Incidental Mutation 'R1982:Gfpt1'
ID 219929
Institutional Source Beutler Lab
Gene Symbol Gfpt1
Ensembl Gene ENSMUSG00000029992
Gene Name glutamine fructose-6-phosphate transaminase 1
Synonyms GFA, 2810423A18Rik, GFAT, GFAT1
MMRRC Submission 039994-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R1982 (G1)
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 87042846-87092197 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 87054630 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 85 (F85I)
Ref Sequence ENSEMBL: ENSMUSP00000109288 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032057] [ENSMUST00000113655] [ENSMUST00000113657] [ENSMUST00000113658]
AlphaFold P47856
Predicted Effect possibly damaging
Transcript: ENSMUST00000032057
AA Change: F85I

PolyPhen 2 Score 0.901 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000032057
Gene: ENSMUSG00000029992
AA Change: F85I

low complexity region 56 67 N/A INTRINSIC
Pfam:GATase_6 69 213 1e-18 PFAM
Pfam:GATase_4 78 198 2.7e-7 PFAM
Pfam:GATase_7 93 195 2.1e-14 PFAM
Pfam:SIS 378 507 4.5e-38 PFAM
Pfam:SIS 549 680 1.6e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113655
SMART Domains Protein: ENSMUSP00000109285
Gene: ENSMUSG00000029992

Pfam:GATase_2 2 65 7.8e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113657
AA Change: F85I

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000109287
Gene: ENSMUSG00000029992
AA Change: F85I

Pfam:GATase_2 2 80 1.7e-10 PFAM
Pfam:GATase_2 76 120 9.5e-10 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000113658
AA Change: F85I

PolyPhen 2 Score 0.901 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000109288
Gene: ENSMUSG00000029992
AA Change: F85I

Pfam:GATase_2 2 78 9e-9 PFAM
Pfam:GATase_4 63 191 3.2e-10 PFAM
Pfam:GATase_6 68 211 3.7e-20 PFAM
Pfam:GATase_2 76 220 6.4e-22 PFAM
Pfam:GATase_7 93 194 1.7e-15 PFAM
Pfam:SIS 362 491 4.5e-36 PFAM
Pfam:SIS 533 664 2.3e-31 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150410
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the first and rate-limiting enzyme of the hexosamine pathway and controls the flux of glucose into the hexosamine pathway. The product of this gene catalyzes the formation of glucosamine 6-phosphate. [provided by RefSeq, Sep 2008]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930415L06Rik A T X: 89,931,445 V382E probably damaging Het
Aatk G T 11: 120,013,514 P252Q probably damaging Het
Adamts4 T C 1: 171,258,934 V765A probably benign Het
Agfg2 A T 5: 137,664,253 V184E possibly damaging Het
Alas1 A T 9: 106,238,185 I48N probably damaging Het
Anks1 T C 17: 27,985,121 V181A probably damaging Het
Anxa8 A T 14: 34,096,570 R261S probably damaging Het
Aqp4 T C 18: 15,393,551 D291G probably damaging Het
Atrn A G 2: 130,970,222 R696G probably benign Het
Barx2 A C 9: 31,913,012 I27S probably damaging Het
Btnl1 A T 17: 34,379,751 I114L possibly damaging Het
Casq1 C T 1: 172,215,530 A200T probably damaging Het
Ccdc33 T A 9: 58,117,168 E225D probably benign Het
Cd84 C A 1: 171,884,585 probably null Het
Ceacam9 T G 7: 16,725,307 L177R probably benign Het
Cenpi T A X: 134,318,033 F161L possibly damaging Het
Cep63 T C 9: 102,602,880 K251E probably damaging Het
Cetn3 A G 13: 81,784,697 E25G probably damaging Het
Crybg3 T C 16: 59,544,125 D2378G possibly damaging Het
Ddx19b T C 8: 111,009,343 T357A possibly damaging Het
Dpep2 A C 8: 105,989,455 Y266* probably null Het
Dqx1 G A 6: 83,058,577 D24N probably damaging Het
Dsg4 A T 18: 20,471,212 Y912F probably damaging Het
Fam71f2 A G 6: 29,285,922 T69A probably benign Het
Fezf2 G T 14: 12,344,405 P261T probably benign Het
Fmo1 T C 1: 162,839,756 I163M possibly damaging Het
Gatad2a G A 8: 69,913,132 R428* probably null Het
Gimap7 A T 6: 48,724,241 I254F possibly damaging Het
Glcci1 T C 6: 8,592,980 S261P probably damaging Het
Glis3 A T 19: 28,531,274 F437I probably damaging Het
Glp1r C A 17: 30,925,627 S258* probably null Het
Gm13023 C A 4: 143,795,150 H445Q probably benign Het
Gm7030 T A 17: 36,128,722 D122V probably damaging Het
Gpt2 C T 8: 85,516,203 A288V possibly damaging Het
Grin2c G T 11: 115,260,905 S76R possibly damaging Het
Guf1 T A 5: 69,567,226 Y447* probably null Het
Hectd1 A C 12: 51,785,841 L916V probably damaging Het
Hnf4g A G 3: 3,638,208 K96E probably damaging Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Ifi207 T G 1: 173,735,239 M114L probably benign Het
Ifi35 A T 11: 101,458,286 E252V probably damaging Het
Igsf9b G A 9: 27,322,239 R345H possibly damaging Het
Itih3 T C 14: 30,923,583 probably benign Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 74 probably benign Het
Kidins220 A T 12: 25,051,194 M1252L probably benign Het
Kifap3 T A 1: 163,862,022 L525* probably null Het
Limk2 A T 11: 3,355,461 D35E probably benign Het
Lrrc37a G A 11: 103,498,966 P1878S probably benign Het
Mansc4 T A 6: 147,075,675 I148F probably benign Het
Mei1 A G 15: 82,103,312 N859S probably benign Het
Mib1 A G 18: 10,812,064 D987G probably damaging Het
Mroh8 A G 2: 157,271,975 V132A possibly damaging Het
Npnt T C 3: 132,948,132 I29M probably benign Het
Nrap T C 19: 56,384,105 D138G probably damaging Het
Olfr1 A T 11: 73,395,092 I310N probably benign Het
Olfr5 T C 7: 6,480,932 M75V probably benign Het
Olfr512 A G 7: 108,713,695 Y102C probably damaging Het
Olfr91 T A 17: 37,093,808 E22V probably damaging Het
Osbpl5 A C 7: 143,741,671 probably null Het
Pcna-ps2 T C 19: 9,283,683 V102A possibly damaging Het
Pik3c2g T C 6: 139,622,548 S221P probably damaging Het
Plppr3 A G 10: 79,866,425 I271T probably damaging Het
Prkar1b C T 5: 139,127,643 A41T probably benign Het
Prkcsh A G 9: 22,012,868 D458G probably damaging Het
Prr14 G T 7: 127,475,490 R398L possibly damaging Het
Ptafr A G 4: 132,579,985 R229G probably damaging Het
Rbp3 T C 14: 33,954,545 F150S probably damaging Het
Rel C T 11: 23,742,761 G424D probably benign Het
Rlf T C 4: 121,150,112 Y557C probably damaging Het
Samt3 A C X: 86,047,134 M211L probably benign Het
Selenop A T 15: 3,275,694 I111F probably damaging Het
Slc2a2 G A 3: 28,717,441 M173I probably benign Het
Slc43a1 G T 2: 84,856,889 G361V possibly damaging Het
Slit2 G A 5: 48,249,836 V870M probably damaging Het
Ssxb10 A G X: 8,331,019 D77G probably benign Het
Stk32b T A 5: 37,649,114 I29F probably damaging Het
Stra6l T A 4: 45,867,237 C161* probably null Het
Tecpr2 T A 12: 110,954,785 M1264K probably benign Het
Tfap2c A T 2: 172,557,236 I468F probably damaging Het
Ticam1 C T 17: 56,271,555 R180H probably damaging Het
Tlr4 T A 4: 66,841,035 N688K probably benign Het
Tmem35b A T 4: 127,126,053 probably benign Het
Ugt2b34 T C 5: 86,906,313 E203G probably damaging Het
Vegfa A C 17: 46,018,860 *393G probably null Het
Vmn2r16 T C 5: 109,364,024 V699A probably benign Het
Zfp324 T C 7: 12,971,218 S445P probably damaging Het
Zfp982 T A 4: 147,512,592 C135* probably null Het
Zfp990 A C 4: 145,536,869 N146H probably damaging Het
Zfyve26 A G 12: 79,255,243 Y431H possibly damaging Het
Other mutations in Gfpt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00857:Gfpt1 APN 6 87056163 missense probably damaging 1.00
IGL00946:Gfpt1 APN 6 87050942 missense probably damaging 1.00
IGL01083:Gfpt1 APN 6 87054696 missense probably damaging 1.00
IGL01930:Gfpt1 APN 6 87059415 missense possibly damaging 0.88
IGL02113:Gfpt1 APN 6 87087367 missense probably benign 0.04
IGL02724:Gfpt1 APN 6 87056182 nonsense probably null
IGL03024:Gfpt1 APN 6 87053831 missense probably damaging 1.00
Fatal_flaw UTSW 6 87053865 splice site probably benign
vanity UTSW 6 87053805 missense probably benign 0.10
R0829:Gfpt1 UTSW 6 87053865 splice site probably benign
R1779:Gfpt1 UTSW 6 87077197 missense possibly damaging 0.74
R2067:Gfpt1 UTSW 6 87057754 missense probably benign 0.02
R2400:Gfpt1 UTSW 6 87087348 missense probably damaging 1.00
R2438:Gfpt1 UTSW 6 87057745 missense probably null 1.00
R3104:Gfpt1 UTSW 6 87057646 missense probably benign 0.16
R3105:Gfpt1 UTSW 6 87057646 missense probably benign 0.16
R4738:Gfpt1 UTSW 6 87054747 intron probably benign
R5070:Gfpt1 UTSW 6 87053745 splice site probably null
R5292:Gfpt1 UTSW 6 87076255 critical splice acceptor site probably null
R5392:Gfpt1 UTSW 6 87077157 missense probably damaging 0.99
R5481:Gfpt1 UTSW 6 87050969 missense probably damaging 1.00
R5646:Gfpt1 UTSW 6 87042999 start codon destroyed probably null 0.92
R5666:Gfpt1 UTSW 6 87053813 missense possibly damaging 0.94
R6003:Gfpt1 UTSW 6 87088248 splice site probably null
R6031:Gfpt1 UTSW 6 87086320 missense probably damaging 1.00
R6031:Gfpt1 UTSW 6 87086320 missense probably damaging 1.00
R6045:Gfpt1 UTSW 6 87085257 missense probably damaging 1.00
R6341:Gfpt1 UTSW 6 87088145 missense probably damaging 1.00
R6980:Gfpt1 UTSW 6 87077089 missense probably damaging 1.00
R7120:Gfpt1 UTSW 6 87087393 missense probably benign 0.25
R7123:Gfpt1 UTSW 6 87056186 missense probably damaging 1.00
R7249:Gfpt1 UTSW 6 87056144 missense probably damaging 0.98
R7374:Gfpt1 UTSW 6 87050977 missense probably benign 0.00
R7501:Gfpt1 UTSW 6 87082526 missense probably benign
R7502:Gfpt1 UTSW 6 87066689 missense probably benign 0.00
R8244:Gfpt1 UTSW 6 87063631 intron probably benign
R8528:Gfpt1 UTSW 6 87066788 critical splice donor site probably null
R8864:Gfpt1 UTSW 6 87054623 missense probably benign 0.01
R8910:Gfpt1 UTSW 6 87053805 missense probably benign 0.10
R9123:Gfpt1 UTSW 6 87076266 missense probably benign
R9125:Gfpt1 UTSW 6 87076266 missense probably benign
R9227:Gfpt1 UTSW 6 87050924 missense probably damaging 1.00
R9414:Gfpt1 UTSW 6 87085283 missense probably benign
Predicted Primers PCR Primer

Sequencing Primer
Posted On 2014-08-25