Mutagenetix > Incidental Mutation

Incidental Mutation 'R1982:Barx2'

219966

Institutional Source

Beutler Lab

Gene Symbol

Barx2

Ensembl Gene

ENSMUSG00000032033

Gene Name

BarH-like homeobox 2

Synonyms

2310006E12Rik, Barx2b

MMRRC Submission

039994-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.738) question?

Stock #

R1982 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

31846044-31913462 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 31913012 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Serine at position 27 (I27S)

Ref Sequence

ENSEMBL: ENSMUSP00000112314 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000116615]

AlphaFold

O08686

Predicted Effect

probably damaging
Transcript: ENSMUST00000116615
AA Change: I27S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000112314
Gene: ENSMUSG00000032033
AA Change: I27S

Domain	Start	End	E-Value	Type
low complexity region	103	113	N/A	INTRINSIC
HOX	137	199	3.2e-25	SMART
low complexity region	230	246	N/A	INTRINSIC
low complexity region	268	283	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000216981

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the homeobox transcription factor family. A highly related protein in mouse has been shown to influence cellular processes that control cell adhesion and remodeling of the actin cytoskeleton in myoblast fusion and chondrogenesis. The encoded protein may also play a role in cancer progression. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted gene deletion exhibit short whiskers at birth, defective juvenile hair follicle remodeling, and short adult hair. Fifty percent of homozygotes are born with open eyelids. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 89 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930415L06Rik	A	T	X: 89,931,445	V382E	probably damaging	Het
Aatk	G	T	11: 120,013,514	P252Q	probably damaging	Het
Adamts4	T	C	1: 171,258,934	V765A	probably benign	Het
Agfg2	A	T	5: 137,664,253	V184E	possibly damaging	Het
Alas1	A	T	9: 106,238,185	I48N	probably damaging	Het
Anks1	T	C	17: 27,985,121	V181A	probably damaging	Het
Anxa8	A	T	14: 34,096,570	R261S	probably damaging	Het
Aqp4	T	C	18: 15,393,551	D291G	probably damaging	Het
Atrn	A	G	2: 130,970,222	R696G	probably benign	Het
Btnl1	A	T	17: 34,379,751	I114L	possibly damaging	Het
Casq1	C	T	1: 172,215,530	A200T	probably damaging	Het
Ccdc33	T	A	9: 58,117,168	E225D	probably benign	Het
Cd84	C	A	1: 171,884,585		probably null	Het
Ceacam9	T	G	7: 16,725,307	L177R	probably benign	Het
Cenpi	T	A	X: 134,318,033	F161L	possibly damaging	Het
Cep63	T	C	9: 102,602,880	K251E	probably damaging	Het
Cetn3	A	G	13: 81,784,697	E25G	probably damaging	Het
Crybg3	T	C	16: 59,544,125	D2378G	possibly damaging	Het
Ddx19b	T	C	8: 111,009,343	T357A	possibly damaging	Het
Dpep2	A	C	8: 105,989,455	Y266*	probably null	Het
Dqx1	G	A	6: 83,058,577	D24N	probably damaging	Het
Dsg4	A	T	18: 20,471,212	Y912F	probably damaging	Het
Fam71f2	A	G	6: 29,285,922	T69A	probably benign	Het
Fezf2	G	T	14: 12,344,405	P261T	probably benign	Het
Fmo1	T	C	1: 162,839,756	I163M	possibly damaging	Het
Gatad2a	G	A	8: 69,913,132	R428*	probably null	Het
Gfpt1	T	A	6: 87,054,630	F85I	possibly damaging	Het
Gimap7	A	T	6: 48,724,241	I254F	possibly damaging	Het
Glcci1	T	C	6: 8,592,980	S261P	probably damaging	Het
Glis3	A	T	19: 28,531,274	F437I	probably damaging	Het
Glp1r	C	A	17: 30,925,627	S258*	probably null	Het
Gm13023	C	A	4: 143,795,150	H445Q	probably benign	Het
Gm7030	T	A	17: 36,128,722	D122V	probably damaging	Het
Gpt2	C	T	8: 85,516,203	A288V	possibly damaging	Het
Grin2c	G	T	11: 115,260,905	S76R	possibly damaging	Het
Guf1	T	A	5: 69,567,226	Y447*	probably null	Het
Hectd1	A	C	12: 51,785,841	L916V	probably damaging	Het
Hnf4g	A	G	3: 3,638,208	K96E	probably damaging	Het
Hsh2d	G	A	8: 72,200,460	D229N	probably benign	Het
Ifi207	T	G	1: 173,735,239	M114L	probably benign	Het
Ifi35	A	T	11: 101,458,286	E252V	probably damaging	Het
Igsf9b	G	A	9: 27,322,239	R345H	possibly damaging	Het
Itih3	T	C	14: 30,923,583		probably benign	Het
Kcnh8	GAGACCAACGAGCAGCTGATGCTTCAGA	GAGA	17: 52,725,906	74	probably benign	Het
Kidins220	A	T	12: 25,051,194	M1252L	probably benign	Het
Kifap3	T	A	1: 163,862,022	L525*	probably null	Het
Limk2	A	T	11: 3,355,461	D35E	probably benign	Het
Lrrc37a	G	A	11: 103,498,966	P1878S	probably benign	Het
Mansc4	T	A	6: 147,075,675	I148F	probably benign	Het
Mei1	A	G	15: 82,103,312	N859S	probably benign	Het
Mib1	A	G	18: 10,812,064	D987G	probably damaging	Het
Mroh8	A	G	2: 157,271,975	V132A	possibly damaging	Het
Npnt	T	C	3: 132,948,132	I29M	probably benign	Het
Nrap	T	C	19: 56,384,105	D138G	probably damaging	Het
Olfr1	A	T	11: 73,395,092	I310N	probably benign	Het
Olfr5	T	C	7: 6,480,932	M75V	probably benign	Het
Olfr512	A	G	7: 108,713,695	Y102C	probably damaging	Het
Olfr91	T	A	17: 37,093,808	E22V	probably damaging	Het
Osbpl5	A	C	7: 143,741,671		probably null	Het
Pcna-ps2	T	C	19: 9,283,683	V102A	possibly damaging	Het
Pik3c2g	T	C	6: 139,622,548	S221P	probably damaging	Het
Plppr3	A	G	10: 79,866,425	I271T	probably damaging	Het
Prkar1b	C	T	5: 139,127,643	A41T	probably benign	Het
Prkcsh	A	G	9: 22,012,868	D458G	probably damaging	Het
Prr14	G	T	7: 127,475,490	R398L	possibly damaging	Het
Ptafr	A	G	4: 132,579,985	R229G	probably damaging	Het
Rbp3	T	C	14: 33,954,545	F150S	probably damaging	Het
Rel	C	T	11: 23,742,761	G424D	probably benign	Het
Rlf	T	C	4: 121,150,112	Y557C	probably damaging	Het
Samt3	A	C	X: 86,047,134	M211L	probably benign	Het
Selenop	A	T	15: 3,275,694	I111F	probably damaging	Het
Slc2a2	G	A	3: 28,717,441	M173I	probably benign	Het
Slc43a1	G	T	2: 84,856,889	G361V	possibly damaging	Het
Slit2	G	A	5: 48,249,836	V870M	probably damaging	Het
Ssxb10	A	G	X: 8,331,019	D77G	probably benign	Het
Stk32b	T	A	5: 37,649,114	I29F	probably damaging	Het
Stra6l	T	A	4: 45,867,237	C161*	probably null	Het
Tecpr2	T	A	12: 110,954,785	M1264K	probably benign	Het
Tfap2c	A	T	2: 172,557,236	I468F	probably damaging	Het
Ticam1	C	T	17: 56,271,555	R180H	probably damaging	Het
Tlr4	T	A	4: 66,841,035	N688K	probably benign	Het
Tmem35b	A	T	4: 127,126,053		probably benign	Het
Ugt2b34	T	C	5: 86,906,313	E203G	probably damaging	Het
Vegfa	A	C	17: 46,018,860	*393G	probably null	Het
Vmn2r16	T	C	5: 109,364,024	V699A	probably benign	Het
Zfp324	T	C	7: 12,971,218	S445P	probably damaging	Het
Zfp982	T	A	4: 147,512,592	C135*	probably null	Het
Zfp990	A	C	4: 145,536,869	N146H	probably damaging	Het
Zfyve26	A	G	12: 79,255,243	Y431H	possibly damaging	Het

Other mutations in Barx2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00481:Barx2	APN	9	31846845	missense	unknown
IGL02045:Barx2	APN	9	31858798	missense	probably damaging	1.00
IGL03341:Barx2	APN	9	31858794	missense	probably damaging	1.00
R1401:Barx2	UTSW	9	31859031	missense	probably damaging	1.00
R2436:Barx2	UTSW	9	31913087	missense	probably damaging	0.99
R4543:Barx2	UTSW	9	31846796	missense	unknown
R4804:Barx2	UTSW	9	31846812	missense	unknown
R5399:Barx2	UTSW	9	31854111	critical splice donor site	probably null
R5436:Barx2	UTSW	9	31912989	missense	probably damaging	1.00
R5700:Barx2	UTSW	9	31858765	missense	probably damaging	1.00
R6036:Barx2	UTSW	9	31913008	missense	probably damaging	1.00
R6036:Barx2	UTSW	9	31913008	missense	probably damaging	1.00
R6042:Barx2	UTSW	9	31846903	missense	probably benign	0.35
R6533:Barx2	UTSW	9	31912979	missense	probably damaging	1.00
R6618:Barx2	UTSW	9	31846872	missense	probably benign	0.01
R8242:Barx2	UTSW	9	31912931	missense	probably damaging	1.00
R8307:Barx2	UTSW	9	31859011	missense	probably damaging	1.00
R8507:Barx2	UTSW	9	31859013	missense	probably damaging	1.00
R8722:Barx2	UTSW	9	31912984	missense	probably damaging	1.00
R9089:Barx2	UTSW	9	31854147	missense	probably damaging	1.00
R9470:Barx2	UTSW	9	31858748	nonsense	probably null
R9720:Barx2	UTSW	9	31854111	critical splice donor site	probably null
Z1088:Barx2	UTSW	9	31846866	missense	possibly damaging	0.59

Predicted Primers

PCR Primer
(F):5'- CTCTCAGGTTGGAAAGCAGAGG -3'
(R):5'- GTAGTCAAAGATGCTGCTCGG -3'

Sequencing Primer
(F):5'- CAGAGGCGACCGCACAC -3'
(R):5'- GTGTAGACGCAGCAGGC -3'

Posted On

2014-08-25