Incidental Mutation 'R1982:Dqx1'
ID 219927
Institutional Source Beutler Lab
Gene Symbol Dqx1
Ensembl Gene ENSMUSG00000009145
Gene Name DEAQ RNA-dependent ATPase
Synonyms
MMRRC Submission 039994-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock # R1982 (G1)
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 83057844-83067318 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 83058577 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Asparagine at position 24 (D24N)
Ref Sequence ENSEMBL: ENSMUSP00000144697 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077502] [ENSMUST00000089645] [ENSMUST00000092618] [ENSMUST00000113962] [ENSMUST00000113963] [ENSMUST00000122955] [ENSMUST00000134606] [ENSMUST00000204803]
AlphaFold Q924H9
Predicted Effect probably damaging
Transcript: ENSMUST00000077502
AA Change: D24N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000076708
Gene: ENSMUSG00000009145
AA Change: D24N

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
DEXDc 30 236 5.01e-4 SMART
low complexity region 268 280 N/A INTRINSIC
low complexity region 288 301 N/A INTRINSIC
HA2 441 530 4e-19 SMART
Pfam:OB_NTP_bind 555 674 2.2e-11 PFAM
low complexity region 695 708 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000089645
SMART Domains Protein: ENSMUSP00000087073
Gene: ENSMUSG00000068329

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
transmembrane domain 106 125 N/A INTRINSIC
low complexity region 128 143 N/A INTRINSIC
Pfam:Trypsin 170 341 1.1e-14 PFAM
Pfam:Trypsin_2 182 320 1.2e-34 PFAM
PDZ 371 445 2.86e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000092618
SMART Domains Protein: ENSMUSP00000090281
Gene: ENSMUSG00000068328

DomainStartEndE-ValueType
low complexity region 10 40 N/A INTRINSIC
transmembrane domain 52 74 N/A INTRINSIC
PlsC 119 222 1.04e-1 SMART
low complexity region 307 322 N/A INTRINSIC
CUE 325 366 1.3e-9 SMART
low complexity region 378 392 N/A INTRINSIC
low complexity region 421 439 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113962
SMART Domains Protein: ENSMUSP00000109595
Gene: ENSMUSG00000068329

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
transmembrane domain 106 125 N/A INTRINSIC
low complexity region 128 143 N/A INTRINSIC
Pfam:Trypsin_2 182 237 2.7e-12 PFAM
Pfam:Trypsin 212 277 4.5e-6 PFAM
PDZ 285 348 4.89e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113963
SMART Domains Protein: ENSMUSP00000109596
Gene: ENSMUSG00000068329

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
transmembrane domain 106 125 N/A INTRINSIC
low complexity region 128 143 N/A INTRINSIC
Pfam:Trypsin 170 342 6.8e-15 PFAM
Pfam:Trypsin_2 182 320 7.1e-24 PFAM
PDZ 350 413 4.89e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000122955
SMART Domains Protein: ENSMUSP00000138153
Gene: ENSMUSG00000068329

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
transmembrane domain 106 125 N/A INTRINSIC
low complexity region 128 143 N/A INTRINSIC
Pfam:Trypsin 170 321 2.1e-10 PFAM
Pfam:Trypsin_2 182 317 9.5e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000132099
Predicted Effect probably benign
Transcript: ENSMUST00000134606
SMART Domains Protein: ENSMUSP00000115547
Gene: ENSMUSG00000068329

DomainStartEndE-ValueType
Pfam:Trypsin 7 180 2.7e-15 PFAM
Pfam:Trypsin_2 20 158 3.1e-24 PFAM
PDZ 209 283 2.86e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144058
Predicted Effect probably benign
Transcript: ENSMUST00000150217
SMART Domains Protein: ENSMUSP00000118234
Gene: ENSMUSG00000068329

DomainStartEndE-ValueType
low complexity region 4 11 N/A INTRINSIC
Pfam:Trypsin 41 215 1.6e-11 PFAM
Pfam:Trypsin_2 53 190 1.8e-31 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154829
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203123
Predicted Effect probably damaging
Transcript: ENSMUST00000204803
AA Change: D24N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144697
Gene: ENSMUSG00000009145
AA Change: D24N

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
DEXDc 30 236 2.1e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000204719
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204761
Predicted Effect probably benign
Transcript: ENSMUST00000203915
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204510
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203180
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203331
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205152
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204752
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204209
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204385
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203339
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204281
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204895
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203749
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205042
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204383
Predicted Effect probably benign
Transcript: ENSMUST00000204343
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930415L06Rik A T X: 89,931,445 V382E probably damaging Het
Aatk G T 11: 120,013,514 P252Q probably damaging Het
Adamts4 T C 1: 171,258,934 V765A probably benign Het
Agfg2 A T 5: 137,664,253 V184E possibly damaging Het
Alas1 A T 9: 106,238,185 I48N probably damaging Het
Anks1 T C 17: 27,985,121 V181A probably damaging Het
Anxa8 A T 14: 34,096,570 R261S probably damaging Het
Aqp4 T C 18: 15,393,551 D291G probably damaging Het
Atrn A G 2: 130,970,222 R696G probably benign Het
Barx2 A C 9: 31,913,012 I27S probably damaging Het
Btnl1 A T 17: 34,379,751 I114L possibly damaging Het
Casq1 C T 1: 172,215,530 A200T probably damaging Het
Ccdc33 T A 9: 58,117,168 E225D probably benign Het
Cd84 C A 1: 171,884,585 probably null Het
Ceacam9 T G 7: 16,725,307 L177R probably benign Het
Cenpi T A X: 134,318,033 F161L possibly damaging Het
Cep63 T C 9: 102,602,880 K251E probably damaging Het
Cetn3 A G 13: 81,784,697 E25G probably damaging Het
Crybg3 T C 16: 59,544,125 D2378G possibly damaging Het
Ddx19b T C 8: 111,009,343 T357A possibly damaging Het
Dpep2 A C 8: 105,989,455 Y266* probably null Het
Dsg4 A T 18: 20,471,212 Y912F probably damaging Het
Fam71f2 A G 6: 29,285,922 T69A probably benign Het
Fezf2 G T 14: 12,344,405 P261T probably benign Het
Fmo1 T C 1: 162,839,756 I163M possibly damaging Het
Gatad2a G A 8: 69,913,132 R428* probably null Het
Gfpt1 T A 6: 87,054,630 F85I possibly damaging Het
Gimap7 A T 6: 48,724,241 I254F possibly damaging Het
Glcci1 T C 6: 8,592,980 S261P probably damaging Het
Glis3 A T 19: 28,531,274 F437I probably damaging Het
Glp1r C A 17: 30,925,627 S258* probably null Het
Gm13023 C A 4: 143,795,150 H445Q probably benign Het
Gm7030 T A 17: 36,128,722 D122V probably damaging Het
Gpt2 C T 8: 85,516,203 A288V possibly damaging Het
Grin2c G T 11: 115,260,905 S76R possibly damaging Het
Guf1 T A 5: 69,567,226 Y447* probably null Het
Hectd1 A C 12: 51,785,841 L916V probably damaging Het
Hnf4g A G 3: 3,638,208 K96E probably damaging Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Ifi207 T G 1: 173,735,239 M114L probably benign Het
Ifi35 A T 11: 101,458,286 E252V probably damaging Het
Igsf9b G A 9: 27,322,239 R345H possibly damaging Het
Itih3 T C 14: 30,923,583 probably benign Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 74 probably benign Het
Kidins220 A T 12: 25,051,194 M1252L probably benign Het
Kifap3 T A 1: 163,862,022 L525* probably null Het
Limk2 A T 11: 3,355,461 D35E probably benign Het
Lrrc37a G A 11: 103,498,966 P1878S probably benign Het
Mansc4 T A 6: 147,075,675 I148F probably benign Het
Mei1 A G 15: 82,103,312 N859S probably benign Het
Mib1 A G 18: 10,812,064 D987G probably damaging Het
Mroh8 A G 2: 157,271,975 V132A possibly damaging Het
Npnt T C 3: 132,948,132 I29M probably benign Het
Nrap T C 19: 56,384,105 D138G probably damaging Het
Olfr1 A T 11: 73,395,092 I310N probably benign Het
Olfr5 T C 7: 6,480,932 M75V probably benign Het
Olfr512 A G 7: 108,713,695 Y102C probably damaging Het
Olfr91 T A 17: 37,093,808 E22V probably damaging Het
Osbpl5 A C 7: 143,741,671 probably null Het
Pcna-ps2 T C 19: 9,283,683 V102A possibly damaging Het
Pik3c2g T C 6: 139,622,548 S221P probably damaging Het
Plppr3 A G 10: 79,866,425 I271T probably damaging Het
Prkar1b C T 5: 139,127,643 A41T probably benign Het
Prkcsh A G 9: 22,012,868 D458G probably damaging Het
Prr14 G T 7: 127,475,490 R398L possibly damaging Het
Ptafr A G 4: 132,579,985 R229G probably damaging Het
Rbp3 T C 14: 33,954,545 F150S probably damaging Het
Rel C T 11: 23,742,761 G424D probably benign Het
Rlf T C 4: 121,150,112 Y557C probably damaging Het
Samt3 A C X: 86,047,134 M211L probably benign Het
Selenop A T 15: 3,275,694 I111F probably damaging Het
Slc2a2 G A 3: 28,717,441 M173I probably benign Het
Slc43a1 G T 2: 84,856,889 G361V possibly damaging Het
Slit2 G A 5: 48,249,836 V870M probably damaging Het
Ssxb10 A G X: 8,331,019 D77G probably benign Het
Stk32b T A 5: 37,649,114 I29F probably damaging Het
Stra6l T A 4: 45,867,237 C161* probably null Het
Tecpr2 T A 12: 110,954,785 M1264K probably benign Het
Tfap2c A T 2: 172,557,236 I468F probably damaging Het
Ticam1 C T 17: 56,271,555 R180H probably damaging Het
Tlr4 T A 4: 66,841,035 N688K probably benign Het
Tmem35b A T 4: 127,126,053 probably benign Het
Ugt2b34 T C 5: 86,906,313 E203G probably damaging Het
Vegfa A C 17: 46,018,860 *393G probably null Het
Vmn2r16 T C 5: 109,364,024 V699A probably benign Het
Zfp324 T C 7: 12,971,218 S445P probably damaging Het
Zfp982 T A 4: 147,512,592 C135* probably null Het
Zfp990 A C 4: 145,536,869 N146H probably damaging Het
Zfyve26 A G 12: 79,255,243 Y431H possibly damaging Het
Other mutations in Dqx1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01796:Dqx1 APN 6 83066427 unclassified probably benign
IGL02158:Dqx1 APN 6 83058910 splice site probably benign
IGL02288:Dqx1 APN 6 83060328 missense probably damaging 0.98
IGL02801:Dqx1 APN 6 83060495 splice site probably null
IGL02929:Dqx1 APN 6 83060484 unclassified probably benign
R0396:Dqx1 UTSW 6 83059005 missense probably benign 0.00
R0448:Dqx1 UTSW 6 83060345 missense probably damaging 1.00
R0471:Dqx1 UTSW 6 83059426 splice site probably benign
R1022:Dqx1 UTSW 6 83061089 missense probably damaging 1.00
R1023:Dqx1 UTSW 6 83061089 missense probably damaging 1.00
R1024:Dqx1 UTSW 6 83061089 missense probably damaging 1.00
R1480:Dqx1 UTSW 6 83059452 missense possibly damaging 0.61
R1804:Dqx1 UTSW 6 83060322 missense probably damaging 1.00
R1848:Dqx1 UTSW 6 83066107 missense probably damaging 1.00
R2064:Dqx1 UTSW 6 83058543 unclassified probably benign
R2350:Dqx1 UTSW 6 83059087 nonsense probably null
R3110:Dqx1 UTSW 6 83058972 missense probably damaging 0.99
R3112:Dqx1 UTSW 6 83058972 missense probably damaging 0.99
R3119:Dqx1 UTSW 6 83066235 nonsense probably null
R4179:Dqx1 UTSW 6 83059479 missense probably benign 0.03
R4180:Dqx1 UTSW 6 83059479 missense probably benign 0.03
R4873:Dqx1 UTSW 6 83061012 missense probably benign 0.25
R4875:Dqx1 UTSW 6 83061012 missense probably benign 0.25
R4882:Dqx1 UTSW 6 83066088 critical splice acceptor site probably null
R5015:Dqx1 UTSW 6 83066111 missense probably benign 0.00
R5128:Dqx1 UTSW 6 83060567 missense probably damaging 0.96
R5346:Dqx1 UTSW 6 83059719 missense possibly damaging 0.87
R5480:Dqx1 UTSW 6 83064803 missense probably damaging 0.98
R6939:Dqx1 UTSW 6 83059465 missense probably damaging 0.99
R6979:Dqx1 UTSW 6 83061011 missense probably damaging 1.00
R7059:Dqx1 UTSW 6 83064809 missense probably benign 0.18
R7084:Dqx1 UTSW 6 83066455 missense probably damaging 1.00
R7354:Dqx1 UTSW 6 83060976 nonsense probably null
R7389:Dqx1 UTSW 6 83064794 missense probably null 0.99
R7497:Dqx1 UTSW 6 83059047 missense probably damaging 1.00
R7632:Dqx1 UTSW 6 83059699 missense probably benign
R7762:Dqx1 UTSW 6 83061032 missense probably damaging 1.00
R8002:Dqx1 UTSW 6 83058577 missense probably damaging 1.00
R8036:Dqx1 UTSW 6 83059807 missense probably damaging 1.00
R8147:Dqx1 UTSW 6 83060241 missense probably benign 0.41
R8776:Dqx1 UTSW 6 83058638 missense probably damaging 0.99
R8776-TAIL:Dqx1 UTSW 6 83058638 missense probably damaging 0.99
R9090:Dqx1 UTSW 6 83059043 missense probably benign 0.13
R9139:Dqx1 UTSW 6 83059778 missense possibly damaging 0.76
R9271:Dqx1 UTSW 6 83059043 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- TCTTAGAGACACCCAGCACG -3'
(R):5'- CAGAATCTTCCTCCACCTGG -3'

Sequencing Primer
(F):5'- TTAGAGACACCCAGCACGGTTTC -3'
(R):5'- ACCTGGGTGCTCTTGCCAG -3'
Posted On 2014-08-25