Incidental Mutation 'R1982:Pik3c2g'
ID 219931
Institutional Source Beutler Lab
Gene Symbol Pik3c2g
Ensembl Gene ENSMUSG00000030228
Gene Name phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 gamma
Synonyms
MMRRC Submission 039994-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.105) question?
Stock # R1982 (G1)
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 139591070-139915010 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 139599546 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 221 (S221P)
Ref Sequence ENSEMBL: ENSMUSP00000140368 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032353] [ENSMUST00000185968] [ENSMUST00000187618] [ENSMUST00000188066] [ENSMUST00000190962]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000032353
AA Change: S221P

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000032353
Gene: ENSMUSG00000030228
AA Change: S221P

DomainStartEndE-ValueType
SCOP:d1e8xa3 223 344 4e-33 SMART
Blast:PI3K_rbd 272 345 7e-44 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000185968
AA Change: S221P

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000140368
Gene: ENSMUSG00000030228
AA Change: S221P

DomainStartEndE-ValueType
SCOP:d1e8xa3 223 371 2e-42 SMART
Blast:PI3K_rbd 272 371 2e-64 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186585
Predicted Effect probably damaging
Transcript: ENSMUST00000187618
AA Change: S221P

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000141025
Gene: ENSMUSG00000030228
AA Change: S221P

DomainStartEndE-ValueType
SCOP:d1e8xa3 223 344 4e-33 SMART
Blast:PI3K_rbd 272 345 7e-44 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000188066
Predicted Effect probably damaging
Transcript: ENSMUST00000190962
AA Change: S221P

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000141141
Gene: ENSMUSG00000030228
AA Change: S221P

DomainStartEndE-ValueType
SCOP:d1e8xa3 223 344 4e-33 SMART
Blast:PI3K_rbd 272 345 7e-44 BLAST
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the phosphoinositide 3-kinase (PI3K) family. PI3-kinases play roles in signaling pathways involved in cell proliferation, oncogenic transformation, cell survival, cell migration, and intracellular protein trafficking. This protein contains a lipid kinase catalytic domain as well as a C-terminal C2 domain, a characteristic of class II PI3-kinases. C2 domains act as calcium-dependent phospholipid binding motifs that mediate translocation of proteins to membranes, and may also mediate protein-protein interactions. This gene may play a role in several diseases, including type II diabetes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for a knock-out allelel exhibit reduced liver glucogen accumulation, hyperlipidemia, adiposity and insulin resistance with age or after consumption of a high-fat diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk G T 11: 119,904,340 (GRCm39) P252Q probably damaging Het
Adamts4 T C 1: 171,086,503 (GRCm39) V765A probably benign Het
Agfg2 A T 5: 137,662,515 (GRCm39) V184E possibly damaging Het
Alas1 A T 9: 106,115,384 (GRCm39) I48N probably damaging Het
Anks1 T C 17: 28,204,095 (GRCm39) V181A probably damaging Het
Anxa8 A T 14: 33,818,527 (GRCm39) R261S probably damaging Het
Aqp4 T C 18: 15,526,608 (GRCm39) D291G probably damaging Het
Atrn A G 2: 130,812,142 (GRCm39) R696G probably benign Het
Barx2 A C 9: 31,824,308 (GRCm39) I27S probably damaging Het
Btnl1 A T 17: 34,598,725 (GRCm39) I114L possibly damaging Het
Casq1 C T 1: 172,043,097 (GRCm39) A200T probably damaging Het
Ccdc33 T A 9: 58,024,451 (GRCm39) E225D probably benign Het
Cd84 C A 1: 171,712,152 (GRCm39) probably null Het
Ceacam9 T G 7: 16,459,232 (GRCm39) L177R probably benign Het
Cenpi T A X: 133,218,782 (GRCm39) F161L possibly damaging Het
Cep63 T C 9: 102,480,079 (GRCm39) K251E probably damaging Het
Cetn3 A G 13: 81,932,816 (GRCm39) E25G probably damaging Het
Crybg3 T C 16: 59,364,488 (GRCm39) D2378G possibly damaging Het
Ddx19b T C 8: 111,735,975 (GRCm39) T357A possibly damaging Het
Dpep2 A C 8: 106,716,087 (GRCm39) Y266* probably null Het
Dqx1 G A 6: 83,035,558 (GRCm39) D24N probably damaging Het
Dsg4 A T 18: 20,604,269 (GRCm39) Y912F probably damaging Het
Fezf2 G T 14: 12,344,405 (GRCm38) P261T probably benign Het
Fmo1 T C 1: 162,667,325 (GRCm39) I163M possibly damaging Het
Garin1a A G 6: 29,285,921 (GRCm39) T69A probably benign Het
Gatad2a G A 8: 70,365,782 (GRCm39) R428* probably null Het
Gfpt1 T A 6: 87,031,612 (GRCm39) F85I possibly damaging Het
Gimap7 A T 6: 48,701,175 (GRCm39) I254F possibly damaging Het
Glcci1 T C 6: 8,592,980 (GRCm39) S261P probably damaging Het
Glis3 A T 19: 28,508,674 (GRCm39) F437I probably damaging Het
Glp1r C A 17: 31,144,601 (GRCm39) S258* probably null Het
Gpt2 C T 8: 86,242,832 (GRCm39) A288V possibly damaging Het
Grin2c G T 11: 115,151,731 (GRCm39) S76R possibly damaging Het
Guf1 T A 5: 69,724,569 (GRCm39) Y447* probably null Het
H2-T9 T A 17: 36,439,614 (GRCm39) D122V probably damaging Het
Hectd1 A C 12: 51,832,624 (GRCm39) L916V probably damaging Het
Hnf4g A G 3: 3,703,268 (GRCm39) K96E probably damaging Het
Hsh2d G A 8: 72,954,304 (GRCm39) D229N probably benign Het
Ifi207 T G 1: 173,562,805 (GRCm39) M114L probably benign Het
Ifi35 A T 11: 101,349,112 (GRCm39) E252V probably damaging Het
Igsf9b G A 9: 27,233,535 (GRCm39) R345H possibly damaging Het
Itih3 T C 14: 30,645,540 (GRCm39) probably benign Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 53,032,934 (GRCm39) 74 probably benign Het
Kidins220 A T 12: 25,101,193 (GRCm39) M1252L probably benign Het
Kifap3 T A 1: 163,689,591 (GRCm39) L525* probably null Het
Limk2 A T 11: 3,305,461 (GRCm39) D35E probably benign Het
Lrrc37a G A 11: 103,389,792 (GRCm39) P1878S probably benign Het
Mansc4 T A 6: 146,977,173 (GRCm39) I148F probably benign Het
Mei1 A G 15: 81,987,513 (GRCm39) N859S probably benign Het
Mib1 A G 18: 10,812,064 (GRCm39) D987G probably damaging Het
Mroh8 A G 2: 157,113,895 (GRCm39) V132A possibly damaging Het
Npnt T C 3: 132,653,893 (GRCm39) I29M probably benign Het
Nrap T C 19: 56,372,537 (GRCm39) D138G probably damaging Het
Or10a3m A G 7: 108,312,902 (GRCm39) Y102C probably damaging Het
Or1e16 A T 11: 73,285,918 (GRCm39) I310N probably benign Het
Or2h1 T A 17: 37,404,700 (GRCm39) E22V probably damaging Het
Or6z7 T C 7: 6,483,931 (GRCm39) M75V probably benign Het
Osbpl5 A C 7: 143,295,408 (GRCm39) probably null Het
Pcna-ps2 T C 19: 9,261,047 (GRCm39) V102A possibly damaging Het
Plppr3 A G 10: 79,702,259 (GRCm39) I271T probably damaging Het
Ppp4r3c1 A T X: 88,975,051 (GRCm39) V382E probably damaging Het
Pramel25 C A 4: 143,521,720 (GRCm39) H445Q probably benign Het
Prkar1b C T 5: 139,113,398 (GRCm39) A41T probably benign Het
Prkcsh A G 9: 21,924,164 (GRCm39) D458G probably damaging Het
Prr14 G T 7: 127,074,662 (GRCm39) R398L possibly damaging Het
Ptafr A G 4: 132,307,296 (GRCm39) R229G probably damaging Het
Rbp3 T C 14: 33,676,502 (GRCm39) F150S probably damaging Het
Rel C T 11: 23,692,761 (GRCm39) G424D probably benign Het
Rlf T C 4: 121,007,309 (GRCm39) Y557C probably damaging Het
Samt3 A C X: 85,090,740 (GRCm39) M211L probably benign Het
Selenop A T 15: 3,305,176 (GRCm39) I111F probably damaging Het
Slc2a2 G A 3: 28,771,590 (GRCm39) M173I probably benign Het
Slc43a1 G T 2: 84,687,233 (GRCm39) G361V possibly damaging Het
Slit2 G A 5: 48,407,178 (GRCm39) V870M probably damaging Het
Ssxb10 A G X: 8,197,258 (GRCm39) D77G probably benign Het
Stk32b T A 5: 37,806,458 (GRCm39) I29F probably damaging Het
Stra6l T A 4: 45,867,237 (GRCm39) C161* probably null Het
Tecpr2 T A 12: 110,921,219 (GRCm39) M1264K probably benign Het
Tfap2c A T 2: 172,399,156 (GRCm39) I468F probably damaging Het
Ticam1 C T 17: 56,578,555 (GRCm39) R180H probably damaging Het
Tlr4 T A 4: 66,759,272 (GRCm39) N688K probably benign Het
Tmem35b A T 4: 127,019,846 (GRCm39) probably benign Het
Ugt2b34 T C 5: 87,054,172 (GRCm39) E203G probably damaging Het
Vegfa A C 17: 46,329,786 (GRCm39) *393G probably null Het
Vmn2r16 T C 5: 109,511,890 (GRCm39) V699A probably benign Het
Zfp324 T C 7: 12,705,145 (GRCm39) S445P probably damaging Het
Zfp982 T A 4: 147,597,049 (GRCm39) C135* probably null Het
Zfp990 A C 4: 145,263,439 (GRCm39) N146H probably damaging Het
Zfyve26 A G 12: 79,302,017 (GRCm39) Y431H possibly damaging Het
Other mutations in Pik3c2g
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Pik3c2g APN 6 139,841,851 (GRCm39) missense probably damaging 1.00
IGL01355:Pik3c2g APN 6 139,798,583 (GRCm39) missense probably damaging 0.98
IGL01579:Pik3c2g APN 6 139,700,467 (GRCm39) nonsense probably null
IGL01580:Pik3c2g APN 6 139,599,514 (GRCm39) missense probably damaging 0.99
IGL01587:Pik3c2g APN 6 139,700,467 (GRCm39) nonsense probably null
IGL01813:Pik3c2g APN 6 139,599,407 (GRCm39) missense possibly damaging 0.55
IGL02218:Pik3c2g APN 6 139,806,081 (GRCm39) missense probably damaging 1.00
IGL02479:Pik3c2g APN 6 139,863,730 (GRCm39) missense probably benign 0.40
IGL02480:Pik3c2g APN 6 139,798,526 (GRCm39) missense probably damaging 1.00
IGL02721:Pik3c2g APN 6 139,682,699 (GRCm39) missense probably benign 0.15
IGL02967:Pik3c2g APN 6 139,913,554 (GRCm39) missense probably damaging 0.98
IGL03221:Pik3c2g APN 6 139,718,133 (GRCm39) critical splice acceptor site probably null
FR4304:Pik3c2g UTSW 6 139,612,654 (GRCm39) frame shift probably null
FR4340:Pik3c2g UTSW 6 139,612,654 (GRCm39) frame shift probably null
FR4976:Pik3c2g UTSW 6 139,612,652 (GRCm39) frame shift probably null
IGL02837:Pik3c2g UTSW 6 139,603,562 (GRCm39) nonsense probably null
PIT4531001:Pik3c2g UTSW 6 139,805,096 (GRCm39) missense
R0002:Pik3c2g UTSW 6 139,714,471 (GRCm39) missense probably benign 0.08
R0081:Pik3c2g UTSW 6 139,903,519 (GRCm39) missense probably benign 0.05
R0098:Pik3c2g UTSW 6 139,639,441 (GRCm39) missense unknown
R0719:Pik3c2g UTSW 6 139,606,723 (GRCm39) missense probably damaging 1.00
R0740:Pik3c2g UTSW 6 139,610,791 (GRCm39) critical splice donor site probably null
R0837:Pik3c2g UTSW 6 139,903,425 (GRCm39) splice site probably benign
R0840:Pik3c2g UTSW 6 139,841,798 (GRCm39) missense probably damaging 1.00
R1306:Pik3c2g UTSW 6 139,718,154 (GRCm39) missense probably benign
R1501:Pik3c2g UTSW 6 139,789,796 (GRCm39) critical splice donor site probably null
R1591:Pik3c2g UTSW 6 139,693,904 (GRCm39) missense probably benign 0.00
R1666:Pik3c2g UTSW 6 139,612,634 (GRCm39) intron probably benign
R1907:Pik3c2g UTSW 6 139,789,768 (GRCm39) missense probably damaging 1.00
R1970:Pik3c2g UTSW 6 139,846,112 (GRCm39) critical splice donor site probably null
R2171:Pik3c2g UTSW 6 139,801,012 (GRCm39) nonsense probably null
R2188:Pik3c2g UTSW 6 139,798,600 (GRCm39) missense probably damaging 1.00
R3777:Pik3c2g UTSW 6 139,599,385 (GRCm39) missense probably damaging 1.00
R3778:Pik3c2g UTSW 6 139,599,385 (GRCm39) missense probably damaging 1.00
R3965:Pik3c2g UTSW 6 139,801,018 (GRCm39) missense possibly damaging 0.90
R4076:Pik3c2g UTSW 6 139,798,589 (GRCm39) missense probably damaging 1.00
R4078:Pik3c2g UTSW 6 139,612,608 (GRCm39) intron probably benign
R4108:Pik3c2g UTSW 6 139,676,096 (GRCm39) missense probably benign 0.00
R4461:Pik3c2g UTSW 6 139,787,407 (GRCm39) intron probably benign
R4474:Pik3c2g UTSW 6 139,610,749 (GRCm39) missense probably damaging 0.99
R4509:Pik3c2g UTSW 6 139,665,732 (GRCm39) missense probably benign 0.25
R4646:Pik3c2g UTSW 6 139,665,744 (GRCm39) missense probably benign 0.05
R4732:Pik3c2g UTSW 6 139,881,711 (GRCm39) missense probably benign 0.28
R4733:Pik3c2g UTSW 6 139,881,711 (GRCm39) missense probably benign 0.28
R4854:Pik3c2g UTSW 6 139,714,505 (GRCm39) missense probably damaging 1.00
R4928:Pik3c2g UTSW 6 139,913,528 (GRCm39) missense possibly damaging 0.88
R4959:Pik3c2g UTSW 6 139,789,657 (GRCm39) missense possibly damaging 0.65
R4973:Pik3c2g UTSW 6 139,789,657 (GRCm39) missense possibly damaging 0.65
R5032:Pik3c2g UTSW 6 139,841,928 (GRCm39) missense probably benign 0.00
R5071:Pik3c2g UTSW 6 139,665,873 (GRCm39) missense probably null 0.00
R5072:Pik3c2g UTSW 6 139,665,873 (GRCm39) missense probably null 0.00
R5073:Pik3c2g UTSW 6 139,665,873 (GRCm39) missense probably null 0.00
R5074:Pik3c2g UTSW 6 139,665,873 (GRCm39) missense probably null 0.00
R5107:Pik3c2g UTSW 6 139,612,623 (GRCm39) intron probably benign
R5186:Pik3c2g UTSW 6 139,599,016 (GRCm39) missense probably damaging 1.00
R5253:Pik3c2g UTSW 6 139,841,983 (GRCm39) critical splice donor site probably null
R5359:Pik3c2g UTSW 6 139,599,121 (GRCm39) missense probably damaging 1.00
R5394:Pik3c2g UTSW 6 139,665,808 (GRCm39) missense probably benign
R5417:Pik3c2g UTSW 6 139,682,669 (GRCm39) missense probably benign
R5435:Pik3c2g UTSW 6 139,661,581 (GRCm39) splice site probably null
R5580:Pik3c2g UTSW 6 139,603,531 (GRCm39) missense probably damaging 0.99
R5664:Pik3c2g UTSW 6 139,682,733 (GRCm39) missense probably damaging 0.98
R5908:Pik3c2g UTSW 6 139,714,436 (GRCm39) missense
R5914:Pik3c2g UTSW 6 139,599,477 (GRCm39) missense probably benign 0.00
R6046:Pik3c2g UTSW 6 139,842,518 (GRCm39) missense probably damaging 1.00
R6046:Pik3c2g UTSW 6 139,599,137 (GRCm39) missense probably damaging 0.96
R6298:Pik3c2g UTSW 6 139,603,561 (GRCm39) missense probably damaging 1.00
R6382:Pik3c2g UTSW 6 139,665,724 (GRCm39) missense possibly damaging 0.88
R6480:Pik3c2g UTSW 6 139,676,195 (GRCm39) missense probably benign 0.27
R6917:Pik3c2g UTSW 6 139,841,899 (GRCm39) missense probably benign 0.00
R6929:Pik3c2g UTSW 6 139,903,502 (GRCm39) missense possibly damaging 0.67
R7022:Pik3c2g UTSW 6 139,599,061 (GRCm39) missense possibly damaging 0.82
R7144:Pik3c2g UTSW 6 139,606,868 (GRCm39) missense probably damaging 1.00
R7213:Pik3c2g UTSW 6 139,805,990 (GRCm39) missense
R7215:Pik3c2g UTSW 6 139,700,589 (GRCm39) missense
R7332:Pik3c2g UTSW 6 139,841,981 (GRCm39) missense
R7357:Pik3c2g UTSW 6 139,610,791 (GRCm39) critical splice donor site probably null
R7359:Pik3c2g UTSW 6 139,913,620 (GRCm39) missense unknown
R7385:Pik3c2g UTSW 6 139,801,079 (GRCm39) missense
R7455:Pik3c2g UTSW 6 139,913,643 (GRCm39) missense unknown
R7651:Pik3c2g UTSW 6 139,599,070 (GRCm39) missense possibly damaging 0.85
R7888:Pik3c2g UTSW 6 139,842,470 (GRCm39) missense
R7923:Pik3c2g UTSW 6 139,610,791 (GRCm39) critical splice donor site probably null
R7964:Pik3c2g UTSW 6 139,827,786 (GRCm39) missense
R8005:Pik3c2g UTSW 6 139,599,067 (GRCm39) missense probably benign 0.01
R8371:Pik3c2g UTSW 6 139,881,782 (GRCm39) missense unknown
R8724:Pik3c2g UTSW 6 139,913,619 (GRCm39) missense unknown
R8733:Pik3c2g UTSW 6 139,714,426 (GRCm39) nonsense probably null
R8809:Pik3c2g UTSW 6 139,714,436 (GRCm39) missense
R8888:Pik3c2g UTSW 6 139,676,092 (GRCm39) nonsense probably null
R8931:Pik3c2g UTSW 6 139,821,093 (GRCm39) missense probably benign 0.02
R9188:Pik3c2g UTSW 6 139,599,401 (GRCm39) missense possibly damaging 0.94
R9336:Pik3c2g UTSW 6 139,821,161 (GRCm39) missense
R9383:Pik3c2g UTSW 6 139,827,742 (GRCm39) nonsense probably null
R9524:Pik3c2g UTSW 6 139,606,768 (GRCm39) missense probably damaging 0.99
R9531:Pik3c2g UTSW 6 139,841,926 (GRCm39) missense
R9630:Pik3c2g UTSW 6 139,599,237 (GRCm39) missense possibly damaging 0.66
R9697:Pik3c2g UTSW 6 139,913,517 (GRCm39) missense unknown
R9708:Pik3c2g UTSW 6 139,606,865 (GRCm39) missense probably benign
R9717:Pik3c2g UTSW 6 139,841,910 (GRCm39) missense
RF015:Pik3c2g UTSW 6 139,700,497 (GRCm39) missense
RF032:Pik3c2g UTSW 6 139,612,656 (GRCm39) frame shift probably null
X0024:Pik3c2g UTSW 6 139,805,984 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAAACATCATAACTACTGTGGAG -3'
(R):5'- AGATTCCACGAGCTAAACTTCC -3'

Sequencing Primer
(F):5'- TGGAGAACATGAAGGCAATCTCCC -3'
(R):5'- TCCACGAGCTAAACTTCCATTTATAC -3'
Posted On 2014-08-25