Incidental Mutation 'R2012:Trpm7'
ID219877
Institutional Source Beutler Lab
Gene Symbol Trpm7
Ensembl Gene ENSMUSG00000027365
Gene Nametransient receptor potential cation channel, subfamily M, member 7
SynonymsLTRPC7, 2310022G15Rik, CHAK, CHAK1, Ltpr7, 4833414K03Rik, 5033407O22Rik, TRP-PLIK
MMRRC Submission 040021-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2012 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location126791565-126876230 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 126823997 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 896 (Y896*)
Ref Sequence ENSEMBL: ENSMUSP00000099513 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028843] [ENSMUST00000103224]
PDB Structure
CRYSTAL STRUCTURE OF THE ATYPICAL PROTEIN KINASE DOMAIN OF A TRP CA-CHANNEL, CHAK (AMPPNP COMPLEX) [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF THE ATYPICAL PROTEIN KINASE DOMAIN OF A TRP CA-CHANNEL, CHAK (ADP-MG COMPLEX) [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF THE ATYPICAL PROTEIN KINASE DOMAIN OF A TRP CA-CHANNEL, CHAK (APO) [X-RAY DIFFRACTION]
Predicted Effect probably null
Transcript: ENSMUST00000028843
AA Change: Y896*
SMART Domains Protein: ENSMUSP00000028843
Gene: ENSMUSG00000027365
AA Change: Y896*

DomainStartEndE-ValueType
Blast:ANK 438 467 5e-6 BLAST
low complexity region 541 555 N/A INTRINSIC
transmembrane domain 757 774 N/A INTRINSIC
transmembrane domain 853 875 N/A INTRINSIC
Pfam:Ion_trans 887 1096 3e-8 PFAM
PDB:3E7K|H 1198 1249 6e-27 PDB
low complexity region 1385 1397 N/A INTRINSIC
Blast:Alpha_kinase 1398 1545 6e-64 BLAST
Alpha_kinase 1596 1813 3.77e-89 SMART
Predicted Effect probably null
Transcript: ENSMUST00000103224
AA Change: Y896*
SMART Domains Protein: ENSMUSP00000099513
Gene: ENSMUSG00000027365
AA Change: Y896*

DomainStartEndE-ValueType
Blast:ANK 438 467 5e-6 BLAST
low complexity region 541 555 N/A INTRINSIC
transmembrane domain 757 774 N/A INTRINSIC
Pfam:Ion_trans 855 1108 1.7e-9 PFAM
Pfam:TRPM_tetra 1194 1249 3.3e-29 PFAM
low complexity region 1385 1397 N/A INTRINSIC
Blast:Alpha_kinase 1398 1546 2e-64 BLAST
Alpha_kinase 1597 1814 3.77e-89 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is both an ion channel and a serine/threonine protein kinase. The kinase activity is essential for the ion channel function, which serves to increase intracellular calcium levels and to help regulate magnesium ion homeostasis. Defects in this gene are a cause of amyotrophic lateral sclerosis-parkinsonism/dementia complex of Guam. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a null allele display embryonic lehality. Mice with conditional deletion in developing thymocytes display a block in thymopoiesis. Mice homozygous for a kinase deleted allele exhibit prenatal lethality. Mice heterozygous for this allele exhibit altered magnesium homeostasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 109 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam22 A T 5: 8,117,634 S675R probably damaging Het
Akap5 A T 12: 76,329,348 H518L possibly damaging Het
Ankfn1 T C 11: 89,405,597 D102G probably damaging Het
Aox3 A T 1: 58,138,232 Y202F probably benign Het
Arhgef37 G A 18: 61,504,356 L412F possibly damaging Het
B4galt3 C T 1: 171,272,548 P121L probably damaging Het
BC034090 C T 1: 155,221,432 R640Q probably damaging Het
Bhmt A T 13: 93,625,392 Y128N probably damaging Het
Bin3 A G 14: 70,134,773 E173G probably damaging Het
C1qtnf1 T A 11: 118,448,284 F260Y probably benign Het
Ccdc14 G T 16: 34,690,722 G22V possibly damaging Het
Ccnc A T 4: 21,741,955 I135L possibly damaging Het
Chd3 T C 11: 69,349,052 D1650G probably benign Het
Cherp A C 8: 72,474,769 N14K probably damaging Het
Clint1 C T 11: 45,894,092 T306I possibly damaging Het
Cyb5r1 T A 1: 134,407,577 Y85N probably damaging Het
D830013O20Rik A G 12: 73,371,388 noncoding transcript Het
Dapk1 A T 13: 60,721,857 K304N probably damaging Het
Dnah6 T A 6: 73,067,466 N3169Y probably damaging Het
Dync2h1 A T 9: 7,169,589 I296K probably benign Het
Elp2 A T 18: 24,631,458 T621S probably benign Het
Eml6 G T 11: 29,831,128 Q635K possibly damaging Het
Exph5 G A 9: 53,367,166 M192I possibly damaging Het
Fmnl2 A G 2: 53,105,537 E424G probably damaging Het
Gas6 C T 8: 13,468,266 V523M probably damaging Het
Ggn A T 7: 29,173,763 probably null Het
Gimap8 A G 6: 48,656,353 T369A probably damaging Het
Gm13101 A T 4: 143,966,067 D121E probably benign Het
Grm5 T C 7: 88,074,872 I790T probably damaging Het
Gtpbp6 G A 5: 110,104,924 A354V probably damaging Het
Habp4 G A 13: 64,170,181 probably null Het
Has2 A G 15: 56,667,868 W484R probably damaging Het
Herc4 G T 10: 63,244,038 probably benign Het
Igf2 C A 7: 142,654,399 E106D probably damaging Het
Il17rb A T 14: 29,996,840 C428* probably null Het
Ipo11 A T 13: 106,919,622 N47K probably benign Het
Itga4 T G 2: 79,277,794 S197A probably damaging Het
Itpr1 T A 6: 108,440,536 M1788K probably benign Het
Kbtbd3 C T 9: 4,330,919 T431I probably benign Het
Kif5a A T 10: 127,239,175 V523E probably benign Het
Klhl41 A T 2: 69,683,496 D573V possibly damaging Het
Kndc1 C A 7: 139,921,280 H828Q possibly damaging Het
Leng8 T A 7: 4,143,610 V407D probably damaging Het
Mamdc2 C T 19: 23,310,851 E608K probably benign Het
Mcf2 T A X: 60,077,214 R850S probably damaging Het
Mmp2 A G 8: 92,850,203 N618S probably benign Het
Morn5 A T 2: 36,052,938 M17L probably benign Het
Nme8 T C 13: 19,696,883 N26S probably damaging Het
Nostrin C A 2: 69,144,767 probably null Het
Npy4r T A 14: 34,147,197 I45F possibly damaging Het
Olfr1163 A G 2: 88,070,719 V221A probably benign Het
Olfr1242 A G 2: 89,493,998 F105L probably benign Het
Olfr170 C T 16: 19,606,131 C179Y probably benign Het
Olfr263 T A 13: 21,133,489 M238K probably benign Het
Olfr317 T C 11: 58,732,388 Y259C possibly damaging Het
Olfr339 A G 2: 36,421,919 I174V probably benign Het
Olfr532 T A 7: 140,419,111 I221F probably damaging Het
Oxt A G 2: 130,576,652 D61G probably damaging Het
Patl1 T C 19: 11,939,817 L676P probably damaging Het
Pcdhb20 G A 18: 37,505,074 G218R probably damaging Het
Pdgfrb T A 18: 61,061,494 S114R probably benign Het
Pfdn5 A G 15: 102,326,521 N54S possibly damaging Het
Phldb1 G T 9: 44,728,036 T15N possibly damaging Het
Pink1 A C 4: 138,318,005 S253A probably null Het
Plag1 A T 4: 3,904,870 L107Q probably damaging Het
Pld5 C A 1: 175,964,013 V476L probably benign Het
Prrt2 C T 7: 127,019,409 A295T probably damaging Het
Ptgs1 A G 2: 36,237,656 I76V probably benign Het
Ptprz1 A G 6: 23,001,027 T1039A probably benign Het
Rbm20 G A 19: 53,859,428 C1135Y probably damaging Het
Recql5 A T 11: 115,897,097 N465K probably benign Het
Rgs12 A G 5: 35,030,528 S510G probably benign Het
Satb1 G A 17: 51,782,788 Q344* probably null Het
Sdr16c5 A G 4: 3,996,244 I283T probably benign Het
Serpinb3c T C 1: 107,271,844 S316G possibly damaging Het
Siglec1 A T 2: 131,083,357 Y395N probably damaging Het
Simc1 A G 13: 54,503,888 I5V probably benign Het
Slc27a2 T C 2: 126,553,615 V154A probably damaging Het
Slc27a5 A G 7: 12,997,707 L119S probably damaging Het
Slc35g2 T A 9: 100,553,067 T184S possibly damaging Het
Slc4a7 C T 14: 14,733,727 R46* probably null Het
Smcr8 T C 11: 60,778,184 F53L probably damaging Het
Spag9 T A 11: 94,092,375 L504* probably null Het
Spata31d1a A G 13: 59,702,556 I586T possibly damaging Het
Spata31d1c A T 13: 65,035,227 E194D possibly damaging Het
Spats2 A G 15: 99,178,494 E151G probably damaging Het
Sugp2 T A 8: 70,243,211 L278Q possibly damaging Het
Sult2a7 T A 7: 14,473,397 probably benign Het
Syde2 G T 3: 145,988,408 G137V possibly damaging Het
Synj1 A T 16: 90,938,696 F1456L probably damaging Het
Szt2 A G 4: 118,363,665 probably benign Het
Timd4 C A 11: 46,820,030 T253K possibly damaging Het
Tlr3 G T 8: 45,402,786 T119N possibly damaging Het
Tmc6 A G 11: 117,769,406 Y669H probably damaging Het
Tmem221 T C 8: 71,555,814 E194G probably benign Het
Tmem232 C A 17: 65,500,172 V9F probably benign Het
Tpm1 G A 9: 67,033,965 Q135* probably null Het
Trank1 A G 9: 111,365,028 T707A probably benign Het
Tuba4a A T 1: 75,216,339 Y210* probably null Het
Vegfa T G 17: 46,025,358 I279L probably benign Het
Vmn2r54 T A 7: 12,615,877 T593S probably damaging Het
Vmn2r93 A G 17: 18,316,578 I508V probably benign Het
Vps33a G T 5: 123,531,181 probably null Het
Wasl T A 6: 24,624,361 N231I probably damaging Het
Zbtb39 A G 10: 127,742,834 N426D probably benign Het
Zcchc6 A G 13: 59,811,538 V372A probably damaging Het
Zeb2 T G 2: 44,997,950 H350P probably damaging Het
Zfp112 T C 7: 24,125,300 F231S possibly damaging Het
Zfp180 T C 7: 24,104,518 S121P probably benign Het
Other mutations in Trpm7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00232:Trpm7 APN 2 126829031 missense possibly damaging 0.82
IGL01084:Trpm7 APN 2 126846072 critical splice donor site probably null
IGL01634:Trpm7 APN 2 126826818 missense probably damaging 1.00
IGL01678:Trpm7 APN 2 126816799 missense probably damaging 0.99
IGL02005:Trpm7 APN 2 126813184 missense probably damaging 0.97
IGL02064:Trpm7 APN 2 126797943 missense probably damaging 1.00
IGL02156:Trpm7 APN 2 126799243 unclassified probably benign
IGL02172:Trpm7 APN 2 126795328 missense possibly damaging 0.94
IGL02334:Trpm7 APN 2 126807362 missense probably benign
IGL02375:Trpm7 APN 2 126825744 missense probably damaging 1.00
IGL02388:Trpm7 APN 2 126819891 missense possibly damaging 0.80
IGL02552:Trpm7 APN 2 126840779 missense probably damaging 1.00
IGL02684:Trpm7 APN 2 126846159 missense probably damaging 0.99
IGL02901:Trpm7 APN 2 126807287 critical splice donor site probably null
P0037:Trpm7 UTSW 2 126816757 splice site probably benign
R0038:Trpm7 UTSW 2 126795468 missense probably damaging 1.00
R0139:Trpm7 UTSW 2 126812771 missense probably benign
R0165:Trpm7 UTSW 2 126797513 missense probably damaging 0.97
R0511:Trpm7 UTSW 2 126826718 nonsense probably null
R0543:Trpm7 UTSW 2 126848529 missense probably damaging 1.00
R0784:Trpm7 UTSW 2 126846072 critical splice donor site probably null
R0844:Trpm7 UTSW 2 126835508 missense probably damaging 1.00
R0865:Trpm7 UTSW 2 126799239 unclassified probably null
R0919:Trpm7 UTSW 2 126831238 missense probably damaging 1.00
R0972:Trpm7 UTSW 2 126805049 missense probably benign
R1109:Trpm7 UTSW 2 126797793 missense probably benign 0.01
R1118:Trpm7 UTSW 2 126822486 missense possibly damaging 0.63
R1278:Trpm7 UTSW 2 126825454 nonsense probably null
R1527:Trpm7 UTSW 2 126830162 missense probably benign 0.18
R1542:Trpm7 UTSW 2 126822599 nonsense probably null
R1882:Trpm7 UTSW 2 126812777 missense probably benign 0.00
R1951:Trpm7 UTSW 2 126831299 missense probably damaging 1.00
R2011:Trpm7 UTSW 2 126823997 nonsense probably null
R2026:Trpm7 UTSW 2 126812738 missense probably benign 0.39
R2067:Trpm7 UTSW 2 126797727 missense probably damaging 1.00
R2926:Trpm7 UTSW 2 126858409 splice site probably benign
R3082:Trpm7 UTSW 2 126844422 missense possibly damaging 0.90
R3552:Trpm7 UTSW 2 126826710 splice site probably benign
R3607:Trpm7 UTSW 2 126796428 intron probably benign
R3739:Trpm7 UTSW 2 126851521 missense probably damaging 1.00
R3943:Trpm7 UTSW 2 126831218 missense possibly damaging 0.94
R4161:Trpm7 UTSW 2 126816831 missense probably damaging 1.00
R4176:Trpm7 UTSW 2 126829163 missense possibly damaging 0.83
R4392:Trpm7 UTSW 2 126795509 splice site probably null
R4392:Trpm7 UTSW 2 126848538 missense probably damaging 1.00
R4404:Trpm7 UTSW 2 126833715 missense probably damaging 0.97
R4574:Trpm7 UTSW 2 126797211 missense probably benign 0.01
R4714:Trpm7 UTSW 2 126840783 nonsense probably null
R4807:Trpm7 UTSW 2 126831229 missense probably benign 0.00
R4815:Trpm7 UTSW 2 126858492 missense probably damaging 1.00
R4846:Trpm7 UTSW 2 126813185 missense possibly damaging 0.63
R4972:Trpm7 UTSW 2 126824058 missense probably damaging 1.00
R5097:Trpm7 UTSW 2 126796336 critical splice donor site probably null
R5263:Trpm7 UTSW 2 126821217 missense probably benign 0.34
R5361:Trpm7 UTSW 2 126829241 missense possibly damaging 0.77
R5377:Trpm7 UTSW 2 126842855 critical splice donor site probably null
R5574:Trpm7 UTSW 2 126813030 missense probably benign
R5782:Trpm7 UTSW 2 126797714 missense probably benign 0.04
R5840:Trpm7 UTSW 2 126822611 nonsense probably null
R6044:Trpm7 UTSW 2 126814745 missense probably damaging 1.00
R6178:Trpm7 UTSW 2 126837381 missense probably damaging 1.00
R6196:Trpm7 UTSW 2 126825639 missense possibly damaging 0.66
R6457:Trpm7 UTSW 2 126807294 missense probably benign
R6530:Trpm7 UTSW 2 126812711 missense probably damaging 1.00
R6764:Trpm7 UTSW 2 126844420 missense possibly damaging 0.79
R6841:Trpm7 UTSW 2 126813021 missense probably benign 0.00
R6868:Trpm7 UTSW 2 126837414 missense probably damaging 1.00
R7250:Trpm7 UTSW 2 126826765 missense possibly damaging 0.87
R7402:Trpm7 UTSW 2 126799206 missense probably damaging 1.00
R7451:Trpm7 UTSW 2 126826737 missense probably damaging 0.99
R7486:Trpm7 UTSW 2 126831195 critical splice donor site probably null
R7509:Trpm7 UTSW 2 126849922 missense probably damaging 1.00
X0026:Trpm7 UTSW 2 126829290 missense probably benign
Z1088:Trpm7 UTSW 2 126797281 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGTCAGATCACGTGTAATGAGTAAATC -3'
(R):5'- CATTTTAACTAGCCTACCATAGCTC -3'

Sequencing Primer
(F):5'- TGAGACAGTTTAACCTCGGC -3'
(R):5'- GCATATTTAGGATTTCTGATGCT -3'
Posted On2014-08-25