Incidental Mutation 'R1982:Atrn'
ID219869
Institutional Source Beutler Lab
Gene Symbol Atrn
Ensembl Gene ENSMUSG00000027312
Gene Nameattractin
SynonymsMgca
MMRRC Submission 039994-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1982 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location130906495-131030333 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 130970222 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 696 (R696G)
Ref Sequence ENSEMBL: ENSMUSP00000028781 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028781]
Predicted Effect probably benign
Transcript: ENSMUST00000028781
AA Change: R696G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000028781
Gene: ENSMUSG00000027312
AA Change: R696G

DomainStartEndE-ValueType
low complexity region 2 9 N/A INTRINSIC
low complexity region 51 97 N/A INTRINSIC
EGF 99 129 9.85e-5 SMART
CUB 131 247 7.85e-18 SMART
EGF 248 282 1.47e1 SMART
Pfam:Kelch_1 339 382 1.1e-7 PFAM
Pfam:Kelch_5 389 434 2.5e-7 PFAM
Pfam:Kelch_6 390 439 3.3e-8 PFAM
Pfam:Kelch_1 553 606 8.4e-8 PFAM
PSI 646 693 7.41e-7 SMART
PSI 702 747 8.64e-8 SMART
PSI 754 799 2.11e-2 SMART
CLECT 787 918 6.14e-20 SMART
PSI 931 982 1.11e-5 SMART
PSI 985 1060 1.2e-6 SMART
EGF_Lam 1062 1105 1.97e-4 SMART
EGF_like 1108 1154 3.9e0 SMART
transmembrane domain 1278 1300 N/A INTRINSIC
low complexity region 1310 1322 N/A INTRINSIC
low complexity region 1373 1385 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134964
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a widely expressed transmembrane glycoprotein that plays important roles in diverse physiological processes such as regulation of hair pigmentation, monocyte-T cell interaction and control of energy homeostasis. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. Certain mutations in this gene are responsible for the mahogany mouse phenotype of dark brown or black coat on a normally agouti background. Mice with loss-of-function mutations in this gene exhibit black coat color, tremor, adiposity, higher basal metabolic rate, juvenile-onset hypomyelination and age-dependent spongiform neurodegeneration of the central nervous system. [provided by RefSeq, Jul 2016]
PHENOTYPE: Some mutant homozygotes exhibit decreases in phaeomelanin synthesis, body weight, and adiposity; increases in locomotion, and abnormal myelination and vacuolation of the central nervous system resulting in tremors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930415L06Rik A T X: 89,931,445 V382E probably damaging Het
Aatk G T 11: 120,013,514 P252Q probably damaging Het
Adamts4 T C 1: 171,258,934 V765A probably benign Het
Agfg2 A T 5: 137,664,253 V184E possibly damaging Het
Alas1 A T 9: 106,238,185 I48N probably damaging Het
Anks1 T C 17: 27,985,121 V181A probably damaging Het
Anxa8 A T 14: 34,096,570 R261S probably damaging Het
Aqp4 T C 18: 15,393,551 D291G probably damaging Het
Barx2 A C 9: 31,913,012 I27S probably damaging Het
Btnl1 A T 17: 34,379,751 I114L possibly damaging Het
Casq1 C T 1: 172,215,530 A200T probably damaging Het
Ccdc33 T A 9: 58,117,168 E225D probably benign Het
Cd84 C A 1: 171,884,585 probably null Het
Ceacam9 T G 7: 16,725,307 L177R probably benign Het
Cenpi T A X: 134,318,033 F161L possibly damaging Het
Cep63 T C 9: 102,602,880 K251E probably damaging Het
Cetn3 A G 13: 81,784,697 E25G probably damaging Het
Crybg3 T C 16: 59,544,125 D2378G possibly damaging Het
Ddx19b T C 8: 111,009,343 T357A possibly damaging Het
Dpep2 A C 8: 105,989,455 Y266* probably null Het
Dqx1 G A 6: 83,058,577 D24N probably damaging Het
Dsg4 A T 18: 20,471,212 Y912F probably damaging Het
Fam71f2 A G 6: 29,285,922 T69A probably benign Het
Fezf2 G T 14: 12,344,405 P261T probably benign Het
Fmo1 T C 1: 162,839,756 I163M possibly damaging Het
Gatad2a G A 8: 69,913,132 R428* probably null Het
Gfpt1 T A 6: 87,054,630 F85I possibly damaging Het
Gimap7 A T 6: 48,724,241 I254F possibly damaging Het
Glcci1 T C 6: 8,592,980 S261P probably damaging Het
Glis3 A T 19: 28,531,274 F437I probably damaging Het
Glp1r C A 17: 30,925,627 S258* probably null Het
Gm13023 C A 4: 143,795,150 H445Q probably benign Het
Gm7030 T A 17: 36,128,722 D122V probably damaging Het
Gpt2 C T 8: 85,516,203 A288V possibly damaging Het
Grin2c G T 11: 115,260,905 S76R possibly damaging Het
Guf1 T A 5: 69,567,226 Y447* probably null Het
Hectd1 A C 12: 51,785,841 L916V probably damaging Het
Hnf4g A G 3: 3,638,208 K96E probably damaging Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Ifi207 T G 1: 173,735,239 M114L probably benign Het
Ifi35 A T 11: 101,458,286 E252V probably damaging Het
Igsf9b G A 9: 27,322,239 R345H possibly damaging Het
Itih3 T C 14: 30,923,583 probably benign Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 74 probably benign Het
Kidins220 A T 12: 25,051,194 M1252L probably benign Het
Kifap3 T A 1: 163,862,022 L525* probably null Het
Limk2 A T 11: 3,355,461 D35E probably benign Het
Lrrc37a G A 11: 103,498,966 P1878S probably benign Het
Mansc4 T A 6: 147,075,675 I148F probably benign Het
Mei1 A G 15: 82,103,312 N859S probably benign Het
Mib1 A G 18: 10,812,064 D987G probably damaging Het
Mroh8 A G 2: 157,271,975 V132A possibly damaging Het
Npnt T C 3: 132,948,132 I29M probably benign Het
Nrap T C 19: 56,384,105 D138G probably damaging Het
Olfr1 A T 11: 73,395,092 I310N probably benign Het
Olfr5 T C 7: 6,480,932 M75V probably benign Het
Olfr512 A G 7: 108,713,695 Y102C probably damaging Het
Olfr91 T A 17: 37,093,808 E22V probably damaging Het
Osbpl5 A C 7: 143,741,671 probably null Het
Pcna-ps2 T C 19: 9,283,683 V102A possibly damaging Het
Pik3c2g T C 6: 139,622,548 S221P probably damaging Het
Plppr3 A G 10: 79,866,425 I271T probably damaging Het
Prkar1b C T 5: 139,127,643 A41T probably benign Het
Prkcsh A G 9: 22,012,868 D458G probably damaging Het
Prr14 G T 7: 127,475,490 R398L possibly damaging Het
Ptafr A G 4: 132,579,985 R229G probably damaging Het
Rbp3 T C 14: 33,954,545 F150S probably damaging Het
Rel C T 11: 23,742,761 G424D probably benign Het
Rlf T C 4: 121,150,112 Y557C probably damaging Het
Samt3 A C X: 86,047,134 M211L probably benign Het
Selenop A T 15: 3,275,694 I111F probably damaging Het
Slc2a2 G A 3: 28,717,441 M173I probably benign Het
Slc43a1 G T 2: 84,856,889 G361V possibly damaging Het
Slit2 G A 5: 48,249,836 V870M probably damaging Het
Ssxb10 A G X: 8,331,019 D77G probably benign Het
Stk32b T A 5: 37,649,114 I29F probably damaging Het
Stra6l T A 4: 45,867,237 C161* probably null Het
Tecpr2 T A 12: 110,954,785 M1264K probably benign Het
Tfap2c A T 2: 172,557,236 I468F probably damaging Het
Ticam1 C T 17: 56,271,555 R180H probably damaging Het
Tlr4 T A 4: 66,841,035 N688K probably benign Het
Tmem35b A T 4: 127,126,053 probably benign Het
Ugt2b34 T C 5: 86,906,313 E203G probably damaging Het
Vegfa A C 17: 46,018,860 *393G probably null Het
Vmn2r16 T C 5: 109,364,024 V699A probably benign Het
Zfp324 T C 7: 12,971,218 S445P probably damaging Het
Zfp982 T A 4: 147,512,592 C135* probably null Het
Zfp990 A C 4: 145,536,869 N146H probably damaging Het
Zfyve26 A G 12: 79,255,243 Y431H possibly damaging Het
Other mutations in Atrn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Atrn APN 2 130958079 missense probably damaging 1.00
IGL00571:Atrn APN 2 130995048 missense probably damaging 1.00
IGL01092:Atrn APN 2 130947636 nonsense probably null
IGL01572:Atrn APN 2 131002795 missense probably damaging 1.00
IGL01924:Atrn APN 2 130935565 missense probably damaging 1.00
IGL02116:Atrn APN 2 130958089 missense probably damaging 1.00
IGL02372:Atrn APN 2 131002754 splice site probably benign
IGL02390:Atrn APN 2 131020977 missense possibly damaging 0.82
IGL02548:Atrn APN 2 130972282 missense probably damaging 1.00
IGL02749:Atrn APN 2 130970144 nonsense probably null
IGL02749:Atrn APN 2 130947734 splice site probably benign
BB010:Atrn UTSW 2 130995066 missense probably damaging 1.00
BB020:Atrn UTSW 2 130995066 missense probably damaging 1.00
R0026:Atrn UTSW 2 130957920 missense probably damaging 1.00
R0403:Atrn UTSW 2 130906859 missense probably damaging 1.00
R0479:Atrn UTSW 2 130999165 nonsense probably null
R0544:Atrn UTSW 2 130986826 missense probably damaging 1.00
R0570:Atrn UTSW 2 130980134 missense probably benign 0.01
R0606:Atrn UTSW 2 130906856 missense possibly damaging 0.90
R0617:Atrn UTSW 2 130995085 critical splice donor site probably null
R0658:Atrn UTSW 2 130970227 critical splice donor site probably null
R1108:Atrn UTSW 2 130957914 missense probably damaging 1.00
R1112:Atrn UTSW 2 130999161 missense probably benign 0.04
R1219:Atrn UTSW 2 131021007 missense possibly damaging 0.90
R1422:Atrn UTSW 2 130957914 missense probably damaging 1.00
R1524:Atrn UTSW 2 130957080 missense probably benign 0.15
R1653:Atrn UTSW 2 130935624 missense probably benign
R1795:Atrn UTSW 2 130972288 missense probably benign
R1807:Atrn UTSW 2 130982772 missense possibly damaging 0.94
R1920:Atrn UTSW 2 130995051 missense probably damaging 1.00
R1921:Atrn UTSW 2 130995051 missense probably damaging 1.00
R1935:Atrn UTSW 2 130958035 missense probably damaging 1.00
R2000:Atrn UTSW 2 130935588 missense probably damaging 1.00
R2143:Atrn UTSW 2 130957996 missense probably benign 0.03
R2336:Atrn UTSW 2 130957954 missense probably damaging 1.00
R2679:Atrn UTSW 2 130961675 critical splice donor site probably null
R3426:Atrn UTSW 2 131020956 missense probably benign 0.06
R3909:Atrn UTSW 2 130994207 missense probably damaging 1.00
R4077:Atrn UTSW 2 130964930 critical splice donor site probably null
R4162:Atrn UTSW 2 130994228 splice site probably benign
R4195:Atrn UTSW 2 130933412 missense probably damaging 1.00
R4364:Atrn UTSW 2 130970208 missense probably benign 0.39
R4465:Atrn UTSW 2 130960468 missense probably benign 0.08
R4510:Atrn UTSW 2 130935577 nonsense probably null
R4511:Atrn UTSW 2 130935577 nonsense probably null
R4527:Atrn UTSW 2 130973504 missense probably benign 0.10
R4586:Atrn UTSW 2 130982042 missense probably damaging 1.00
R4592:Atrn UTSW 2 130999130 intron probably benign
R4658:Atrn UTSW 2 130933429 missense probably damaging 1.00
R4735:Atrn UTSW 2 131020990 missense probably benign 0.06
R4960:Atrn UTSW 2 130995047 nonsense probably null
R4999:Atrn UTSW 2 130975954 missense probably damaging 1.00
R5066:Atrn UTSW 2 130994193 missense possibly damaging 0.60
R5080:Atrn UTSW 2 130970124 missense possibly damaging 0.95
R5141:Atrn UTSW 2 130999130 intron probably benign
R5256:Atrn UTSW 2 130946019 missense probably benign 0.39
R5494:Atrn UTSW 2 131023075 missense probably damaging 1.00
R5678:Atrn UTSW 2 130970016 missense probably damaging 0.96
R5752:Atrn UTSW 2 130906544 unclassified probably benign
R5931:Atrn UTSW 2 130933436 missense possibly damaging 0.56
R6023:Atrn UTSW 2 131020980 missense probably benign 0.25
R6176:Atrn UTSW 2 130946091 missense probably benign 0.31
R6377:Atrn UTSW 2 130979969 missense probably damaging 1.00
R6433:Atrn UTSW 2 131023027 missense probably damaging 1.00
R7226:Atrn UTSW 2 130986744 missense probably damaging 0.99
R7402:Atrn UTSW 2 130947600 missense probably damaging 1.00
R7541:Atrn UTSW 2 130961571 missense possibly damaging 0.46
R7587:Atrn UTSW 2 130980114 missense probably damaging 1.00
R7872:Atrn UTSW 2 130970227 critical splice donor site probably null
R7910:Atrn UTSW 2 130964887 missense probably benign 0.04
R7913:Atrn UTSW 2 130970211 missense probably damaging 1.00
R7933:Atrn UTSW 2 130995066 missense probably damaging 1.00
R8044:Atrn UTSW 2 130935529 missense probably damaging 1.00
R8079:Atrn UTSW 2 131013641 missense probably null 1.00
R8093:Atrn UTSW 2 130975988 missense probably benign 0.00
R8203:Atrn UTSW 2 130960549 missense probably benign 0.00
R8234:Atrn UTSW 2 131023000 critical splice acceptor site probably null
R8462:Atrn UTSW 2 130935584 missense probably damaging 1.00
R8816:Atrn UTSW 2 130906878 missense probably damaging 1.00
R8816:Atrn UTSW 2 131004574 missense probably damaging 1.00
R8831:Atrn UTSW 2 130906601 missense probably benign 0.22
R8937:Atrn UTSW 2 130999237 missense probably benign 0.00
RF009:Atrn UTSW 2 130906922 missense probably benign 0.12
X0024:Atrn UTSW 2 130958139 missense probably damaging 1.00
Z1088:Atrn UTSW 2 130973399 missense probably benign
Z1176:Atrn UTSW 2 130946193 missense probably benign 0.27
Z1177:Atrn UTSW 2 130946042 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTTGGTCTTTACCTCGGAGCAG -3'
(R):5'- TTCAGATCACCTGCAGCCAG -3'

Sequencing Primer
(F):5'- TTACCTCGGAGCAGTGCGATG -3'
(R):5'- CCAGGAGTTGGTACACAAAGCC -3'
Posted On2014-08-25