Incidental Mutation 'R1982:Alas1'
Institutional Source Beutler Lab
Gene Symbol Alas1
Ensembl Gene ENSMUSG00000032786
Gene Nameaminolevulinic acid synthase 1
Synonymssuccinyl-CoA: glycine C-succinyl transferase, Alas-1, ALAS-N, 5-aminolevulinate synthase
MMRRC Submission 039994-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1982 (G1)
Quality Score225
Status Not validated
Chromosomal Location106233455-106248654 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 106238185 bp
Amino Acid Change Isoleucine to Asparagine at position 48 (I48N)
Ref Sequence ENSEMBL: ENSMUSP00000119968 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074082] [ENSMUST00000112524] [ENSMUST00000133617] [ENSMUST00000141118] [ENSMUST00000143125] [ENSMUST00000214989] [ENSMUST00000219129]
Predicted Effect probably damaging
Transcript: ENSMUST00000074082
AA Change: I408N

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000073725
Gene: ENSMUSG00000032786
AA Change: I408N

Pfam:Preseq_ALAS 1 81 1.1e-21 PFAM
Pfam:Preseq_ALAS 73 141 2.8e-12 PFAM
Pfam:Aminotran_1_2 245 591 2.1e-77 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000112524
AA Change: I409N

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000108143
Gene: ENSMUSG00000032786
AA Change: I409N

Pfam:Preseq_ALAS 2 140 1.3e-49 PFAM
Pfam:Aminotran_1_2 245 592 5.3e-80 PFAM
Pfam:Cys_Met_Meta_PP 283 423 1.5e-6 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123115
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123601
Predicted Effect probably benign
Transcript: ENSMUST00000133617
SMART Domains Protein: ENSMUSP00000122117
Gene: ENSMUSG00000032786

Pfam:Preseq_ALAS 1 79 3.1e-22 PFAM
Pfam:Preseq_ALAS 73 141 8.7e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134053
Predicted Effect probably damaging
Transcript: ENSMUST00000141118
AA Change: I409N

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000117014
Gene: ENSMUSG00000032786
AA Change: I409N

Pfam:Preseq_ALAS 1 81 1.7e-20 PFAM
Pfam:Preseq_ALAS 73 141 4.2e-11 PFAM
Pfam:Aminotran_1_2 245 592 5.3e-80 PFAM
Pfam:Aminotran_5 257 422 3.4e-6 PFAM
Pfam:Cys_Met_Meta_PP 285 423 1.8e-6 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000143125
AA Change: I48N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000119968
Gene: ENSMUSG00000032786
AA Change: I48N

Pfam:Aminotran_5 1 61 7.7e-7 PFAM
Pfam:Aminotran_1_2 1 93 2.2e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214249
Predicted Effect probably benign
Transcript: ENSMUST00000214989
Predicted Effect probably benign
Transcript: ENSMUST00000219129
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219340
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the mitochondrial enzyme which is catalyzes the rate-limiting step in heme (iron-protoporphyrin) biosynthesis. The enzyme encoded by this gene is the housekeeping enzyme; a separate gene encodes a form of the enzyme that is specific for erythroid tissue. The level of the mature encoded protein is regulated by heme: high levels of heme down-regulate the mature enzyme in mitochondria while low heme levels up-regulate. A pseudogene of this gene is located on chromosome 12. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jan 2015]
PHENOTYPE: Mice homozygous for a reporter allele exhibit embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930415L06Rik A T X: 89,931,445 V382E probably damaging Het
Aatk G T 11: 120,013,514 P252Q probably damaging Het
Adamts4 T C 1: 171,258,934 V765A probably benign Het
Agfg2 A T 5: 137,664,253 V184E possibly damaging Het
Anks1 T C 17: 27,985,121 V181A probably damaging Het
Anxa8 A T 14: 34,096,570 R261S probably damaging Het
Aqp4 T C 18: 15,393,551 D291G probably damaging Het
Atrn A G 2: 130,970,222 R696G probably benign Het
Barx2 A C 9: 31,913,012 I27S probably damaging Het
Btnl1 A T 17: 34,379,751 I114L possibly damaging Het
Casq1 C T 1: 172,215,530 A200T probably damaging Het
Ccdc33 T A 9: 58,117,168 E225D probably benign Het
Cd84 C A 1: 171,884,585 probably null Het
Ceacam9 T G 7: 16,725,307 L177R probably benign Het
Cenpi T A X: 134,318,033 F161L possibly damaging Het
Cep63 T C 9: 102,602,880 K251E probably damaging Het
Cetn3 A G 13: 81,784,697 E25G probably damaging Het
Crybg3 T C 16: 59,544,125 D2378G possibly damaging Het
Ddx19b T C 8: 111,009,343 T357A possibly damaging Het
Dpep2 A C 8: 105,989,455 Y266* probably null Het
Dqx1 G A 6: 83,058,577 D24N probably damaging Het
Dsg4 A T 18: 20,471,212 Y912F probably damaging Het
Fam71f2 A G 6: 29,285,922 T69A probably benign Het
Fezf2 G T 14: 12,344,405 P261T probably benign Het
Fmo1 T C 1: 162,839,756 I163M possibly damaging Het
Gatad2a G A 8: 69,913,132 R428* probably null Het
Gfpt1 T A 6: 87,054,630 F85I possibly damaging Het
Gimap7 A T 6: 48,724,241 I254F possibly damaging Het
Glcci1 T C 6: 8,592,980 S261P probably damaging Het
Glis3 A T 19: 28,531,274 F437I probably damaging Het
Glp1r C A 17: 30,925,627 S258* probably null Het
Gm13023 C A 4: 143,795,150 H445Q probably benign Het
Gm7030 T A 17: 36,128,722 D122V probably damaging Het
Gpt2 C T 8: 85,516,203 A288V possibly damaging Het
Grin2c G T 11: 115,260,905 S76R possibly damaging Het
Guf1 T A 5: 69,567,226 Y447* probably null Het
Hectd1 A C 12: 51,785,841 L916V probably damaging Het
Hnf4g A G 3: 3,638,208 K96E probably damaging Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Ifi207 T G 1: 173,735,239 M114L probably benign Het
Ifi35 A T 11: 101,458,286 E252V probably damaging Het
Igsf9b G A 9: 27,322,239 R345H possibly damaging Het
Itih3 T C 14: 30,923,583 probably benign Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Kidins220 A T 12: 25,051,194 M1252L probably benign Het
Kifap3 T A 1: 163,862,022 L525* probably null Het
Limk2 A T 11: 3,355,461 D35E probably benign Het
Lrrc37a G A 11: 103,498,966 P1878S probably benign Het
Mansc4 T A 6: 147,075,675 I148F probably benign Het
Mei1 A G 15: 82,103,312 N859S probably benign Het
Mib1 A G 18: 10,812,064 D987G probably damaging Het
Mroh8 A G 2: 157,271,975 V132A possibly damaging Het
Npnt T C 3: 132,948,132 I29M probably benign Het
Nrap T C 19: 56,384,105 D138G probably damaging Het
Olfr1 A T 11: 73,395,092 I310N probably benign Het
Olfr5 T C 7: 6,480,932 M75V probably benign Het
Olfr512 A G 7: 108,713,695 Y102C probably damaging Het
Olfr91 T A 17: 37,093,808 E22V probably damaging Het
Osbpl5 A C 7: 143,741,671 probably null Het
Pcna-ps2 T C 19: 9,283,683 V102A possibly damaging Het
Pik3c2g T C 6: 139,622,548 S221P probably damaging Het
Plppr3 A G 10: 79,866,425 I271T probably damaging Het
Prkar1b C T 5: 139,127,643 A41T probably benign Het
Prkcsh A G 9: 22,012,868 D458G probably damaging Het
Prr14 G T 7: 127,475,490 R398L possibly damaging Het
Ptafr A G 4: 132,579,985 R229G probably damaging Het
Rbp3 T C 14: 33,954,545 F150S probably damaging Het
Rel C T 11: 23,742,761 G424D probably benign Het
Rlf T C 4: 121,150,112 Y557C probably damaging Het
Samt3 A C X: 86,047,134 M211L probably benign Het
Selenop A T 15: 3,275,694 I111F probably damaging Het
Slc2a2 G A 3: 28,717,441 M173I probably benign Het
Slc43a1 G T 2: 84,856,889 G361V possibly damaging Het
Slit2 G A 5: 48,249,836 V870M probably damaging Het
Ssxb10 A G X: 8,331,019 D77G probably benign Het
Stk32b T A 5: 37,649,114 I29F probably damaging Het
Stra6l T A 4: 45,867,237 C161* probably null Het
Tecpr2 T A 12: 110,954,785 M1264K probably benign Het
Tfap2c A T 2: 172,557,236 I468F probably damaging Het
Ticam1 C T 17: 56,271,555 R180H probably damaging Het
Tlr4 T A 4: 66,841,035 N688K probably benign Het
Tmem35b A T 4: 127,126,053 probably benign Het
Ugt2b34 T C 5: 86,906,313 E203G probably damaging Het
Vegfa A C 17: 46,018,860 *393G probably null Het
Vmn2r16 T C 5: 109,364,024 V699A probably benign Het
Zfp324 T C 7: 12,971,218 S445P probably damaging Het
Zfp982 T A 4: 147,512,592 C135* probably null Het
Zfp990 A C 4: 145,536,869 N146H probably damaging Het
Zfyve26 A G 12: 79,255,243 Y431H possibly damaging Het
Other mutations in Alas1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00911:Alas1 APN 9 106236472 missense probably benign 0.17
IGL02165:Alas1 APN 9 106238783 missense probably damaging 1.00
IGL02355:Alas1 APN 9 106236639 missense probably damaging 1.00
IGL02362:Alas1 APN 9 106236639 missense probably damaging 1.00
IGL02499:Alas1 APN 9 106241321 missense probably damaging 1.00
IGL02606:Alas1 APN 9 106241110 unclassified probably benign
IGL03121:Alas1 APN 9 106246914 missense probably damaging 0.99
R0115:Alas1 UTSW 9 106238252 splice site probably null
R0294:Alas1 UTSW 9 106241256 missense probably damaging 1.00
R0333:Alas1 UTSW 9 106241281 missense probably benign 0.08
R0346:Alas1 UTSW 9 106243351 missense possibly damaging 0.78
R1700:Alas1 UTSW 9 106239646 missense possibly damaging 0.46
R2056:Alas1 UTSW 9 106241290 missense probably damaging 1.00
R2058:Alas1 UTSW 9 106241290 missense probably damaging 1.00
R2059:Alas1 UTSW 9 106241290 missense probably damaging 1.00
R2355:Alas1 UTSW 9 106236474 missense probably damaging 0.96
R2516:Alas1 UTSW 9 106238660 missense probably damaging 1.00
R3896:Alas1 UTSW 9 106241801 splice site probably null
R4091:Alas1 UTSW 9 106241801 splice site probably null
R4093:Alas1 UTSW 9 106241801 splice site probably null
R4095:Alas1 UTSW 9 106241801 splice site probably null
R4673:Alas1 UTSW 9 106236477 missense probably damaging 1.00
R4948:Alas1 UTSW 9 106246878 nonsense probably null
R5165:Alas1 UTSW 9 106241255 missense probably damaging 1.00
R5215:Alas1 UTSW 9 106243375 missense probably benign 0.05
R5420:Alas1 UTSW 9 106234159 missense probably benign 0.13
R5993:Alas1 UTSW 9 106234129 missense probably benign 0.11
R6033:Alas1 UTSW 9 106241204 missense probably damaging 1.00
R6033:Alas1 UTSW 9 106241204 missense probably damaging 1.00
R7489:Alas1 UTSW 9 106241634 critical splice donor site probably null
R7726:Alas1 UTSW 9 106246951 missense probably benign 0.00
R8012:Alas1 UTSW 9 106246763 missense probably benign
R8036:Alas1 UTSW 9 106235522 missense probably benign 0.19
R8353:Alas1 UTSW 9 106236522 missense possibly damaging 0.83
R8453:Alas1 UTSW 9 106236522 missense possibly damaging 0.83
Z1176:Alas1 UTSW 9 106238769 missense probably benign 0.42
Z1176:Alas1 UTSW 9 106243367 missense probably benign 0.00
Predicted Primers PCR Primer

Sequencing Primer
Posted On2014-08-25