Incidental Mutation 'R1982:Agfg2'
ID219917
Institutional Source Beutler Lab
Gene Symbol Agfg2
Ensembl Gene ENSMUSG00000029722
Gene NameArfGAP with FG repeats 2
SynonymsHrbl, A630095P14Rik
MMRRC Submission 039994-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1982 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location137650463-137684726 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 137664253 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 184 (V184E)
Ref Sequence ENSEMBL: ENSMUSP00000117351 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031736] [ENSMUST00000100544] [ENSMUST00000151839] [ENSMUST00000198657]
Predicted Effect possibly damaging
Transcript: ENSMUST00000031736
AA Change: V184E

PolyPhen 2 Score 0.638 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000031736
Gene: ENSMUSG00000029722
AA Change: V184E

DomainStartEndE-ValueType
ArfGap 27 153 7.19e-35 SMART
low complexity region 194 219 N/A INTRINSIC
low complexity region 235 249 N/A INTRINSIC
low complexity region 269 283 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000100544
AA Change: V184E

PolyPhen 2 Score 0.638 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000098112
Gene: ENSMUSG00000029722
AA Change: V184E

DomainStartEndE-ValueType
ArfGap 27 153 7.19e-35 SMART
low complexity region 194 219 N/A INTRINSIC
low complexity region 235 249 N/A INTRINSIC
low complexity region 269 283 N/A INTRINSIC
low complexity region 285 296 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138604
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147518
Predicted Effect possibly damaging
Transcript: ENSMUST00000151839
AA Change: V184E

PolyPhen 2 Score 0.873 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000117351
Gene: ENSMUSG00000029722
AA Change: V184E

DomainStartEndE-ValueType
ArfGap 27 153 7.19e-35 SMART
low complexity region 194 219 N/A INTRINSIC
low complexity region 235 249 N/A INTRINSIC
low complexity region 268 282 N/A INTRINSIC
low complexity region 284 295 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000198657
AA Change: C22S
SMART Domains Protein: ENSMUSP00000143273
Gene: ENSMUSG00000029722
AA Change: C22S

DomainStartEndE-ValueType
low complexity region 24 51 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a paralog of the HIV-1 Rev binding proteins that serve as cellular co-factors for HIV-1 Rev protein in shuttling viral pre-mRNAs from the nucleus to the cytoplasm. The encoded protein contains an ADP-ribosylation factor GTPase activating protein (Arf-GAP) zinc finger domain, several phenylalanine-glycine (FG) motifs and asparagine-proline-phenylalanine (NPF) motifs. Alternate splicing of this gene results in multiple transcript variants. [provided by RefSeq, Dec 2014]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930415L06Rik A T X: 89,931,445 V382E probably damaging Het
Aatk G T 11: 120,013,514 P252Q probably damaging Het
Adamts4 T C 1: 171,258,934 V765A probably benign Het
Alas1 A T 9: 106,238,185 I48N probably damaging Het
Anks1 T C 17: 27,985,121 V181A probably damaging Het
Anxa8 A T 14: 34,096,570 R261S probably damaging Het
Aqp4 T C 18: 15,393,551 D291G probably damaging Het
Atrn A G 2: 130,970,222 R696G probably benign Het
Barx2 A C 9: 31,913,012 I27S probably damaging Het
Btnl1 A T 17: 34,379,751 I114L possibly damaging Het
Casq1 C T 1: 172,215,530 A200T probably damaging Het
Ccdc33 T A 9: 58,117,168 E225D probably benign Het
Cd84 C A 1: 171,884,585 probably null Het
Ceacam9 T G 7: 16,725,307 L177R probably benign Het
Cenpi T A X: 134,318,033 F161L possibly damaging Het
Cep63 T C 9: 102,602,880 K251E probably damaging Het
Cetn3 A G 13: 81,784,697 E25G probably damaging Het
Crybg3 T C 16: 59,544,125 D2378G possibly damaging Het
Ddx19b T C 8: 111,009,343 T357A possibly damaging Het
Dpep2 A C 8: 105,989,455 Y266* probably null Het
Dqx1 G A 6: 83,058,577 D24N probably damaging Het
Dsg4 A T 18: 20,471,212 Y912F probably damaging Het
Fam71f2 A G 6: 29,285,922 T69A probably benign Het
Fezf2 G T 14: 12,344,405 P261T probably benign Het
Fmo1 T C 1: 162,839,756 I163M possibly damaging Het
Gatad2a G A 8: 69,913,132 R428* probably null Het
Gfpt1 T A 6: 87,054,630 F85I possibly damaging Het
Gimap7 A T 6: 48,724,241 I254F possibly damaging Het
Glcci1 T C 6: 8,592,980 S261P probably damaging Het
Glis3 A T 19: 28,531,274 F437I probably damaging Het
Glp1r C A 17: 30,925,627 S258* probably null Het
Gm13023 C A 4: 143,795,150 H445Q probably benign Het
Gm7030 T A 17: 36,128,722 D122V probably damaging Het
Gpt2 C T 8: 85,516,203 A288V possibly damaging Het
Grin2c G T 11: 115,260,905 S76R possibly damaging Het
Guf1 T A 5: 69,567,226 Y447* probably null Het
Hectd1 A C 12: 51,785,841 L916V probably damaging Het
Hnf4g A G 3: 3,638,208 K96E probably damaging Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Ifi207 T G 1: 173,735,239 M114L probably benign Het
Ifi35 A T 11: 101,458,286 E252V probably damaging Het
Igsf9b G A 9: 27,322,239 R345H possibly damaging Het
Itih3 T C 14: 30,923,583 probably benign Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Kidins220 A T 12: 25,051,194 M1252L probably benign Het
Kifap3 T A 1: 163,862,022 L525* probably null Het
Limk2 A T 11: 3,355,461 D35E probably benign Het
Lrrc37a G A 11: 103,498,966 P1878S probably benign Het
Mansc4 T A 6: 147,075,675 I148F probably benign Het
Mei1 A G 15: 82,103,312 N859S probably benign Het
Mib1 A G 18: 10,812,064 D987G probably damaging Het
Mroh8 A G 2: 157,271,975 V132A possibly damaging Het
Npnt T C 3: 132,948,132 I29M probably benign Het
Nrap T C 19: 56,384,105 D138G probably damaging Het
Olfr1 A T 11: 73,395,092 I310N probably benign Het
Olfr5 T C 7: 6,480,932 M75V probably benign Het
Olfr512 A G 7: 108,713,695 Y102C probably damaging Het
Olfr91 T A 17: 37,093,808 E22V probably damaging Het
Osbpl5 A C 7: 143,741,671 probably null Het
Pcna-ps2 T C 19: 9,283,683 V102A possibly damaging Het
Pik3c2g T C 6: 139,622,548 S221P probably damaging Het
Plppr3 A G 10: 79,866,425 I271T probably damaging Het
Prkar1b C T 5: 139,127,643 A41T probably benign Het
Prkcsh A G 9: 22,012,868 D458G probably damaging Het
Prr14 G T 7: 127,475,490 R398L possibly damaging Het
Ptafr A G 4: 132,579,985 R229G probably damaging Het
Rbp3 T C 14: 33,954,545 F150S probably damaging Het
Rel C T 11: 23,742,761 G424D probably benign Het
Rlf T C 4: 121,150,112 Y557C probably damaging Het
Samt3 A C X: 86,047,134 M211L probably benign Het
Selenop A T 15: 3,275,694 I111F probably damaging Het
Slc2a2 G A 3: 28,717,441 M173I probably benign Het
Slc43a1 G T 2: 84,856,889 G361V possibly damaging Het
Slit2 G A 5: 48,249,836 V870M probably damaging Het
Ssxb10 A G X: 8,331,019 D77G probably benign Het
Stk32b T A 5: 37,649,114 I29F probably damaging Het
Stra6l T A 4: 45,867,237 C161* probably null Het
Tecpr2 T A 12: 110,954,785 M1264K probably benign Het
Tfap2c A T 2: 172,557,236 I468F probably damaging Het
Ticam1 C T 17: 56,271,555 R180H probably damaging Het
Tlr4 T A 4: 66,841,035 N688K probably benign Het
Tmem35b A T 4: 127,126,053 probably benign Het
Ugt2b34 T C 5: 86,906,313 E203G probably damaging Het
Vegfa A C 17: 46,018,860 *393G probably null Het
Vmn2r16 T C 5: 109,364,024 V699A probably benign Het
Zfp324 T C 7: 12,971,218 S445P probably damaging Het
Zfp982 T A 4: 147,512,592 C135* probably null Het
Zfp990 A C 4: 145,536,869 N146H probably damaging Het
Zfyve26 A G 12: 79,255,243 Y431H possibly damaging Het
Other mutations in Agfg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0020:Agfg2 UTSW 5 137653802 missense probably benign 0.22
R0020:Agfg2 UTSW 5 137653802 missense probably benign 0.22
R0584:Agfg2 UTSW 5 137667730 missense probably damaging 1.00
R1692:Agfg2 UTSW 5 137664371 missense probably damaging 0.99
R2140:Agfg2 UTSW 5 137667116 missense probably damaging 1.00
R3816:Agfg2 UTSW 5 137653774 missense probably benign 0.03
R4527:Agfg2 UTSW 5 137684536 missense unknown
R4645:Agfg2 UTSW 5 137684592 utr 5 prime probably benign
R4965:Agfg2 UTSW 5 137667177 critical splice acceptor site probably null
R5022:Agfg2 UTSW 5 137660160 critical splice donor site probably null
R5426:Agfg2 UTSW 5 137667758 missense probably damaging 1.00
R6140:Agfg2 UTSW 5 137667085 missense probably damaging 1.00
R7474:Agfg2 UTSW 5 137653868 missense possibly damaging 0.96
R7752:Agfg2 UTSW 5 137667704 missense probably damaging 0.96
R7901:Agfg2 UTSW 5 137667704 missense probably damaging 0.96
R7984:Agfg2 UTSW 5 137667704 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TTTCTGCCAGGGTCTAGGTATC -3'
(R):5'- AAACATGGTCCAAGGTTCTCTC -3'

Sequencing Primer
(F):5'- CCAGGGTCTAGGTATCCAGATG -3'
(R):5'- ATGGTCCAAGGTTCTCTCTCTCTC -3'
Posted On2014-08-25