058:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0060:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0061:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0062:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0063:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0064:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0065:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0066:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0067:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
Z1177:Ifi207 UTSW 1 173729579 missense probably damaging 1.00
Z1187:Ifi207 UTSW 1 173730527 missense unknown
Z1192:Ifi207 UTSW 1 173730527 missense unknown
Predicted Primers PCR Primer

Sequencing Primer
Posted On 2014-08-25