Incidental Mutation 'R1982:Prr14'
ID219944
Institutional Source Beutler Lab
Gene Symbol Prr14
Ensembl Gene ENSMUSG00000030822
Gene Nameproline rich 14
Synonyms
MMRRC Submission 039994-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.129) question?
Stock #R1982 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location127459611-127476759 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 127475490 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 398 (R398L)
Ref Sequence ENSEMBL: ENSMUSP00000101899 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033095] [ENSMUST00000106292] [ENSMUST00000133817] [ENSMUST00000133938] [ENSMUST00000205432] [ENSMUST00000206394] [ENSMUST00000206915]
Predicted Effect possibly damaging
Transcript: ENSMUST00000033095
AA Change: R398L

PolyPhen 2 Score 0.873 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000033095
Gene: ENSMUSG00000030822
AA Change: R398L

DomainStartEndE-ValueType
low complexity region 241 256 N/A INTRINSIC
low complexity region 263 273 N/A INTRINSIC
low complexity region 297 309 N/A INTRINSIC
low complexity region 364 387 N/A INTRINSIC
Pfam:Tantalus 485 545 5.6e-28 PFAM
low complexity region 554 564 N/A INTRINSIC
low complexity region 587 603 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000106292
AA Change: R398L

PolyPhen 2 Score 0.873 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000101899
Gene: ENSMUSG00000030822
AA Change: R398L

DomainStartEndE-ValueType
low complexity region 241 256 N/A INTRINSIC
low complexity region 263 273 N/A INTRINSIC
low complexity region 297 309 N/A INTRINSIC
low complexity region 364 387 N/A INTRINSIC
Pfam:Tantalus 487 544 1.7e-26 PFAM
low complexity region 554 564 N/A INTRINSIC
low complexity region 587 603 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128805
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132124
Predicted Effect probably benign
Transcript: ENSMUST00000132819
Predicted Effect probably benign
Transcript: ENSMUST00000133817
Predicted Effect probably benign
Transcript: ENSMUST00000133938
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142532
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147202
Predicted Effect probably benign
Transcript: ENSMUST00000205432
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206118
Predicted Effect probably benign
Transcript: ENSMUST00000206394
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206980
Predicted Effect probably benign
Transcript: ENSMUST00000206915
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene tethers heterochromatin to the nuclear laminar scaffold by binding heterochromatin protein 1 (HP1) and the nuclear lamina. The tether is broken during mitosis and reforms quickly after mitosis, with the encoded protein first binding HP1 and then attaching to the nuclear lamina. This protein also has been shown to promote MyoD activity and skeletal myogenesis. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930415L06Rik A T X: 89,931,445 V382E probably damaging Het
Aatk G T 11: 120,013,514 P252Q probably damaging Het
Adamts4 T C 1: 171,258,934 V765A probably benign Het
Agfg2 A T 5: 137,664,253 V184E possibly damaging Het
Alas1 A T 9: 106,238,185 I48N probably damaging Het
Anks1 T C 17: 27,985,121 V181A probably damaging Het
Anxa8 A T 14: 34,096,570 R261S probably damaging Het
Aqp4 T C 18: 15,393,551 D291G probably damaging Het
Atrn A G 2: 130,970,222 R696G probably benign Het
Barx2 A C 9: 31,913,012 I27S probably damaging Het
Btnl1 A T 17: 34,379,751 I114L possibly damaging Het
Casq1 C T 1: 172,215,530 A200T probably damaging Het
Ccdc33 T A 9: 58,117,168 E225D probably benign Het
Cd84 C A 1: 171,884,585 probably null Het
Ceacam9 T G 7: 16,725,307 L177R probably benign Het
Cenpi T A X: 134,318,033 F161L possibly damaging Het
Cep63 T C 9: 102,602,880 K251E probably damaging Het
Cetn3 A G 13: 81,784,697 E25G probably damaging Het
Crybg3 T C 16: 59,544,125 D2378G possibly damaging Het
Ddx19b T C 8: 111,009,343 T357A possibly damaging Het
Dpep2 A C 8: 105,989,455 Y266* probably null Het
Dqx1 G A 6: 83,058,577 D24N probably damaging Het
Dsg4 A T 18: 20,471,212 Y912F probably damaging Het
Fam71f2 A G 6: 29,285,922 T69A probably benign Het
Fezf2 G T 14: 12,344,405 P261T probably benign Het
Fmo1 T C 1: 162,839,756 I163M possibly damaging Het
Gatad2a G A 8: 69,913,132 R428* probably null Het
Gfpt1 T A 6: 87,054,630 F85I possibly damaging Het
Gimap7 A T 6: 48,724,241 I254F possibly damaging Het
Glcci1 T C 6: 8,592,980 S261P probably damaging Het
Glis3 A T 19: 28,531,274 F437I probably damaging Het
Glp1r C A 17: 30,925,627 S258* probably null Het
Gm13023 C A 4: 143,795,150 H445Q probably benign Het
Gm7030 T A 17: 36,128,722 D122V probably damaging Het
Gpt2 C T 8: 85,516,203 A288V possibly damaging Het
Grin2c G T 11: 115,260,905 S76R possibly damaging Het
Guf1 T A 5: 69,567,226 Y447* probably null Het
Hectd1 A C 12: 51,785,841 L916V probably damaging Het
Hnf4g A G 3: 3,638,208 K96E probably damaging Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Ifi207 T G 1: 173,735,239 M114L probably benign Het
Ifi35 A T 11: 101,458,286 E252V probably damaging Het
Igsf9b G A 9: 27,322,239 R345H possibly damaging Het
Itih3 T C 14: 30,923,583 probably benign Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Kidins220 A T 12: 25,051,194 M1252L probably benign Het
Kifap3 T A 1: 163,862,022 L525* probably null Het
Limk2 A T 11: 3,355,461 D35E probably benign Het
Lrrc37a G A 11: 103,498,966 P1878S probably benign Het
Mansc4 T A 6: 147,075,675 I148F probably benign Het
Mei1 A G 15: 82,103,312 N859S probably benign Het
Mib1 A G 18: 10,812,064 D987G probably damaging Het
Mroh8 A G 2: 157,271,975 V132A possibly damaging Het
Npnt T C 3: 132,948,132 I29M probably benign Het
Nrap T C 19: 56,384,105 D138G probably damaging Het
Olfr1 A T 11: 73,395,092 I310N probably benign Het
Olfr5 T C 7: 6,480,932 M75V probably benign Het
Olfr512 A G 7: 108,713,695 Y102C probably damaging Het
Olfr91 T A 17: 37,093,808 E22V probably damaging Het
Osbpl5 A C 7: 143,741,671 probably null Het
Pcna-ps2 T C 19: 9,283,683 V102A possibly damaging Het
Pik3c2g T C 6: 139,622,548 S221P probably damaging Het
Plppr3 A G 10: 79,866,425 I271T probably damaging Het
Prkar1b C T 5: 139,127,643 A41T probably benign Het
Prkcsh A G 9: 22,012,868 D458G probably damaging Het
Ptafr A G 4: 132,579,985 R229G probably damaging Het
Rbp3 T C 14: 33,954,545 F150S probably damaging Het
Rel C T 11: 23,742,761 G424D probably benign Het
Rlf T C 4: 121,150,112 Y557C probably damaging Het
Samt3 A C X: 86,047,134 M211L probably benign Het
Selenop A T 15: 3,275,694 I111F probably damaging Het
Slc2a2 G A 3: 28,717,441 M173I probably benign Het
Slc43a1 G T 2: 84,856,889 G361V possibly damaging Het
Slit2 G A 5: 48,249,836 V870M probably damaging Het
Ssxb10 A G X: 8,331,019 D77G probably benign Het
Stk32b T A 5: 37,649,114 I29F probably damaging Het
Stra6l T A 4: 45,867,237 C161* probably null Het
Tecpr2 T A 12: 110,954,785 M1264K probably benign Het
Tfap2c A T 2: 172,557,236 I468F probably damaging Het
Ticam1 C T 17: 56,271,555 R180H probably damaging Het
Tlr4 T A 4: 66,841,035 N688K probably benign Het
Tmem35b A T 4: 127,126,053 probably benign Het
Ugt2b34 T C 5: 86,906,313 E203G probably damaging Het
Vegfa A C 17: 46,018,860 *393G probably null Het
Vmn2r16 T C 5: 109,364,024 V699A probably benign Het
Zfp324 T C 7: 12,971,218 S445P probably damaging Het
Zfp982 T A 4: 147,512,592 C135* probably null Het
Zfp990 A C 4: 145,536,869 N146H probably damaging Het
Zfyve26 A G 12: 79,255,243 Y431H possibly damaging Het
Other mutations in Prr14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00551:Prr14 APN 7 127474647 missense probably benign 0.01
IGL01614:Prr14 APN 7 127475133 missense probably damaging 1.00
IGL01655:Prr14 APN 7 127475767 missense probably benign 0.00
IGL02273:Prr14 APN 7 127475936 missense probably damaging 1.00
IGL03033:Prr14 APN 7 127471963 missense probably damaging 1.00
R0364:Prr14 UTSW 7 127474579 missense probably benign 0.01
R0376:Prr14 UTSW 7 127476643 missense probably benign 0.33
R0448:Prr14 UTSW 7 127474726 unclassified probably benign
R0555:Prr14 UTSW 7 127472095 unclassified probably benign
R1462:Prr14 UTSW 7 127473988 critical splice donor site probably null
R1462:Prr14 UTSW 7 127473988 critical splice donor site probably null
R1534:Prr14 UTSW 7 127473982 missense probably benign 0.08
R2357:Prr14 UTSW 7 127475363 missense probably benign 0.02
R4729:Prr14 UTSW 7 127474696 missense probably benign 0.00
R5582:Prr14 UTSW 7 127476397 missense probably damaging 1.00
R5757:Prr14 UTSW 7 127475553 missense possibly damaging 0.65
R6497:Prr14 UTSW 7 127474578 missense probably benign 0.03
R6987:Prr14 UTSW 7 127473805 missense possibly damaging 0.94
R7202:Prr14 UTSW 7 127476476 missense probably damaging 0.99
R7376:Prr14 UTSW 7 127476577 missense probably benign
R7380:Prr14 UTSW 7 127476442 missense probably null 1.00
R7426:Prr14 UTSW 7 127475286 missense probably benign 0.00
R7470:Prr14 UTSW 7 127475825 missense probably null 1.00
R8322:Prr14 UTSW 7 127473827 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- TGGCGGACTCAGTGCAATTC -3'
(R):5'- CACAGCAATGCACTCGTCTTC -3'

Sequencing Primer
(F):5'- GGACTCAGTGCAATTCCCTAG -3'
(R):5'- CTTCTGCCAGTGAATACTAAGCAAGG -3'
Posted On2014-08-25