Incidental Mutation 'R1982:Ugt2b34'
ID219911
Institutional Source Beutler Lab
Gene Symbol Ugt2b34
Ensembl Gene ENSMUSG00000029260
Gene NameUDP glucuronosyltransferase 2 family, polypeptide B34
Synonyms
MMRRC Submission 039994-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.158) question?
Stock #R1982 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location86889767-86906937 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 86906313 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 203 (E203G)
Ref Sequence ENSEMBL: ENSMUSP00000031181 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031181] [ENSMUST00000113333]
Predicted Effect probably damaging
Transcript: ENSMUST00000031181
AA Change: E203G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000031181
Gene: ENSMUSG00000029260
AA Change: E203G

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:UDPGT 26 529 2.4e-253 PFAM
Pfam:Glyco_tran_28_C 331 456 3.2e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113333
AA Change: E203G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000108959
Gene: ENSMUSG00000029260
AA Change: E203G

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:UDPGT 26 440 5.7e-190 PFAM
Pfam:Glyco_tran_28_C 344 440 1.1e-8 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930415L06Rik A T X: 89,931,445 V382E probably damaging Het
Aatk G T 11: 120,013,514 P252Q probably damaging Het
Adamts4 T C 1: 171,258,934 V765A probably benign Het
Agfg2 A T 5: 137,664,253 V184E possibly damaging Het
Alas1 A T 9: 106,238,185 I48N probably damaging Het
Anks1 T C 17: 27,985,121 V181A probably damaging Het
Anxa8 A T 14: 34,096,570 R261S probably damaging Het
Aqp4 T C 18: 15,393,551 D291G probably damaging Het
Atrn A G 2: 130,970,222 R696G probably benign Het
Barx2 A C 9: 31,913,012 I27S probably damaging Het
Btnl1 A T 17: 34,379,751 I114L possibly damaging Het
Casq1 C T 1: 172,215,530 A200T probably damaging Het
Ccdc33 T A 9: 58,117,168 E225D probably benign Het
Cd84 C A 1: 171,884,585 probably null Het
Ceacam9 T G 7: 16,725,307 L177R probably benign Het
Cenpi T A X: 134,318,033 F161L possibly damaging Het
Cep63 T C 9: 102,602,880 K251E probably damaging Het
Cetn3 A G 13: 81,784,697 E25G probably damaging Het
Crybg3 T C 16: 59,544,125 D2378G possibly damaging Het
Ddx19b T C 8: 111,009,343 T357A possibly damaging Het
Dpep2 A C 8: 105,989,455 Y266* probably null Het
Dqx1 G A 6: 83,058,577 D24N probably damaging Het
Dsg4 A T 18: 20,471,212 Y912F probably damaging Het
Fam71f2 A G 6: 29,285,922 T69A probably benign Het
Fezf2 G T 14: 12,344,405 P261T probably benign Het
Fmo1 T C 1: 162,839,756 I163M possibly damaging Het
Gatad2a G A 8: 69,913,132 R428* probably null Het
Gfpt1 T A 6: 87,054,630 F85I possibly damaging Het
Gimap7 A T 6: 48,724,241 I254F possibly damaging Het
Glcci1 T C 6: 8,592,980 S261P probably damaging Het
Glis3 A T 19: 28,531,274 F437I probably damaging Het
Glp1r C A 17: 30,925,627 S258* probably null Het
Gm13023 C A 4: 143,795,150 H445Q probably benign Het
Gm7030 T A 17: 36,128,722 D122V probably damaging Het
Gpt2 C T 8: 85,516,203 A288V possibly damaging Het
Grin2c G T 11: 115,260,905 S76R possibly damaging Het
Guf1 T A 5: 69,567,226 Y447* probably null Het
Hectd1 A C 12: 51,785,841 L916V probably damaging Het
Hnf4g A G 3: 3,638,208 K96E probably damaging Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Ifi207 T G 1: 173,735,239 M114L probably benign Het
Ifi35 A T 11: 101,458,286 E252V probably damaging Het
Igsf9b G A 9: 27,322,239 R345H possibly damaging Het
Itih3 T C 14: 30,923,583 probably benign Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Kidins220 A T 12: 25,051,194 M1252L probably benign Het
Kifap3 T A 1: 163,862,022 L525* probably null Het
Limk2 A T 11: 3,355,461 D35E probably benign Het
Lrrc37a G A 11: 103,498,966 P1878S probably benign Het
Mansc4 T A 6: 147,075,675 I148F probably benign Het
Mei1 A G 15: 82,103,312 N859S probably benign Het
Mib1 A G 18: 10,812,064 D987G probably damaging Het
Mroh8 A G 2: 157,271,975 V132A possibly damaging Het
Npnt T C 3: 132,948,132 I29M probably benign Het
Nrap T C 19: 56,384,105 D138G probably damaging Het
Olfr1 A T 11: 73,395,092 I310N probably benign Het
Olfr5 T C 7: 6,480,932 M75V probably benign Het
Olfr512 A G 7: 108,713,695 Y102C probably damaging Het
Olfr91 T A 17: 37,093,808 E22V probably damaging Het
Osbpl5 A C 7: 143,741,671 probably null Het
Pcna-ps2 T C 19: 9,283,683 V102A possibly damaging Het
Pik3c2g T C 6: 139,622,548 S221P probably damaging Het
Plppr3 A G 10: 79,866,425 I271T probably damaging Het
Prkar1b C T 5: 139,127,643 A41T probably benign Het
Prkcsh A G 9: 22,012,868 D458G probably damaging Het
Prr14 G T 7: 127,475,490 R398L possibly damaging Het
Ptafr A G 4: 132,579,985 R229G probably damaging Het
Rbp3 T C 14: 33,954,545 F150S probably damaging Het
Rel C T 11: 23,742,761 G424D probably benign Het
Rlf T C 4: 121,150,112 Y557C probably damaging Het
Samt3 A C X: 86,047,134 M211L probably benign Het
Selenop A T 15: 3,275,694 I111F probably damaging Het
Slc2a2 G A 3: 28,717,441 M173I probably benign Het
Slc43a1 G T 2: 84,856,889 G361V possibly damaging Het
Slit2 G A 5: 48,249,836 V870M probably damaging Het
Ssxb10 A G X: 8,331,019 D77G probably benign Het
Stk32b T A 5: 37,649,114 I29F probably damaging Het
Stra6l T A 4: 45,867,237 C161* probably null Het
Tecpr2 T A 12: 110,954,785 M1264K probably benign Het
Tfap2c A T 2: 172,557,236 I468F probably damaging Het
Ticam1 C T 17: 56,271,555 R180H probably damaging Het
Tlr4 T A 4: 66,841,035 N688K probably benign Het
Tmem35b A T 4: 127,126,053 probably benign Het
Vegfa A C 17: 46,018,860 *393G probably null Het
Vmn2r16 T C 5: 109,364,024 V699A probably benign Het
Zfp324 T C 7: 12,971,218 S445P probably damaging Het
Zfp982 T A 4: 147,512,592 C135* probably null Het
Zfp990 A C 4: 145,536,869 N146H probably damaging Het
Zfyve26 A G 12: 79,255,243 Y431H possibly damaging Het
Other mutations in Ugt2b34
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00488:Ugt2b34 APN 5 86892959 missense probably damaging 1.00
IGL00498:Ugt2b34 APN 5 86901225 missense probably damaging 1.00
IGL00710:Ugt2b34 APN 5 86906589 missense probably damaging 1.00
IGL01089:Ugt2b34 APN 5 86906326 missense probably benign 0.02
IGL01090:Ugt2b34 APN 5 86893820 missense probably damaging 1.00
IGL01152:Ugt2b34 APN 5 86901203 missense probably damaging 0.99
IGL01343:Ugt2b34 APN 5 86904388 missense possibly damaging 0.93
IGL01410:Ugt2b34 APN 5 86892830 missense possibly damaging 0.77
IGL01419:Ugt2b34 APN 5 86891405 missense probably damaging 1.00
IGL01986:Ugt2b34 APN 5 86901252 missense probably benign 0.01
IGL02702:Ugt2b34 APN 5 86892891 missense probably benign 0.21
IGL02725:Ugt2b34 APN 5 86906425 missense probably benign
IGL02810:Ugt2b34 APN 5 86906524 missense probably benign 0.01
IGL03199:Ugt2b34 APN 5 86906880 missense unknown
IGL03335:Ugt2b34 APN 5 86906640 missense probably benign 0.29
IGL03355:Ugt2b34 APN 5 86906685 missense probably benign 0.01
R0624:Ugt2b34 UTSW 5 86893732 critical splice donor site probably null
R0707:Ugt2b34 UTSW 5 86892899 missense possibly damaging 0.60
R0825:Ugt2b34 UTSW 5 86906701 missense possibly damaging 0.64
R1029:Ugt2b34 UTSW 5 86904387 nonsense probably null
R1857:Ugt2b34 UTSW 5 86904382 missense possibly damaging 0.90
R2032:Ugt2b34 UTSW 5 86891272 missense probably damaging 1.00
R2133:Ugt2b34 UTSW 5 86906557 missense probably benign 0.39
R4439:Ugt2b34 UTSW 5 86892867 missense probably damaging 1.00
R4783:Ugt2b34 UTSW 5 86891473 missense probably damaging 1.00
R5046:Ugt2b34 UTSW 5 86904387 missense probably benign 0.00
R5304:Ugt2b34 UTSW 5 86892865 missense probably damaging 1.00
R5543:Ugt2b34 UTSW 5 86906701 missense probably damaging 0.99
R6235:Ugt2b34 UTSW 5 86906364 missense probably benign 0.09
R6841:Ugt2b34 UTSW 5 86892816 missense probably benign 0.01
R7459:Ugt2b34 UTSW 5 86901275 missense possibly damaging 0.56
R7624:Ugt2b34 UTSW 5 86891282 missense possibly damaging 0.95
V8831:Ugt2b34 UTSW 5 86906674 missense probably benign 0.39
Z1177:Ugt2b34 UTSW 5 86906719 missense not run
Predicted Primers PCR Primer
(F):5'- GAGACAAATCATTCCCCTGTCAG -3'
(R):5'- CAAGGTTTGATGTGATCCTGGC -3'

Sequencing Primer
(F):5'- GTCAGACCTGTTCTTAGACATTCAC -3'
(R):5'- TGATGTGATCCTGGCAGATCCC -3'
Posted On2014-08-25