Incidental Mutation 'R1982:Slit2'
Institutional Source Beutler Lab
Gene Symbol Slit2
Ensembl Gene ENSMUSG00000031558
Gene Nameslit guidance ligand 2
SynonymsDrad-1, Slil3, E130320P19Rik, E030015M03Rik
MMRRC Submission 039994-MU
Accession Numbers

Ncbi RefSeq: NM_178804.3; MGI: 1315205

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1982 (G1)
Quality Score225
Status Not validated
Chromosomal Location47983138-48307733 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 48249836 bp
Amino Acid Change Valine to Methionine at position 870 (V870M)
Ref Sequence ENSEMBL: ENSMUSP00000133912 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033967] [ENSMUST00000170109] [ENSMUST00000172493] [ENSMUST00000173107] [ENSMUST00000174313] [ENSMUST00000174421]
Predicted Effect silent
Transcript: ENSMUST00000033967
SMART Domains Protein: ENSMUSP00000033967
Gene: ENSMUSG00000031558

signal peptide 1 18 N/A INTRINSIC
LRRNT 27 59 6.53e-9 SMART
LRR 53 77 1.41e2 SMART
LRR_TYP 78 101 1.79e-2 SMART
LRR 102 125 2.45e0 SMART
LRR 126 149 9.96e-1 SMART
LRR 154 173 1.29e2 SMART
LRR_TYP 174 197 2.05e-2 SMART
LRRCT 209 258 3.42e-9 SMART
LRRNT 272 304 4.55e-8 SMART
LRR 298 322 3e1 SMART
LRR_TYP 323 346 1.95e-3 SMART
LRR_TYP 347 370 2.24e-3 SMART
LRR 371 394 1.31e0 SMART
LRR 395 418 2.49e-1 SMART
LRRCT 430 479 1.88e-6 SMART
LRRNT 497 529 1.45e-6 SMART
LRR_TYP 549 572 1.38e-3 SMART
LRR 597 620 9.96e-1 SMART
LRR_TYP 621 644 2.71e-2 SMART
LRRCT 656 705 3.56e-7 SMART
LRRNT 718 750 3.69e-8 SMART
LRR 768 791 7.36e0 SMART
LRR_TYP 792 815 5.59e-4 SMART
LRR_TYP 816 839 7.9e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000170109
AA Change: V878M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000127615
Gene: ENSMUSG00000031558
AA Change: V878M

signal peptide 1 18 N/A INTRINSIC
LRRNT 27 59 6.53e-9 SMART
LRR 53 77 1.41e2 SMART
LRR_TYP 78 101 1.79e-2 SMART
LRR 102 125 2.45e0 SMART
LRR 126 149 9.96e-1 SMART
LRR 154 173 1.29e2 SMART
LRR_TYP 174 197 2.05e-2 SMART
LRRCT 209 258 3.42e-9 SMART
LRRNT 272 304 4.55e-8 SMART
LRR 298 322 3e1 SMART
LRR_TYP 323 346 1.95e-3 SMART
LRR_TYP 347 370 2.24e-3 SMART
LRR 371 394 1.31e0 SMART
LRR 395 418 2.49e-1 SMART
LRRCT 430 479 1.88e-6 SMART
LRRNT 497 529 1.45e-6 SMART
LRR_TYP 549 572 1.38e-3 SMART
LRR 597 620 9.96e-1 SMART
LRR_TYP 621 644 2.71e-2 SMART
LRRCT 656 705 3.56e-7 SMART
LRRNT 718 750 3.69e-8 SMART
LRR 768 791 7.36e0 SMART
LRR_TYP 792 815 5.59e-4 SMART
LRR_TYP 816 839 7.9e-4 SMART
LRRCT 851 900 3.9e-13 SMART
EGF 913 947 3.73e-5 SMART
EGF 952 988 4.35e-6 SMART
EGF_CA 990 1026 2.21e-7 SMART
FOLN 993 1015 5.84e1 SMART
EGF 1031 1066 1.07e-5 SMART
EGF_CA 1068 1104 3.97e-9 SMART
FOLN 1116 1138 2.22e0 SMART
EGF 1116 1149 1.62e-5 SMART
LamG 1172 1308 4.82e-39 SMART
EGF 1327 1360 3.68e-4 SMART
EGF 1366 1399 3.88e-3 SMART
FOLN 1407 1429 3.34e0 SMART
EGF 1407 1440 4.46e-3 SMART
CT 1451 1520 4.23e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172484
Predicted Effect probably damaging
Transcript: ENSMUST00000172493
AA Change: V118M

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000134655
Gene: ENSMUSG00000031558
AA Change: V118M

LRR 20 43 3.1e-2 SMART
LRR_TYP 44 67 2.4e-6 SMART
LRR_TYP 68 91 3.2e-6 SMART
LRRCT 103 152 1.8e-15 SMART
EGF 176 210 1.8e-7 SMART
EGF 215 251 2.1e-8 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000173107
AA Change: V866M

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000133840
Gene: ENSMUSG00000031558
AA Change: V866M

signal peptide 1 18 N/A INTRINSIC
LRRNT 27 59 6.53e-9 SMART
LRR 53 77 1.41e2 SMART
LRR_TYP 78 101 1.79e-2 SMART
LRR 102 125 2.45e0 SMART
LRR 126 149 9.96e-1 SMART
LRR 154 173 1.29e2 SMART
LRR_TYP 174 197 2.05e-2 SMART
LRRCT 209 258 3.42e-9 SMART
LRRNT 272 304 4.55e-8 SMART
LRR 298 322 3e1 SMART
LRR_TYP 323 346 1.95e-3 SMART
LRR_TYP 347 370 2.24e-3 SMART
LRR 371 394 1.31e0 SMART
LRR 395 418 2.49e-1 SMART
LRRCT 430 479 1.88e-6 SMART
LRRNT 505 537 1.45e-6 SMART
LRR_TYP 557 580 1.38e-3 SMART
LRR 605 628 9.96e-1 SMART
LRR_TYP 629 652 2.71e-2 SMART
LRRCT 664 713 3.56e-7 SMART
LRRNT 726 758 3.69e-8 SMART
LRR 776 799 7.36e0 SMART
LRR_TYP 800 823 5.59e-4 SMART
LRR_TYP 824 847 7.9e-4 SMART
LRRCT 859 908 3.9e-13 SMART
EGF 921 955 3.73e-5 SMART
EGF 960 996 4.35e-6 SMART
EGF_CA 998 1034 2.21e-7 SMART
FOLN 1001 1023 5.84e1 SMART
EGF 1039 1074 1.07e-5 SMART
EGF_CA 1076 1112 3.97e-9 SMART
FOLN 1124 1146 2.22e0 SMART
EGF 1124 1157 1.62e-5 SMART
LamG 1180 1316 4.82e-39 SMART
EGF 1335 1368 3.68e-4 SMART
EGF 1374 1407 3.88e-3 SMART
FOLN 1415 1437 3.34e0 SMART
EGF 1415 1448 4.46e-3 SMART
CT 1459 1528 4.23e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173671
Predicted Effect probably damaging
Transcript: ENSMUST00000174313
AA Change: V870M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000133912
Gene: ENSMUSG00000031558
AA Change: V870M

signal peptide 1 18 N/A INTRINSIC
LRRNT 27 59 6.53e-9 SMART
LRR 53 77 1.41e2 SMART
LRR_TYP 78 101 1.79e-2 SMART
LRR 102 125 2.45e0 SMART
LRR 126 149 9.96e-1 SMART
LRR 154 173 1.29e2 SMART
LRR_TYP 174 197 2.05e-2 SMART
LRRCT 209 258 3.42e-9 SMART
LRRNT 276 308 4.55e-8 SMART
LRR 302 326 3e1 SMART
LRR_TYP 327 350 1.95e-3 SMART
LRR_TYP 351 374 2.24e-3 SMART
LRR 375 398 1.31e0 SMART
LRR 399 422 2.49e-1 SMART
LRRCT 434 483 1.88e-6 SMART
LRRNT 501 533 1.45e-6 SMART
LRR_TYP 553 576 1.38e-3 SMART
LRR 601 624 9.96e-1 SMART
LRR_TYP 625 648 2.71e-2 SMART
LRRCT 660 709 3.56e-7 SMART
LRRNT 722 754 3.69e-8 SMART
LRR 772 795 7.36e0 SMART
LRR_TYP 796 819 5.59e-4 SMART
LRR_TYP 820 843 7.9e-4 SMART
LRRCT 855 904 3.9e-13 SMART
EGF 917 951 3.73e-5 SMART
EGF 956 992 4.35e-6 SMART
EGF_CA 994 1030 2.21e-7 SMART
FOLN 997 1019 5.84e1 SMART
EGF 1035 1070 1.07e-5 SMART
EGF_CA 1072 1108 3.97e-9 SMART
FOLN 1120 1142 2.22e0 SMART
EGF 1120 1153 1.62e-5 SMART
LamG 1176 1312 4.82e-39 SMART
EGF 1331 1364 3.68e-4 SMART
EGF 1370 1403 3.88e-3 SMART
FOLN 1411 1433 3.34e0 SMART
EGF 1411 1444 4.46e-3 SMART
CT 1455 1524 4.23e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000174421
AA Change: V878M

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000134263
Gene: ENSMUSG00000031558
AA Change: V878M

signal peptide 1 18 N/A INTRINSIC
LRRNT 27 59 6.53e-9 SMART
LRR 53 77 1.41e2 SMART
LRR_TYP 78 101 1.79e-2 SMART
LRR 102 125 2.45e0 SMART
LRR 126 149 9.96e-1 SMART
LRR 154 173 1.29e2 SMART
LRR_TYP 174 197 2.05e-2 SMART
LRRCT 209 258 3.42e-9 SMART
LRRNT 276 308 4.55e-8 SMART
LRR 302 326 3e1 SMART
LRR_TYP 327 350 1.95e-3 SMART
LRR_TYP 351 374 2.24e-3 SMART
LRR 375 398 1.31e0 SMART
LRR 399 422 2.49e-1 SMART
LRRCT 434 483 1.88e-6 SMART
LRRNT 509 541 1.45e-6 SMART
LRR_TYP 561 584 1.38e-3 SMART
LRR 609 632 9.96e-1 SMART
LRR_TYP 633 656 2.71e-2 SMART
LRRCT 668 717 3.56e-7 SMART
LRRNT 730 762 3.69e-8 SMART
LRR 780 803 7.36e0 SMART
LRR_TYP 804 827 5.59e-4 SMART
LRR_TYP 828 851 7.9e-4 SMART
LRRCT 863 912 3.9e-13 SMART
EGF 925 959 3.73e-5 SMART
EGF 964 1000 4.35e-6 SMART
EGF_CA 1002 1047 4.74e-7 SMART
FOLN 1005 1027 5.84e1 SMART
EGF 1052 1087 1.07e-5 SMART
EGF_CA 1089 1125 3.97e-9 SMART
FOLN 1137 1159 2.22e0 SMART
EGF 1137 1170 1.62e-5 SMART
LamG 1193 1329 4.82e-39 SMART
EGF 1348 1381 3.68e-4 SMART
EGF 1387 1420 3.88e-3 SMART
FOLN 1428 1450 3.34e0 SMART
EGF 1428 1461 4.46e-3 SMART
CT 1472 1541 4.23e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199024
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype Strain: 2179460
FUNCTION: The protein encoded by this gene is a member of the Slit family of secreted glycoproteins, which function as ligands for the Robo family of immunoglobulin receptors. Slit proteins play highly conserved roles in axon guidance and neuronal migration and may also have functions during other cell migration processes including leukocyte migration. In mammals, members of the slit family are characterized by an N-terminal signal peptide, four leucine-rich repeats, nine epidermal growth factor repeats, and a C-terminal cysteine knot. Mice deficient for this gene exhibit abnormal axonal projections in the embryonic forebrain and develop supernumerary uretic buds that maintain improper connections to the nephric duct. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous mutants display perinatal lethality, abnormal ureteric bud development, multiple fused kidneys, multiple ureters, and hydroureter. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(4)

Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930415L06Rik A T X: 89,931,445 V382E probably damaging Het
Aatk G T 11: 120,013,514 P252Q probably damaging Het
Adamts4 T C 1: 171,258,934 V765A probably benign Het
Agfg2 A T 5: 137,664,253 V184E possibly damaging Het
Alas1 A T 9: 106,238,185 I48N probably damaging Het
Anks1 T C 17: 27,985,121 V181A probably damaging Het
Anxa8 A T 14: 34,096,570 R261S probably damaging Het
Aqp4 T C 18: 15,393,551 D291G probably damaging Het
Atrn A G 2: 130,970,222 R696G probably benign Het
Barx2 A C 9: 31,913,012 I27S probably damaging Het
Btnl1 A T 17: 34,379,751 I114L possibly damaging Het
Casq1 C T 1: 172,215,530 A200T probably damaging Het
Ccdc33 T A 9: 58,117,168 E225D probably benign Het
Cd84 C A 1: 171,884,585 probably null Het
Ceacam9 T G 7: 16,725,307 L177R probably benign Het
Cenpi T A X: 134,318,033 F161L possibly damaging Het
Cep63 T C 9: 102,602,880 K251E probably damaging Het
Cetn3 A G 13: 81,784,697 E25G probably damaging Het
Crybg3 T C 16: 59,544,125 D2378G possibly damaging Het
Ddx19b T C 8: 111,009,343 T357A possibly damaging Het
Dpep2 A C 8: 105,989,455 Y266* probably null Het
Dqx1 G A 6: 83,058,577 D24N probably damaging Het
Dsg4 A T 18: 20,471,212 Y912F probably damaging Het
Fam71f2 A G 6: 29,285,922 T69A probably benign Het
Fezf2 G T 14: 12,344,405 P261T probably benign Het
Fmo1 T C 1: 162,839,756 I163M possibly damaging Het
Gatad2a G A 8: 69,913,132 R428* probably null Het
Gfpt1 T A 6: 87,054,630 F85I possibly damaging Het
Gimap7 A T 6: 48,724,241 I254F possibly damaging Het
Glcci1 T C 6: 8,592,980 S261P probably damaging Het
Glis3 A T 19: 28,531,274 F437I probably damaging Het
Glp1r C A 17: 30,925,627 S258* probably null Het
Gm13023 C A 4: 143,795,150 H445Q probably benign Het
Gm7030 T A 17: 36,128,722 D122V probably damaging Het
Gpt2 C T 8: 85,516,203 A288V possibly damaging Het
Grin2c G T 11: 115,260,905 S76R possibly damaging Het
Guf1 T A 5: 69,567,226 Y447* probably null Het
Hectd1 A C 12: 51,785,841 L916V probably damaging Het
Hnf4g A G 3: 3,638,208 K96E probably damaging Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Ifi207 T G 1: 173,735,239 M114L probably benign Het
Ifi35 A T 11: 101,458,286 E252V probably damaging Het
Igsf9b G A 9: 27,322,239 R345H possibly damaging Het
Itih3 T C 14: 30,923,583 probably benign Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Kidins220 A T 12: 25,051,194 M1252L probably benign Het
Kifap3 T A 1: 163,862,022 L525* probably null Het
Limk2 A T 11: 3,355,461 D35E probably benign Het
Lrrc37a G A 11: 103,498,966 P1878S probably benign Het
Mansc4 T A 6: 147,075,675 I148F probably benign Het
Mei1 A G 15: 82,103,312 N859S probably benign Het
Mib1 A G 18: 10,812,064 D987G probably damaging Het
Mroh8 A G 2: 157,271,975 V132A possibly damaging Het
Npnt T C 3: 132,948,132 I29M probably benign Het
Nrap T C 19: 56,384,105 D138G probably damaging Het
Olfr1 A T 11: 73,395,092 I310N probably benign Het
Olfr5 T C 7: 6,480,932 M75V probably benign Het
Olfr512 A G 7: 108,713,695 Y102C probably damaging Het
Olfr91 T A 17: 37,093,808 E22V probably damaging Het
Osbpl5 A C 7: 143,741,671 probably null Het
Pcna-ps2 T C 19: 9,283,683 V102A possibly damaging Het
Pik3c2g T C 6: 139,622,548 S221P probably damaging Het
Plppr3 A G 10: 79,866,425 I271T probably damaging Het
Prkar1b C T 5: 139,127,643 A41T probably benign Het
Prkcsh A G 9: 22,012,868 D458G probably damaging Het
Prr14 G T 7: 127,475,490 R398L possibly damaging Het
Ptafr A G 4: 132,579,985 R229G probably damaging Het
Rbp3 T C 14: 33,954,545 F150S probably damaging Het
Rel C T 11: 23,742,761 G424D probably benign Het
Rlf T C 4: 121,150,112 Y557C probably damaging Het
Samt3 A C X: 86,047,134 M211L probably benign Het
Selenop A T 15: 3,275,694 I111F probably damaging Het
Slc2a2 G A 3: 28,717,441 M173I probably benign Het
Slc43a1 G T 2: 84,856,889 G361V possibly damaging Het
Ssxb10 A G X: 8,331,019 D77G probably benign Het
Stk32b T A 5: 37,649,114 I29F probably damaging Het
Stra6l T A 4: 45,867,237 C161* probably null Het
Tecpr2 T A 12: 110,954,785 M1264K probably benign Het
Tfap2c A T 2: 172,557,236 I468F probably damaging Het
Ticam1 C T 17: 56,271,555 R180H probably damaging Het
Tlr4 T A 4: 66,841,035 N688K probably benign Het
Tmem35b A T 4: 127,126,053 probably benign Het
Ugt2b34 T C 5: 86,906,313 E203G probably damaging Het
Vegfa A C 17: 46,018,860 *393G probably null Het
Vmn2r16 T C 5: 109,364,024 V699A probably benign Het
Zfp324 T C 7: 12,971,218 S445P probably damaging Het
Zfp982 T A 4: 147,512,592 C135* probably null Het
Zfp990 A C 4: 145,536,869 N146H probably damaging Het
Zfyve26 A G 12: 79,255,243 Y431H possibly damaging Het
Other mutations in Slit2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00791:Slit2 APN 5 48304032 missense possibly damaging 0.86
IGL00809:Slit2 APN 5 47989151 missense possibly damaging 0.88
IGL00811:Slit2 APN 5 47989151 missense possibly damaging 0.88
IGL00813:Slit2 APN 5 47989151 missense possibly damaging 0.88
IGL00815:Slit2 APN 5 47989151 missense possibly damaging 0.88
IGL00816:Slit2 APN 5 47989151 missense possibly damaging 0.88
IGL00817:Slit2 APN 5 47989151 missense possibly damaging 0.88
IGL00819:Slit2 APN 5 47989151 missense possibly damaging 0.88
IGL00820:Slit2 APN 5 47989151 missense possibly damaging 0.88
IGL00822:Slit2 APN 5 47989151 missense possibly damaging 0.88
IGL01077:Slit2 APN 5 48217443 splice site probably null
IGL01375:Slit2 APN 5 48281714 splice site probably benign
IGL01481:Slit2 APN 5 48302931 missense probably benign 0.05
IGL01934:Slit2 APN 5 48238405 missense possibly damaging 0.93
IGL01992:Slit2 APN 5 48238417 missense probably benign 0.01
IGL02315:Slit2 APN 5 47987871 missense probably damaging 0.98
IGL02328:Slit2 APN 5 48230304 missense probably damaging 1.00
IGL02366:Slit2 APN 5 48304068 missense possibly damaging 0.53
IGL02526:Slit2 APN 5 48304223 nonsense probably null
IGL02852:Slit2 APN 5 48244672 missense probably damaging 1.00
IGL02887:Slit2 APN 5 48217474 missense probably benign 0.44
IGL03123:Slit2 APN 5 48211339 missense probably damaging 1.00
IGL03182:Slit2 APN 5 48220053 missense possibly damaging 0.77
P0025:Slit2 UTSW 5 48304035 missense probably damaging 0.96
R0032:Slit2 UTSW 5 48256856 missense probably damaging 0.99
R0032:Slit2 UTSW 5 48256856 missense probably damaging 0.99
R0055:Slit2 UTSW 5 48281726 nonsense probably null
R0055:Slit2 UTSW 5 48281726 nonsense probably null
R0267:Slit2 UTSW 5 48182331 splice site probably benign
R0552:Slit2 UTSW 5 48238379 missense probably damaging 1.00
R0610:Slit2 UTSW 5 48275674 missense possibly damaging 0.77
R0883:Slit2 UTSW 5 48245573 splice site probably benign
R1390:Slit2 UTSW 5 48217490 missense probably benign 0.06
R1442:Slit2 UTSW 5 48238383 missense probably damaging 0.96
R1453:Slit2 UTSW 5 48257051 missense possibly damaging 0.88
R1508:Slit2 UTSW 5 48192249 missense probably damaging 0.98
R1639:Slit2 UTSW 5 48259654 missense probably damaging 1.00
R1705:Slit2 UTSW 5 48189472 missense probably damaging 0.99
R1828:Slit2 UTSW 5 48304030 missense probably damaging 1.00
R1897:Slit2 UTSW 5 48238423 missense probably damaging 1.00
R1908:Slit2 UTSW 5 48281988 missense probably damaging 1.00
R1919:Slit2 UTSW 5 48191016 unclassified probably benign
R2013:Slit2 UTSW 5 48302490 missense probably damaging 1.00
R2136:Slit2 UTSW 5 48304225 missense probably benign 0.03
R2655:Slit2 UTSW 5 48189575 missense possibly damaging 0.88
R3402:Slit2 UTSW 5 48283421 missense probably damaging 0.98
R3724:Slit2 UTSW 5 48256883 critical splice donor site probably null
R4176:Slit2 UTSW 5 48237244 splice site probably null
R4306:Slit2 UTSW 5 48302783 missense possibly damaging 0.83
R4397:Slit2 UTSW 5 48220081 critical splice donor site probably null
R4525:Slit2 UTSW 5 48249873 missense probably damaging 1.00
R4688:Slit2 UTSW 5 48257003 splice site probably null
R5026:Slit2 UTSW 5 48256805 missense probably damaging 0.99
R5138:Slit2 UTSW 5 48281967 missense probably damaging 1.00
R5465:Slit2 UTSW 5 48249912 missense probably damaging 1.00
R5471:Slit2 UTSW 5 48189555 missense probably damaging 1.00
R5699:Slit2 UTSW 5 48220991 critical splice donor site probably null
R5735:Slit2 UTSW 5 48259616 missense probably damaging 1.00
R5834:Slit2 UTSW 5 48259647 missense probably damaging 1.00
R5967:Slit2 UTSW 5 47985164 missense probably damaging 0.99
R6150:Slit2 UTSW 5 48304174 missense probably damaging 1.00
R6219:Slit2 UTSW 5 48302428 missense possibly damaging 0.53
R6344:Slit2 UTSW 5 48219681 missense probably benign 0.07
R6408:Slit2 UTSW 5 47984986 unclassified probably benign
R6479:Slit2 UTSW 5 48231989 missense probably damaging 1.00
R6526:Slit2 UTSW 5 48304167 missense probably damaging 0.99
R6959:Slit2 UTSW 5 48238385 missense possibly damaging 0.83
R7139:Slit2 UTSW 5 48244683 missense probably benign 0.19
R7201:Slit2 UTSW 5 48237285 missense probably null 0.85
R7472:Slit2 UTSW 5 48256838 missense probably damaging 0.97
R7491:Slit2 UTSW 5 48219994 missense probably benign 0.18
R7566:Slit2 UTSW 5 48249897 missense probably damaging 0.99
R7622:Slit2 UTSW 5 47985205 missense probably damaging 0.98
R7831:Slit2 UTSW 5 48244683 missense probably benign 0.19
R7870:Slit2 UTSW 5 48302307 missense probably damaging 0.99
R7899:Slit2 UTSW 5 48247185 missense possibly damaging 0.89
R7969:Slit2 UTSW 5 48304036 missense possibly damaging 0.47
R7984:Slit2 UTSW 5 48176123 intron probably benign
R8021:Slit2 UTSW 5 48302492 nonsense probably null
R8253:Slit2 UTSW 5 48275671 missense probably benign 0.00
R8321:Slit2 UTSW 5 48230267 missense probably damaging 1.00
R8426:Slit2 UTSW 5 48224763 missense probably benign 0.00
R8513:Slit2 UTSW 5 48224708 nonsense probably null
Z1088:Slit2 UTSW 5 48302353 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
Posted On2014-08-25