Incidental Mutation 'R1982:Osbpl5'
ID 219947
Institutional Source Beutler Lab
Gene Symbol Osbpl5
Ensembl Gene ENSMUSG00000037606
Gene Name oxysterol binding protein-like 5
Synonyms Obph1, ORP5, 1110006M06Rik
MMRRC Submission 039994-MU
Accession Numbers

Genbank: NM_024289 ; MGI: 1930265

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R1982 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 143688762-143756985 bp(-) (GRCm38)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to C at 143741671 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000020411] [ENSMUST00000020411] [ENSMUST00000119499] [ENSMUST00000134056]
AlphaFold Q9ER64
Predicted Effect probably null
Transcript: ENSMUST00000020411
SMART Domains Protein: ENSMUSP00000020411
Gene: ENSMUSG00000037606

DomainStartEndE-ValueType
PH 151 269 1.02e-14 SMART
Pfam:Oxysterol_BP 394 738 2.9e-91 PFAM
transmembrane domain 879 897 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000020411
SMART Domains Protein: ENSMUSP00000020411
Gene: ENSMUSG00000037606

DomainStartEndE-ValueType
PH 151 269 1.02e-14 SMART
Pfam:Oxysterol_BP 394 738 2.9e-91 PFAM
transmembrane domain 879 897 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119499
SMART Domains Protein: ENSMUSP00000113362
Gene: ENSMUSG00000037606

DomainStartEndE-ValueType
coiled coil region 92 122 N/A INTRINSIC
PH 127 245 1.02e-14 SMART
Pfam:Oxysterol_BP 369 724 1e-93 PFAM
transmembrane domain 855 873 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000121409
SMART Domains Protein: ENSMUSP00000113375
Gene: ENSMUSG00000037606

DomainStartEndE-ValueType
coiled coil region 92 122 N/A INTRINSIC
PH 127 245 1.02e-14 SMART
Pfam:Oxysterol_BP 369 724 1e-93 PFAM
transmembrane domain 855 873 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000134056
SMART Domains Protein: ENSMUSP00000115141
Gene: ENSMUSG00000037606

DomainStartEndE-ValueType
PDB:1V88|A 122 187 7e-33 PDB
SCOP:d1fgya_ 125 187 3e-10 SMART
Blast:PH 127 187 5e-38 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153864
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the oxysterol-binding protein (OSBP) family, a group of intracellular lipid receptors that play a key role in the maintenance of cholesterol balance in the body. Most members contain an N-terminal pleckstrin homology domain and a highly conserved C-terminal OSBP-like sterol-binding domain. This gene has been shown to be imprinted, with preferential expression from the maternal allele only in placenta. Transcript variants encoding different isoforms have been identified. [provided by RefSeq, Oct 2010]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930415L06Rik A T X: 89,931,445 V382E probably damaging Het
Aatk G T 11: 120,013,514 P252Q probably damaging Het
Adamts4 T C 1: 171,258,934 V765A probably benign Het
Agfg2 A T 5: 137,664,253 V184E possibly damaging Het
Alas1 A T 9: 106,238,185 I48N probably damaging Het
Anks1 T C 17: 27,985,121 V181A probably damaging Het
Anxa8 A T 14: 34,096,570 R261S probably damaging Het
Aqp4 T C 18: 15,393,551 D291G probably damaging Het
Atrn A G 2: 130,970,222 R696G probably benign Het
Barx2 A C 9: 31,913,012 I27S probably damaging Het
Btnl1 A T 17: 34,379,751 I114L possibly damaging Het
Casq1 C T 1: 172,215,530 A200T probably damaging Het
Ccdc33 T A 9: 58,117,168 E225D probably benign Het
Cd84 C A 1: 171,884,585 probably null Het
Ceacam9 T G 7: 16,725,307 L177R probably benign Het
Cenpi T A X: 134,318,033 F161L possibly damaging Het
Cep63 T C 9: 102,602,880 K251E probably damaging Het
Cetn3 A G 13: 81,784,697 E25G probably damaging Het
Crybg3 T C 16: 59,544,125 D2378G possibly damaging Het
Ddx19b T C 8: 111,009,343 T357A possibly damaging Het
Dpep2 A C 8: 105,989,455 Y266* probably null Het
Dqx1 G A 6: 83,058,577 D24N probably damaging Het
Dsg4 A T 18: 20,471,212 Y912F probably damaging Het
Fam71f2 A G 6: 29,285,922 T69A probably benign Het
Fezf2 G T 14: 12,344,405 P261T probably benign Het
Fmo1 T C 1: 162,839,756 I163M possibly damaging Het
Gatad2a G A 8: 69,913,132 R428* probably null Het
Gfpt1 T A 6: 87,054,630 F85I possibly damaging Het
Gimap7 A T 6: 48,724,241 I254F possibly damaging Het
Glcci1 T C 6: 8,592,980 S261P probably damaging Het
Glis3 A T 19: 28,531,274 F437I probably damaging Het
Glp1r C A 17: 30,925,627 S258* probably null Het
Gm13023 C A 4: 143,795,150 H445Q probably benign Het
Gm7030 T A 17: 36,128,722 D122V probably damaging Het
Gpt2 C T 8: 85,516,203 A288V possibly damaging Het
Grin2c G T 11: 115,260,905 S76R possibly damaging Het
Guf1 T A 5: 69,567,226 Y447* probably null Het
Hectd1 A C 12: 51,785,841 L916V probably damaging Het
Hnf4g A G 3: 3,638,208 K96E probably damaging Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Ifi207 T G 1: 173,735,239 M114L probably benign Het
Ifi35 A T 11: 101,458,286 E252V probably damaging Het
Igsf9b G A 9: 27,322,239 R345H possibly damaging Het
Itih3 T C 14: 30,923,583 probably benign Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 74 probably benign Het
Kidins220 A T 12: 25,051,194 M1252L probably benign Het
Kifap3 T A 1: 163,862,022 L525* probably null Het
Limk2 A T 11: 3,355,461 D35E probably benign Het
Lrrc37a G A 11: 103,498,966 P1878S probably benign Het
Mansc4 T A 6: 147,075,675 I148F probably benign Het
Mei1 A G 15: 82,103,312 N859S probably benign Het
Mib1 A G 18: 10,812,064 D987G probably damaging Het
Mroh8 A G 2: 157,271,975 V132A possibly damaging Het
Npnt T C 3: 132,948,132 I29M probably benign Het
Nrap T C 19: 56,384,105 D138G probably damaging Het
Olfr1 A T 11: 73,395,092 I310N probably benign Het
Olfr5 T C 7: 6,480,932 M75V probably benign Het
Olfr512 A G 7: 108,713,695 Y102C probably damaging Het
Olfr91 T A 17: 37,093,808 E22V probably damaging Het
Pcna-ps2 T C 19: 9,283,683 V102A possibly damaging Het
Pik3c2g T C 6: 139,622,548 S221P probably damaging Het
Plppr3 A G 10: 79,866,425 I271T probably damaging Het
Prkar1b C T 5: 139,127,643 A41T probably benign Het
Prkcsh A G 9: 22,012,868 D458G probably damaging Het
Prr14 G T 7: 127,475,490 R398L possibly damaging Het
Ptafr A G 4: 132,579,985 R229G probably damaging Het
Rbp3 T C 14: 33,954,545 F150S probably damaging Het
Rel C T 11: 23,742,761 G424D probably benign Het
Rlf T C 4: 121,150,112 Y557C probably damaging Het
Samt3 A C X: 86,047,134 M211L probably benign Het
Selenop A T 15: 3,275,694 I111F probably damaging Het
Slc2a2 G A 3: 28,717,441 M173I probably benign Het
Slc43a1 G T 2: 84,856,889 G361V possibly damaging Het
Slit2 G A 5: 48,249,836 V870M probably damaging Het
Ssxb10 A G X: 8,331,019 D77G probably benign Het
Stk32b T A 5: 37,649,114 I29F probably damaging Het
Stra6l T A 4: 45,867,237 C161* probably null Het
Tecpr2 T A 12: 110,954,785 M1264K probably benign Het
Tfap2c A T 2: 172,557,236 I468F probably damaging Het
Ticam1 C T 17: 56,271,555 R180H probably damaging Het
Tlr4 T A 4: 66,841,035 N688K probably benign Het
Tmem35b A T 4: 127,126,053 probably benign Het
Ugt2b34 T C 5: 86,906,313 E203G probably damaging Het
Vegfa A C 17: 46,018,860 *393G probably null Het
Vmn2r16 T C 5: 109,364,024 V699A probably benign Het
Zfp324 T C 7: 12,971,218 S445P probably damaging Het
Zfp982 T A 4: 147,512,592 C135* probably null Het
Zfp990 A C 4: 145,536,869 N146H probably damaging Het
Zfyve26 A G 12: 79,255,243 Y431H possibly damaging Het
Other mutations in Osbpl5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01560:Osbpl5 APN 7 143715693 nonsense probably null
IGL01996:Osbpl5 APN 7 143707344 critical splice donor site probably null
IGL02135:Osbpl5 APN 7 143705125 missense probably damaging 1.00
IGL02331:Osbpl5 APN 7 143709795 missense probably benign 0.22
IGL02993:Osbpl5 APN 7 143699334 critical splice acceptor site probably null
R0240:Osbpl5 UTSW 7 143741669 splice site probably null
R0601:Osbpl5 UTSW 7 143709549 missense probably damaging 0.98
R0609:Osbpl5 UTSW 7 143694821 missense probably damaging 0.99
R0659:Osbpl5 UTSW 7 143705030 missense probably damaging 0.97
R1532:Osbpl5 UTSW 7 143695080 missense probably benign
R1579:Osbpl5 UTSW 7 143709202 missense possibly damaging 0.93
R1595:Osbpl5 UTSW 7 143703218 missense possibly damaging 0.88
R1666:Osbpl5 UTSW 7 143709039 missense probably damaging 1.00
R1668:Osbpl5 UTSW 7 143709039 missense probably damaging 1.00
R1713:Osbpl5 UTSW 7 143694373 missense probably damaging 1.00
R1868:Osbpl5 UTSW 7 143715773 missense probably damaging 1.00
R1901:Osbpl5 UTSW 7 143703181 missense possibly damaging 0.83
R1902:Osbpl5 UTSW 7 143703181 missense possibly damaging 0.83
R1903:Osbpl5 UTSW 7 143703181 missense possibly damaging 0.83
R1911:Osbpl5 UTSW 7 143689925 missense probably benign 0.00
R2014:Osbpl5 UTSW 7 143741692 missense probably damaging 0.98
R2076:Osbpl5 UTSW 7 143709144 missense probably damaging 1.00
R2192:Osbpl5 UTSW 7 143693859 nonsense probably null
R2256:Osbpl5 UTSW 7 143709094 missense probably damaging 1.00
R4271:Osbpl5 UTSW 7 143695602 nonsense probably null
R4418:Osbpl5 UTSW 7 143709815 nonsense probably null
R4450:Osbpl5 UTSW 7 143694906 missense probably benign 0.00
R4573:Osbpl5 UTSW 7 143694316 missense probably benign 0.00
R5325:Osbpl5 UTSW 7 143691928 missense probably damaging 0.99
R5439:Osbpl5 UTSW 7 143741696 missense possibly damaging 0.83
R5617:Osbpl5 UTSW 7 143692947 missense possibly damaging 0.89
R5775:Osbpl5 UTSW 7 143704529 missense probably benign 0.00
R5935:Osbpl5 UTSW 7 143756958 start gained probably benign
R6906:Osbpl5 UTSW 7 143694328 missense probably damaging 0.99
R7076:Osbpl5 UTSW 7 143709840 missense probably benign 0.12
R7117:Osbpl5 UTSW 7 143709783 missense probably benign 0.01
R7292:Osbpl5 UTSW 7 143701278 missense probably damaging 1.00
R7555:Osbpl5 UTSW 7 143694933 missense possibly damaging 0.65
R7594:Osbpl5 UTSW 7 143693797 missense probably benign 0.02
R8028:Osbpl5 UTSW 7 143715735 missense probably benign 0.00
R8061:Osbpl5 UTSW 7 143702724 missense probably benign 0.03
R8314:Osbpl5 UTSW 7 143695096 missense probably benign 0.05
R8482:Osbpl5 UTSW 7 143704994 missense probably benign 0.12
R9202:Osbpl5 UTSW 7 143700761 missense probably benign 0.45
R9430:Osbpl5 UTSW 7 143709789
YA93:Osbpl5 UTSW 7 143693870 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GCGTGCAAACCTGGAATAGAC -3'
(R):5'- TACTGGGTTCTAGCAGCCAC -3'

Sequencing Primer
(F):5'- CTGGAATAGACAACTTCCAGTCTCTG -3'
(R):5'- ACACCCAGCTTTTTGTTTGAG -3'
Posted On 2014-08-25