Mutagenetix > Incidental Mutations

Incidental Mutation 'R1982:Tlr4'

219889

Institutional Source

Beutler Lab

Gene Symbol

Tlr4

Ensembl Gene

ENSMUSG00000039005

Gene Name

toll-like receptor 4

Synonyms

Rasl2-8, Lps, lipopolysaccharide response

MMRRC Submission

039994-MU

Accession Numbers

MGI: 96824

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1982 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

66827584-66930284 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 66841035 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 688 (N688K)

Ref Sequence

ENSEMBL: ENSMUSP00000045770 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048096] [ENSMUST00000107365]

AlphaFold

Q9QUK6

PDB Structure

Crystal structure of mouse TLR4 and mouse MD-2 complex [X-RAY DIFFRACTION]
Crystal structure of mouse TLR4/MD-2/lipid IVa complex [X-RAY DIFFRACTION]
Crystal structure of mouse TLR4/MD-2/LPS complex [X-RAY DIFFRACTION]

Predicted Effect

probably benign
Transcript: ENSMUST00000048096
AA Change: N688K

PolyPhen 2 Score 0.403 (Sensitivity: 0.89; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000045770
Gene: ENSMUSG00000039005
AA Change: N688K

Domain	Start	End	E-Value	Type
LRR	76	99	7.36e0	SMART
LRR	100	123	1.86e0	SMART
LRR	173	196	8.24e0	SMART
LRR	370	401	4.33e1	SMART
LRR	468	492	2.54e2	SMART
LRR	493	516	1.86e2	SMART
LRR	517	540	1.67e2	SMART
LRR	541	563	1.92e2	SMART
LRRCT	576	626	4.74e-3	SMART
transmembrane domain	636	658	N/A	INTRINSIC
TIR	671	816	7.3e-39	SMART
low complexity region	822	833	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000107365

SMART Domains

Protein: ENSMUSP00000102988
Gene: ENSMUSG00000039005

Domain	Start	End	E-Value	Type
PDB:3VQ2\|B	22	86	2e-38	PDB
SCOP:d1m0za_	27	86	4e-6	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143580

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147008

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.5%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene belongs to the evolutionarily-conserved Toll-like receptor family, whose members are type-1 transmembrane proteins that are involved in innate immunity. Toll-like receptors are characterized by an extracellular leucine-rich repeat domain that functions in ligand recognition and an intracellular toll/interleukin-1 receptor-like domain that is crucial for signal transduction. The receptor encoded by this gene mediates the innate immune response to bacterial lipopolysaccharide, a major component of the outer membrane of Gram-negative bacteria, through synthesis of pro-inflammatory cytokines and chemokines. In addition, this protein can recognize other pathogens from Gram-negative and Gram-positive bacteria as well as viral components. Mice deficient in this gene display a number of immune response-related phenotypes including hyporesponsiveness to bacterial lipopolysaccharide and increased levels of respiratory syncytial virus compared to controls. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygotes for spontaneous or targeted mutations are hyporesponsive to bacterial lipopolysaccharide and more susceptible to infection by gram negative bacteria. [provided by MGI curators]

Allele List at MGI

All alleles(10) : Targeted(2) Spontaneous(6) Chemically induced(2)

Other mutations in this stock

Total: 89 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930415L06Rik	A	T	X: 89,931,445	V382E	probably damaging	Het
Aatk	G	T	11: 120,013,514	P252Q	probably damaging	Het
Adamts4	T	C	1: 171,258,934	V765A	probably benign	Het
Agfg2	A	T	5: 137,664,253	V184E	possibly damaging	Het
Alas1	A	T	9: 106,238,185	I48N	probably damaging	Het
Anks1	T	C	17: 27,985,121	V181A	probably damaging	Het
Anxa8	A	T	14: 34,096,570	R261S	probably damaging	Het
Aqp4	T	C	18: 15,393,551	D291G	probably damaging	Het
Atrn	A	G	2: 130,970,222	R696G	probably benign	Het
Barx2	A	C	9: 31,913,012	I27S	probably damaging	Het
Btnl1	A	T	17: 34,379,751	I114L	possibly damaging	Het
Casq1	C	T	1: 172,215,530	A200T	probably damaging	Het
Ccdc33	T	A	9: 58,117,168	E225D	probably benign	Het
Cd84	C	A	1: 171,884,585		probably null	Het
Ceacam9	T	G	7: 16,725,307	L177R	probably benign	Het
Cenpi	T	A	X: 134,318,033	F161L	possibly damaging	Het
Cep63	T	C	9: 102,602,880	K251E	probably damaging	Het
Cetn3	A	G	13: 81,784,697	E25G	probably damaging	Het
Crybg3	T	C	16: 59,544,125	D2378G	possibly damaging	Het
Ddx19b	T	C	8: 111,009,343	T357A	possibly damaging	Het
Dpep2	A	C	8: 105,989,455	Y266*	probably null	Het
Dqx1	G	A	6: 83,058,577	D24N	probably damaging	Het
Dsg4	A	T	18: 20,471,212	Y912F	probably damaging	Het
Fam71f2	A	G	6: 29,285,922	T69A	probably benign	Het
Fezf2	G	T	14: 12,344,405	P261T	probably benign	Het
Fmo1	T	C	1: 162,839,756	I163M	possibly damaging	Het
Gatad2a	G	A	8: 69,913,132	R428*	probably null	Het
Gfpt1	T	A	6: 87,054,630	F85I	possibly damaging	Het
Gimap7	A	T	6: 48,724,241	I254F	possibly damaging	Het
Glcci1	T	C	6: 8,592,980	S261P	probably damaging	Het
Glis3	A	T	19: 28,531,274	F437I	probably damaging	Het
Glp1r	C	A	17: 30,925,627	S258*	probably null	Het
Gm13023	C	A	4: 143,795,150	H445Q	probably benign	Het
Gm7030	T	A	17: 36,128,722	D122V	probably damaging	Het
Gpt2	C	T	8: 85,516,203	A288V	possibly damaging	Het
Grin2c	G	T	11: 115,260,905	S76R	possibly damaging	Het
Guf1	T	A	5: 69,567,226	Y447*	probably null	Het
Hectd1	A	C	12: 51,785,841	L916V	probably damaging	Het
Hnf4g	A	G	3: 3,638,208	K96E	probably damaging	Het
Hsh2d	G	A	8: 72,200,460	D229N	probably benign	Het
Ifi207	T	G	1: 173,735,239	M114L	probably benign	Het
Ifi35	A	T	11: 101,458,286	E252V	probably damaging	Het
Igsf9b	G	A	9: 27,322,239	R345H	possibly damaging	Het
Itih3	T	C	14: 30,923,583		probably benign	Het
Kcnh8	GAGACCAACGAGCAGCTGATGCTTCAGA	GAGA	17: 52,725,906	74	probably benign	Het
Kidins220	A	T	12: 25,051,194	M1252L	probably benign	Het
Kifap3	T	A	1: 163,862,022	L525*	probably null	Het
Limk2	A	T	11: 3,355,461	D35E	probably benign	Het
Lrrc37a	G	A	11: 103,498,966	P1878S	probably benign	Het
Mansc4	T	A	6: 147,075,675	I148F	probably benign	Het
Mei1	A	G	15: 82,103,312	N859S	probably benign	Het
Mib1	A	G	18: 10,812,064	D987G	probably damaging	Het
Mroh8	A	G	2: 157,271,975	V132A	possibly damaging	Het
Npnt	T	C	3: 132,948,132	I29M	probably benign	Het
Nrap	T	C	19: 56,384,105	D138G	probably damaging	Het
Olfr1	A	T	11: 73,395,092	I310N	probably benign	Het
Olfr5	T	C	7: 6,480,932	M75V	probably benign	Het
Olfr512	A	G	7: 108,713,695	Y102C	probably damaging	Het
Olfr91	T	A	17: 37,093,808	E22V	probably damaging	Het
Osbpl5	A	C	7: 143,741,671		probably null	Het
Pcna-ps2	T	C	19: 9,283,683	V102A	possibly damaging	Het
Pik3c2g	T	C	6: 139,622,548	S221P	probably damaging	Het
Plppr3	A	G	10: 79,866,425	I271T	probably damaging	Het
Prkar1b	C	T	5: 139,127,643	A41T	probably benign	Het
Prkcsh	A	G	9: 22,012,868	D458G	probably damaging	Het
Prr14	G	T	7: 127,475,490	R398L	possibly damaging	Het
Ptafr	A	G	4: 132,579,985	R229G	probably damaging	Het
Rbp3	T	C	14: 33,954,545	F150S	probably damaging	Het
Rel	C	T	11: 23,742,761	G424D	probably benign	Het
Rlf	T	C	4: 121,150,112	Y557C	probably damaging	Het
Samt3	A	C	X: 86,047,134	M211L	probably benign	Het
Selenop	A	T	15: 3,275,694	I111F	probably damaging	Het
Slc2a2	G	A	3: 28,717,441	M173I	probably benign	Het
Slc43a1	G	T	2: 84,856,889	G361V	possibly damaging	Het
Slit2	G	A	5: 48,249,836	V870M	probably damaging	Het
Ssxb10	A	G	X: 8,331,019	D77G	probably benign	Het
Stk32b	T	A	5: 37,649,114	I29F	probably damaging	Het
Stra6l	T	A	4: 45,867,237	C161*	probably null	Het
Tecpr2	T	A	12: 110,954,785	M1264K	probably benign	Het
Tfap2c	A	T	2: 172,557,236	I468F	probably damaging	Het
Ticam1	C	T	17: 56,271,555	R180H	probably damaging	Het
Tmem35b	A	T	4: 127,126,053		probably benign	Het
Ugt2b34	T	C	5: 86,906,313	E203G	probably damaging	Het
Vegfa	A	C	17: 46,018,860	*393G	probably null	Het
Vmn2r16	T	C	5: 109,364,024	V699A	probably benign	Het
Zfp324	T	C	7: 12,971,218	S445P	probably damaging	Het
Zfp982	T	A	4: 147,512,592	C135*	probably null	Het
Zfp990	A	C	4: 145,536,869	N146H	probably damaging	Het
Zfyve26	A	G	12: 79,255,243	Y431H	possibly damaging	Het

Other mutations in Tlr4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01120:Tlr4	APN	4	66840425	missense	probably benign	0.01
IGL01343:Tlr4	APN	4	66833887	splice site	probably benign
IGL01669:Tlr4	APN	4	66841267	missense	possibly damaging	0.48
IGL01875:Tlr4	APN	4	66839489	missense	probably damaging	1.00
IGL02138:Tlr4	APN	4	66840965	missense	probably damaging	0.99
IGL02244:Tlr4	APN	4	66834061	critical splice donor site	probably null
IGL02793:Tlr4	APN	4	66839444	missense	probably damaging	1.00
IGL03269:Tlr4	APN	4	66840796	missense	probably damaging	1.00
IGL03288:Tlr4	APN	4	66839753	missense	probably damaging	0.99
bugsy	UTSW	4	66839254	nonsense	probably null
Cruyff	UTSW	4	66840326	missense	probably damaging	1.00
don_knotts	UTSW	4	66841172	missense	probably damaging	1.00
Guardiola	UTSW	4	66839303	missense	probably damaging	1.00
Lops	UTSW	4	66833880	splice site	probably null
lps3	UTSW	4	66841097	missense	probably damaging	1.00
Lps4	UTSW	4	66841142	missense	probably damaging	1.00
milquetoast	UTSW	4	66839444	missense	probably damaging	1.00
salvador	UTSW	4	66840206	missense	probably damaging	0.99
R0449:Tlr4	UTSW	4	66839620	missense	probably damaging	0.99
R0481:Tlr4	UTSW	4	66827916	missense	probably benign	0.05
R0576:Tlr4	UTSW	4	66839495	missense	probably benign	0.00
R0827:Tlr4	UTSW	4	66833880	splice site	probably null
R1488:Tlr4	UTSW	4	66839549	missense	probably damaging	1.00
R1490:Tlr4	UTSW	4	66839374	missense	possibly damaging	0.56
R1522:Tlr4	UTSW	4	66839696	missense	possibly damaging	0.80
R1616:Tlr4	UTSW	4	66839480	missense	probably damaging	1.00
R1681:Tlr4	UTSW	4	66841105	missense	probably damaging	1.00
R1738:Tlr4	UTSW	4	66841076	missense	probably benign	0.19
R1888:Tlr4	UTSW	4	66841172	missense	probably damaging	1.00
R1888:Tlr4	UTSW	4	66841172	missense	probably damaging	1.00
R1929:Tlr4	UTSW	4	66839444	missense	probably damaging	1.00
R1998:Tlr4	UTSW	4	66840470	missense	probably damaging	1.00
R2186:Tlr4	UTSW	4	66839983	missense	possibly damaging	0.63
R2305:Tlr4	UTSW	4	66840101	missense	probably damaging	1.00
R3011:Tlr4	UTSW	4	66839254	nonsense	probably null
R3420:Tlr4	UTSW	4	66839536	missense	probably benign	0.37
R3422:Tlr4	UTSW	4	66839536	missense	probably benign	0.37
R3818:Tlr4	UTSW	4	66841316	missense	probably benign	0.00
R4212:Tlr4	UTSW	4	66840326	missense	probably damaging	1.00
R4213:Tlr4	UTSW	4	66840326	missense	probably damaging	1.00
R4417:Tlr4	UTSW	4	66839303	missense	probably damaging	1.00
R4630:Tlr4	UTSW	4	66839240	missense	probably benign	0.44
R4735:Tlr4	UTSW	4	66841198	missense	probably damaging	1.00
R5191:Tlr4	UTSW	4	66841379	missense	probably damaging	0.96
R5613:Tlr4	UTSW	4	66840885	missense	possibly damaging	0.94
R5705:Tlr4	UTSW	4	66833980	missense	probably damaging	1.00
R5726:Tlr4	UTSW	4	66840415	missense	probably benign
R6021:Tlr4	UTSW	4	66840866	missense	probably damaging	1.00
R6159:Tlr4	UTSW	4	66839833	missense	possibly damaging	0.92
R6227:Tlr4	UTSW	4	66840595	missense	probably benign
R7139:Tlr4	UTSW	4	66840283	missense	probably benign	0.06
R7199:Tlr4	UTSW	4	66841193	missense	probably damaging	0.99
R7220:Tlr4	UTSW	4	66839951	missense	probably benign
R7337:Tlr4	UTSW	4	66839954	missense	possibly damaging	0.86
R7487:Tlr4	UTSW	4	66924422	missense	probably benign	0.00
R7638:Tlr4	UTSW	4	66840206	missense	probably damaging	0.99
R7773:Tlr4	UTSW	4	66839599	missense	probably damaging	1.00
R7814:Tlr4	UTSW	4	66841079	missense	probably damaging	1.00
R7897:Tlr4	UTSW	4	66839821	missense	probably benign	0.07
R8044:Tlr4	UTSW	4	66827847	missense	probably benign	0.01
R8062:Tlr4	UTSW	4	66839850	missense	probably benign	0.00
R8080:Tlr4	UTSW	4	66839476	missense	probably damaging	1.00
R8446:Tlr4	UTSW	4	66839436	missense	probably damaging	0.98
R8916:Tlr4	UTSW	4	66929031	missense	probably benign	0.06
R9100:Tlr4	UTSW	4	66840281	missense	probably benign	0.08
R9415:Tlr4	UTSW	4	66827923	critical splice donor site	probably null
X0064:Tlr4	UTSW	4	66840140	missense	probably damaging	0.99
Z1088:Tlr4	UTSW	4	66929082	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- GTACAAGACAATCATCAGTGTGTC -3'
(R):5'- GCTGCTCAGAAACTGCCATG -3'

Sequencing Primer
(F):5'- AGACAATCATCAGTGTGTCAGTGGTC -3'
(R):5'- CTGCTCAGAAACTGCCATGTTTGAG -3'

Posted On

2014-08-25