Incidental Mutation 'R1982:Guf1'
Institutional Source Beutler Lab
Gene Symbol Guf1
Ensembl Gene ENSMUSG00000029208
Gene NameGUF1 homolog, GTPase
MMRRC Submission 039994-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.756) question?
Stock #R1982 (G1)
Quality Score225
Status Not validated
Chromosomal Location69556923-69575973 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 69567226 bp
Amino Acid Change Tyrosine to Stop codon at position 447 (Y447*)
Ref Sequence ENSEMBL: ENSMUSP00000133467 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031113] [ENSMUST00000087228] [ENSMUST00000132169] [ENSMUST00000144363] [ENSMUST00000154728] [ENSMUST00000173205]
Predicted Effect probably null
Transcript: ENSMUST00000031113
AA Change: Y420*
SMART Domains Protein: ENSMUSP00000031113
Gene: ENSMUSG00000029208
AA Change: Y420*

low complexity region 7 29 N/A INTRINSIC
Pfam:GTP_EFTU 48 227 2.9e-53 PFAM
Pfam:MMR_HSR1 52 177 1.1e-7 PFAM
Pfam:Ras 83 227 2.4e-7 PFAM
low complexity region 336 349 N/A INTRINSIC
EFG_C 364 450 9.13e-1 SMART
Pfam:LepA_C 452 559 3.1e-48 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000087228
AA Change: Y508*
SMART Domains Protein: ENSMUSP00000084480
Gene: ENSMUSG00000029208
AA Change: Y508*

low complexity region 7 29 N/A INTRINSIC
Pfam:GTP_EFTU 48 227 3.1e-54 PFAM
Pfam:MMR_HSR1 52 177 4.1e-6 PFAM
Pfam:Ras 83 226 2.9e-7 PFAM
Pfam:GTP_EFTU_D2 250 320 7e-10 PFAM
low complexity region 424 437 N/A INTRINSIC
EFG_C 452 538 9.13e-1 SMART
Pfam:LepA_C 540 646 1.3e-48 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125543
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125660
Predicted Effect probably benign
Transcript: ENSMUST00000132169
SMART Domains Protein: ENSMUSP00000144290
Gene: ENSMUSG00000029208

low complexity region 7 29 N/A INTRINSIC
Pfam:GTP_EFTU 48 227 6.2e-54 PFAM
Pfam:MMR_HSR1 52 177 6.2e-6 PFAM
Pfam:Ras 83 226 1.2e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144363
SMART Domains Protein: ENSMUSP00000114707
Gene: ENSMUSG00000029208

low complexity region 1 23 N/A INTRINSIC
Pfam:GTP_EFTU 42 221 5.8e-54 PFAM
Pfam:MMR_HSR1 46 171 5.9e-6 PFAM
Pfam:Ras 77 220 1.1e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154728
SMART Domains Protein: ENSMUSP00000144246
Gene: ENSMUSG00000029208

low complexity region 7 29 N/A INTRINSIC
Pfam:GTP_EFTU 48 227 6.2e-54 PFAM
Pfam:MMR_HSR1 52 177 6.2e-6 PFAM
Pfam:Ras 83 226 1.2e-6 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000173205
AA Change: Y447*
SMART Domains Protein: ENSMUSP00000133467
Gene: ENSMUSG00000029208
AA Change: Y447*

Pfam:GTP_EFTU 11 190 1.1e-53 PFAM
Pfam:MMR_HSR1 15 140 2.6e-8 PFAM
Pfam:Ras 46 190 1.6e-7 PFAM
Pfam:GTP_EFTU_D2 213 283 3.1e-9 PFAM
Pfam:EFG_C 369 454 1e-16 PFAM
Pfam:LepA_C 455 562 4.5e-50 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202180
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a GTPase that triggers back-translocation of the elongating ribosome during mitochondrial protein synthesis. The protein contains a highly conserved C-terminal domain not found in other GTPases that facilitates tRNA binding. The encoded protein is thought to prevent misincorporation of amino acids in stressful, suboptimal conditions. An allelic variant in this gene has been associated with early infantile epileptic encephalopathy-40. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930415L06Rik A T X: 89,931,445 V382E probably damaging Het
Aatk G T 11: 120,013,514 P252Q probably damaging Het
Adamts4 T C 1: 171,258,934 V765A probably benign Het
Agfg2 A T 5: 137,664,253 V184E possibly damaging Het
Alas1 A T 9: 106,238,185 I48N probably damaging Het
Anks1 T C 17: 27,985,121 V181A probably damaging Het
Anxa8 A T 14: 34,096,570 R261S probably damaging Het
Aqp4 T C 18: 15,393,551 D291G probably damaging Het
Atrn A G 2: 130,970,222 R696G probably benign Het
Barx2 A C 9: 31,913,012 I27S probably damaging Het
Btnl1 A T 17: 34,379,751 I114L possibly damaging Het
Casq1 C T 1: 172,215,530 A200T probably damaging Het
Ccdc33 T A 9: 58,117,168 E225D probably benign Het
Cd84 C A 1: 171,884,585 probably null Het
Ceacam9 T G 7: 16,725,307 L177R probably benign Het
Cenpi T A X: 134,318,033 F161L possibly damaging Het
Cep63 T C 9: 102,602,880 K251E probably damaging Het
Cetn3 A G 13: 81,784,697 E25G probably damaging Het
Crybg3 T C 16: 59,544,125 D2378G possibly damaging Het
Ddx19b T C 8: 111,009,343 T357A possibly damaging Het
Dpep2 A C 8: 105,989,455 Y266* probably null Het
Dqx1 G A 6: 83,058,577 D24N probably damaging Het
Dsg4 A T 18: 20,471,212 Y912F probably damaging Het
Fam71f2 A G 6: 29,285,922 T69A probably benign Het
Fezf2 G T 14: 12,344,405 P261T probably benign Het
Fmo1 T C 1: 162,839,756 I163M possibly damaging Het
Gatad2a G A 8: 69,913,132 R428* probably null Het
Gfpt1 T A 6: 87,054,630 F85I possibly damaging Het
Gimap7 A T 6: 48,724,241 I254F possibly damaging Het
Glcci1 T C 6: 8,592,980 S261P probably damaging Het
Glis3 A T 19: 28,531,274 F437I probably damaging Het
Glp1r C A 17: 30,925,627 S258* probably null Het
Gm13023 C A 4: 143,795,150 H445Q probably benign Het
Gm7030 T A 17: 36,128,722 D122V probably damaging Het
Gpt2 C T 8: 85,516,203 A288V possibly damaging Het
Grin2c G T 11: 115,260,905 S76R possibly damaging Het
Hectd1 A C 12: 51,785,841 L916V probably damaging Het
Hnf4g A G 3: 3,638,208 K96E probably damaging Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Ifi207 T G 1: 173,735,239 M114L probably benign Het
Ifi35 A T 11: 101,458,286 E252V probably damaging Het
Igsf9b G A 9: 27,322,239 R345H possibly damaging Het
Itih3 T C 14: 30,923,583 probably benign Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Kidins220 A T 12: 25,051,194 M1252L probably benign Het
Kifap3 T A 1: 163,862,022 L525* probably null Het
Limk2 A T 11: 3,355,461 D35E probably benign Het
Lrrc37a G A 11: 103,498,966 P1878S probably benign Het
Mansc4 T A 6: 147,075,675 I148F probably benign Het
Mei1 A G 15: 82,103,312 N859S probably benign Het
Mib1 A G 18: 10,812,064 D987G probably damaging Het
Mroh8 A G 2: 157,271,975 V132A possibly damaging Het
Npnt T C 3: 132,948,132 I29M probably benign Het
Nrap T C 19: 56,384,105 D138G probably damaging Het
Olfr1 A T 11: 73,395,092 I310N probably benign Het
Olfr5 T C 7: 6,480,932 M75V probably benign Het
Olfr512 A G 7: 108,713,695 Y102C probably damaging Het
Olfr91 T A 17: 37,093,808 E22V probably damaging Het
Osbpl5 A C 7: 143,741,671 probably null Het
Pcna-ps2 T C 19: 9,283,683 V102A possibly damaging Het
Pik3c2g T C 6: 139,622,548 S221P probably damaging Het
Plppr3 A G 10: 79,866,425 I271T probably damaging Het
Prkar1b C T 5: 139,127,643 A41T probably benign Het
Prkcsh A G 9: 22,012,868 D458G probably damaging Het
Prr14 G T 7: 127,475,490 R398L possibly damaging Het
Ptafr A G 4: 132,579,985 R229G probably damaging Het
Rbp3 T C 14: 33,954,545 F150S probably damaging Het
Rel C T 11: 23,742,761 G424D probably benign Het
Rlf T C 4: 121,150,112 Y557C probably damaging Het
Samt3 A C X: 86,047,134 M211L probably benign Het
Selenop A T 15: 3,275,694 I111F probably damaging Het
Slc2a2 G A 3: 28,717,441 M173I probably benign Het
Slc43a1 G T 2: 84,856,889 G361V possibly damaging Het
Slit2 G A 5: 48,249,836 V870M probably damaging Het
Ssxb10 A G X: 8,331,019 D77G probably benign Het
Stk32b T A 5: 37,649,114 I29F probably damaging Het
Stra6l T A 4: 45,867,237 C161* probably null Het
Tecpr2 T A 12: 110,954,785 M1264K probably benign Het
Tfap2c A T 2: 172,557,236 I468F probably damaging Het
Ticam1 C T 17: 56,271,555 R180H probably damaging Het
Tlr4 T A 4: 66,841,035 N688K probably benign Het
Tmem35b A T 4: 127,126,053 probably benign Het
Ugt2b34 T C 5: 86,906,313 E203G probably damaging Het
Vegfa A C 17: 46,018,860 *393G probably null Het
Vmn2r16 T C 5: 109,364,024 V699A probably benign Het
Zfp324 T C 7: 12,971,218 S445P probably damaging Het
Zfp982 T A 4: 147,512,592 C135* probably null Het
Zfp990 A C 4: 145,536,869 N146H probably damaging Het
Zfyve26 A G 12: 79,255,243 Y431H possibly damaging Het
Other mutations in Guf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01580:Guf1 APN 5 69565421 splice site probably benign
IGL01739:Guf1 APN 5 69561158 missense probably damaging 1.00
IGL03110:Guf1 APN 5 69558477 missense probably damaging 1.00
R0054:Guf1 UTSW 5 69559561 synonymous silent
R0219:Guf1 UTSW 5 69559586 missense probably damaging 1.00
R0269:Guf1 UTSW 5 69559599 missense probably damaging 0.99
R0624:Guf1 UTSW 5 69558580 missense probably damaging 1.00
R0690:Guf1 UTSW 5 69566352 splice site probably null
R0906:Guf1 UTSW 5 69566386 missense probably damaging 0.99
R1082:Guf1 UTSW 5 69567212 missense possibly damaging 0.95
R1386:Guf1 UTSW 5 69563162 missense probably benign
R1506:Guf1 UTSW 5 69567166 missense possibly damaging 0.85
R1859:Guf1 UTSW 5 69568460 nonsense probably null
R3782:Guf1 UTSW 5 69567152 missense probably benign 0.01
R3847:Guf1 UTSW 5 69561157 missense probably damaging 0.99
R4172:Guf1 UTSW 5 69558229 missense possibly damaging 0.88
R4513:Guf1 UTSW 5 69561662 missense probably benign 0.00
R4592:Guf1 UTSW 5 69566443 missense possibly damaging 0.55
R4811:Guf1 UTSW 5 69564509 splice site probably null
R5435:Guf1 UTSW 5 69563169 missense probably benign 0.01
R5792:Guf1 UTSW 5 69560486 missense probably damaging 1.00
R6181:Guf1 UTSW 5 69561716 missense probably damaging 1.00
R6246:Guf1 UTSW 5 69558555 missense probably damaging 1.00
R6411:Guf1 UTSW 5 69560511 missense possibly damaging 0.87
R6701:Guf1 UTSW 5 69558253 missense probably damaging 1.00
R6724:Guf1 UTSW 5 69566393 missense probably damaging 0.99
R7634:Guf1 UTSW 5 69564544 missense probably damaging 0.97
R7923:Guf1 UTSW 5 69561159 missense probably benign 0.01
R8202:Guf1 UTSW 5 69563202 missense possibly damaging 0.95
R8387:Guf1 UTSW 5 69566467 missense probably damaging 1.00
X0018:Guf1 UTSW 5 69566366 nonsense probably null
Predicted Primers PCR Primer

Sequencing Primer
Posted On2014-08-25