Incidental Mutation 'R1982:Slc2a2'
Institutional Source Beutler Lab
Gene Symbol Slc2a2
Ensembl Gene ENSMUSG00000027690
Gene Namesolute carrier family 2 (facilitated glucose transporter), member 2
SynonymsGlut2, liver-type glucose transporter, Glut-2
MMRRC Submission 039994-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1982 (G1)
Quality Score225
Status Not validated
Chromosomal Location28697903-28731359 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 28717441 bp
Amino Acid Change Methionine to Isoleucine at position 173 (M173I)
Ref Sequence ENSEMBL: ENSMUSP00000029240 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029240] [ENSMUST00000163536]
Predicted Effect probably benign
Transcript: ENSMUST00000029240
AA Change: M173I

PolyPhen 2 Score 0.356 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000029240
Gene: ENSMUSG00000027690
AA Change: M173I

Pfam:MFS_1 9 442 4.2e-23 PFAM
Pfam:Sugar_tr 13 498 2.4e-165 PFAM
Pfam:Folate_carrier 187 458 5.3e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163536
AA Change: V132I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000131046
Gene: ENSMUSG00000027690
AA Change: V132I

Pfam:Sugar_tr 13 133 3.9e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167704
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169047
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an integral plasma membrane glycoprotein of the liver, islet beta cells, intestine, and kidney epithelium. The encoded protein mediates facilitated bidirectional glucose transport. Because of its low affinity for glucose, it has been suggested as a glucose sensor. Mutations in this gene are associated with susceptibility to diseases, including Fanconi-Bickel syndrome and noninsulin-dependent diabetes mellitus (NIDDM). Alternative splicing results in multiple transcript variants of this gene. [provided by RefSeq, Jul 2013]
PHENOTYPE: Homozygous null mice are hyperglycemic with hypoinsulinemia and die within 2-3 weeks of life displaying increased plasma levels of glucagon, free fatty acids and beta-hydroxybutyrate, abnormal glucose tolerance, and altered postnatal development of pancreatic islets. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930415L06Rik A T X: 89,931,445 V382E probably damaging Het
Aatk G T 11: 120,013,514 P252Q probably damaging Het
Adamts4 T C 1: 171,258,934 V765A probably benign Het
Agfg2 A T 5: 137,664,253 V184E possibly damaging Het
Alas1 A T 9: 106,238,185 I48N probably damaging Het
Anks1 T C 17: 27,985,121 V181A probably damaging Het
Anxa8 A T 14: 34,096,570 R261S probably damaging Het
Aqp4 T C 18: 15,393,551 D291G probably damaging Het
Atrn A G 2: 130,970,222 R696G probably benign Het
Barx2 A C 9: 31,913,012 I27S probably damaging Het
Btnl1 A T 17: 34,379,751 I114L possibly damaging Het
Casq1 C T 1: 172,215,530 A200T probably damaging Het
Ccdc33 T A 9: 58,117,168 E225D probably benign Het
Cd84 C A 1: 171,884,585 probably null Het
Ceacam9 T G 7: 16,725,307 L177R probably benign Het
Cenpi T A X: 134,318,033 F161L possibly damaging Het
Cep63 T C 9: 102,602,880 K251E probably damaging Het
Cetn3 A G 13: 81,784,697 E25G probably damaging Het
Crybg3 T C 16: 59,544,125 D2378G possibly damaging Het
Ddx19b T C 8: 111,009,343 T357A possibly damaging Het
Dpep2 A C 8: 105,989,455 Y266* probably null Het
Dqx1 G A 6: 83,058,577 D24N probably damaging Het
Dsg4 A T 18: 20,471,212 Y912F probably damaging Het
Fam71f2 A G 6: 29,285,922 T69A probably benign Het
Fezf2 G T 14: 12,344,405 P261T probably benign Het
Fmo1 T C 1: 162,839,756 I163M possibly damaging Het
Gatad2a G A 8: 69,913,132 R428* probably null Het
Gfpt1 T A 6: 87,054,630 F85I possibly damaging Het
Gimap7 A T 6: 48,724,241 I254F possibly damaging Het
Glcci1 T C 6: 8,592,980 S261P probably damaging Het
Glis3 A T 19: 28,531,274 F437I probably damaging Het
Glp1r C A 17: 30,925,627 S258* probably null Het
Gm13023 C A 4: 143,795,150 H445Q probably benign Het
Gm7030 T A 17: 36,128,722 D122V probably damaging Het
Gpt2 C T 8: 85,516,203 A288V possibly damaging Het
Grin2c G T 11: 115,260,905 S76R possibly damaging Het
Guf1 T A 5: 69,567,226 Y447* probably null Het
Hectd1 A C 12: 51,785,841 L916V probably damaging Het
Hnf4g A G 3: 3,638,208 K96E probably damaging Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Ifi207 T G 1: 173,735,239 M114L probably benign Het
Ifi35 A T 11: 101,458,286 E252V probably damaging Het
Igsf9b G A 9: 27,322,239 R345H possibly damaging Het
Itih3 T C 14: 30,923,583 probably benign Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Kidins220 A T 12: 25,051,194 M1252L probably benign Het
Kifap3 T A 1: 163,862,022 L525* probably null Het
Limk2 A T 11: 3,355,461 D35E probably benign Het
Lrrc37a G A 11: 103,498,966 P1878S probably benign Het
Mansc4 T A 6: 147,075,675 I148F probably benign Het
Mei1 A G 15: 82,103,312 N859S probably benign Het
Mib1 A G 18: 10,812,064 D987G probably damaging Het
Mroh8 A G 2: 157,271,975 V132A possibly damaging Het
Npnt T C 3: 132,948,132 I29M probably benign Het
Nrap T C 19: 56,384,105 D138G probably damaging Het
Olfr1 A T 11: 73,395,092 I310N probably benign Het
Olfr5 T C 7: 6,480,932 M75V probably benign Het
Olfr512 A G 7: 108,713,695 Y102C probably damaging Het
Olfr91 T A 17: 37,093,808 E22V probably damaging Het
Osbpl5 A C 7: 143,741,671 probably null Het
Pcna-ps2 T C 19: 9,283,683 V102A possibly damaging Het
Pik3c2g T C 6: 139,622,548 S221P probably damaging Het
Plppr3 A G 10: 79,866,425 I271T probably damaging Het
Prkar1b C T 5: 139,127,643 A41T probably benign Het
Prkcsh A G 9: 22,012,868 D458G probably damaging Het
Prr14 G T 7: 127,475,490 R398L possibly damaging Het
Ptafr A G 4: 132,579,985 R229G probably damaging Het
Rbp3 T C 14: 33,954,545 F150S probably damaging Het
Rel C T 11: 23,742,761 G424D probably benign Het
Rlf T C 4: 121,150,112 Y557C probably damaging Het
Samt3 A C X: 86,047,134 M211L probably benign Het
Selenop A T 15: 3,275,694 I111F probably damaging Het
Slc43a1 G T 2: 84,856,889 G361V possibly damaging Het
Slit2 G A 5: 48,249,836 V870M probably damaging Het
Ssxb10 A G X: 8,331,019 D77G probably benign Het
Stk32b T A 5: 37,649,114 I29F probably damaging Het
Stra6l T A 4: 45,867,237 C161* probably null Het
Tecpr2 T A 12: 110,954,785 M1264K probably benign Het
Tfap2c A T 2: 172,557,236 I468F probably damaging Het
Ticam1 C T 17: 56,271,555 R180H probably damaging Het
Tlr4 T A 4: 66,841,035 N688K probably benign Het
Tmem35b A T 4: 127,126,053 probably benign Het
Ugt2b34 T C 5: 86,906,313 E203G probably damaging Het
Vegfa A C 17: 46,018,860 *393G probably null Het
Vmn2r16 T C 5: 109,364,024 V699A probably benign Het
Zfp324 T C 7: 12,971,218 S445P probably damaging Het
Zfp982 T A 4: 147,512,592 C135* probably null Het
Zfp990 A C 4: 145,536,869 N146H probably damaging Het
Zfyve26 A G 12: 79,255,243 Y431H possibly damaging Het
Other mutations in Slc2a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00836:Slc2a2 APN 3 28718741 missense possibly damaging 0.86
IGL01582:Slc2a2 APN 3 28708488 missense probably benign 0.01
IGL01762:Slc2a2 APN 3 28717472 missense probably damaging 1.00
IGL01942:Slc2a2 APN 3 28705803 missense probably damaging 1.00
IGL02128:Slc2a2 APN 3 28719401 missense probably damaging 1.00
IGL02218:Slc2a2 APN 3 28698025 missense possibly damaging 0.94
IGL02278:Slc2a2 APN 3 28717455 missense probably damaging 0.99
IGL02507:Slc2a2 APN 3 28727111 missense probably benign 0.00
IGL02649:Slc2a2 APN 3 28718736 missense probably damaging 0.97
IGL03323:Slc2a2 APN 3 28726290 missense probably damaging 1.00
IGL03147:Slc2a2 UTSW 3 28719370 missense possibly damaging 0.56
R0063:Slc2a2 UTSW 3 28717440 missense probably damaging 0.98
R0063:Slc2a2 UTSW 3 28717440 missense probably damaging 0.98
R0365:Slc2a2 UTSW 3 28708679 critical splice donor site probably null
R0494:Slc2a2 UTSW 3 28727277 missense probably benign 0.01
R0519:Slc2a2 UTSW 3 28718816 missense possibly damaging 0.54
R1292:Slc2a2 UTSW 3 28717488 missense probably damaging 1.00
R1755:Slc2a2 UTSW 3 28713662 intron probably null
R1965:Slc2a2 UTSW 3 28719485 missense probably damaging 1.00
R1966:Slc2a2 UTSW 3 28719485 missense probably damaging 1.00
R2937:Slc2a2 UTSW 3 28718771 missense probably damaging 1.00
R3121:Slc2a2 UTSW 3 28721749 missense probably benign 0.01
R3721:Slc2a2 UTSW 3 28727152 missense probably damaging 1.00
R4799:Slc2a2 UTSW 3 28717532 critical splice donor site probably null
R5206:Slc2a2 UTSW 3 28708607 missense probably damaging 1.00
R6829:Slc2a2 UTSW 3 28727441 nonsense probably null
R6864:Slc2a2 UTSW 3 28721725 missense probably damaging 1.00
R6932:Slc2a2 UTSW 3 28717519 missense probably benign 0.40
R7178:Slc2a2 UTSW 3 28719482 missense possibly damaging 0.90
R7599:Slc2a2 UTSW 3 28698017 start codon destroyed probably null 0.02
R7616:Slc2a2 UTSW 3 28727111 missense probably benign 0.00
Predicted Primers PCR Primer

Sequencing Primer
Posted On2014-08-25