Incidental Mutation 'R1982:Rel'
ID 219984
Institutional Source Beutler Lab
Gene Symbol Rel
Ensembl Gene ENSMUSG00000020275
Gene Name reticuloendotheliosis oncogene
Synonyms c-Rel
MMRRC Submission 039994-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R1982 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 23736847-23770970 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 23742761 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glycine to Aspartic acid at position 424 (G424D)
Ref Sequence ENSEMBL: ENSMUSP00000099928 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102864]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000102864
AA Change: G424D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000099928
Gene: ENSMUSG00000020275
AA Change: G424D

Pfam:RHD_DNA_bind 10 178 8.1e-78 PFAM
IPT 185 280 7.64e-24 SMART
low complexity region 512 530 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the Rel homology domain/immunoglobulin-like fold, plexin, transcription factor (RHD/IPT) family. Members of this family regulate genes involved in apoptosis, inflammation, the immune response, and oncogenic processes. This proto-oncogene plays a role in the survival and proliferation of B lymphocytes. Mutation or amplification of this gene is associated with B-cell lymphomas, including Hodgkin's lymphoma. Single nucleotide polymorphisms in this gene are associated with susceptibility to ulcerative colitis and rheumatoid arthritis. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2014]
PHENOTYPE: Homozygous inactivation of this gene causes defects in lymphocyte proliferation, humoral immunity and cytokine production, and may lead to impaired Th1 responses and resistance to autoimmune disease. Mice lacking only the COOH-terminal region show severehemopoietic defects and lymphoid hyperplasia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930415L06Rik A T X: 89,931,445 V382E probably damaging Het
Aatk G T 11: 120,013,514 P252Q probably damaging Het
Adamts4 T C 1: 171,258,934 V765A probably benign Het
Agfg2 A T 5: 137,664,253 V184E possibly damaging Het
Alas1 A T 9: 106,238,185 I48N probably damaging Het
Anks1 T C 17: 27,985,121 V181A probably damaging Het
Anxa8 A T 14: 34,096,570 R261S probably damaging Het
Aqp4 T C 18: 15,393,551 D291G probably damaging Het
Atrn A G 2: 130,970,222 R696G probably benign Het
Barx2 A C 9: 31,913,012 I27S probably damaging Het
Btnl1 A T 17: 34,379,751 I114L possibly damaging Het
Casq1 C T 1: 172,215,530 A200T probably damaging Het
Ccdc33 T A 9: 58,117,168 E225D probably benign Het
Cd84 C A 1: 171,884,585 probably null Het
Ceacam9 T G 7: 16,725,307 L177R probably benign Het
Cenpi T A X: 134,318,033 F161L possibly damaging Het
Cep63 T C 9: 102,602,880 K251E probably damaging Het
Cetn3 A G 13: 81,784,697 E25G probably damaging Het
Crybg3 T C 16: 59,544,125 D2378G possibly damaging Het
Ddx19b T C 8: 111,009,343 T357A possibly damaging Het
Dpep2 A C 8: 105,989,455 Y266* probably null Het
Dqx1 G A 6: 83,058,577 D24N probably damaging Het
Dsg4 A T 18: 20,471,212 Y912F probably damaging Het
Fam71f2 A G 6: 29,285,922 T69A probably benign Het
Fezf2 G T 14: 12,344,405 P261T probably benign Het
Fmo1 T C 1: 162,839,756 I163M possibly damaging Het
Gatad2a G A 8: 69,913,132 R428* probably null Het
Gfpt1 T A 6: 87,054,630 F85I possibly damaging Het
Gimap7 A T 6: 48,724,241 I254F possibly damaging Het
Glcci1 T C 6: 8,592,980 S261P probably damaging Het
Glis3 A T 19: 28,531,274 F437I probably damaging Het
Glp1r C A 17: 30,925,627 S258* probably null Het
Gm13023 C A 4: 143,795,150 H445Q probably benign Het
Gm7030 T A 17: 36,128,722 D122V probably damaging Het
Gpt2 C T 8: 85,516,203 A288V possibly damaging Het
Grin2c G T 11: 115,260,905 S76R possibly damaging Het
Guf1 T A 5: 69,567,226 Y447* probably null Het
Hectd1 A C 12: 51,785,841 L916V probably damaging Het
Hnf4g A G 3: 3,638,208 K96E probably damaging Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Ifi207 T G 1: 173,735,239 M114L probably benign Het
Ifi35 A T 11: 101,458,286 E252V probably damaging Het
Igsf9b G A 9: 27,322,239 R345H possibly damaging Het
Itih3 T C 14: 30,923,583 probably benign Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 74 probably benign Het
Kidins220 A T 12: 25,051,194 M1252L probably benign Het
Kifap3 T A 1: 163,862,022 L525* probably null Het
Limk2 A T 11: 3,355,461 D35E probably benign Het
Lrrc37a G A 11: 103,498,966 P1878S probably benign Het
Mansc4 T A 6: 147,075,675 I148F probably benign Het
Mei1 A G 15: 82,103,312 N859S probably benign Het
Mib1 A G 18: 10,812,064 D987G probably damaging Het
Mroh8 A G 2: 157,271,975 V132A possibly damaging Het
Npnt T C 3: 132,948,132 I29M probably benign Het
Nrap T C 19: 56,384,105 D138G probably damaging Het
Olfr1 A T 11: 73,395,092 I310N probably benign Het
Olfr5 T C 7: 6,480,932 M75V probably benign Het
Olfr512 A G 7: 108,713,695 Y102C probably damaging Het
Olfr91 T A 17: 37,093,808 E22V probably damaging Het
Osbpl5 A C 7: 143,741,671 probably null Het
Pcna-ps2 T C 19: 9,283,683 V102A possibly damaging Het
Pik3c2g T C 6: 139,622,548 S221P probably damaging Het
Plppr3 A G 10: 79,866,425 I271T probably damaging Het
Prkar1b C T 5: 139,127,643 A41T probably benign Het
Prkcsh A G 9: 22,012,868 D458G probably damaging Het
Prr14 G T 7: 127,475,490 R398L possibly damaging Het
Ptafr A G 4: 132,579,985 R229G probably damaging Het
Rbp3 T C 14: 33,954,545 F150S probably damaging Het
Rlf T C 4: 121,150,112 Y557C probably damaging Het
Samt3 A C X: 86,047,134 M211L probably benign Het
Selenop A T 15: 3,275,694 I111F probably damaging Het
Slc2a2 G A 3: 28,717,441 M173I probably benign Het
Slc43a1 G T 2: 84,856,889 G361V possibly damaging Het
Slit2 G A 5: 48,249,836 V870M probably damaging Het
Ssxb10 A G X: 8,331,019 D77G probably benign Het
Stk32b T A 5: 37,649,114 I29F probably damaging Het
Stra6l T A 4: 45,867,237 C161* probably null Het
Tecpr2 T A 12: 110,954,785 M1264K probably benign Het
Tfap2c A T 2: 172,557,236 I468F probably damaging Het
Ticam1 C T 17: 56,271,555 R180H probably damaging Het
Tlr4 T A 4: 66,841,035 N688K probably benign Het
Tmem35b A T 4: 127,126,053 probably benign Het
Ugt2b34 T C 5: 86,906,313 E203G probably damaging Het
Vegfa A C 17: 46,018,860 *393G probably null Het
Vmn2r16 T C 5: 109,364,024 V699A probably benign Het
Zfp324 T C 7: 12,971,218 S445P probably damaging Het
Zfp982 T A 4: 147,512,592 C135* probably null Het
Zfp990 A C 4: 145,536,869 N146H probably damaging Het
Zfyve26 A G 12: 79,255,243 Y431H possibly damaging Het
Other mutations in Rel
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00663:Rel APN 11 23757043 missense probably benign 0.31
IGL00819:Rel APN 11 23743029 missense probably benign 0.13
IGL00906:Rel APN 11 23744266 missense probably benign 0.00
IGL01358:Rel APN 11 23761155 missense probably benign 0.06
IGL01820:Rel APN 11 23753218 missense probably benign 0.22
IGL01889:Rel APN 11 23757035 missense probably damaging 0.96
IGL03270:Rel APN 11 23742584 missense probably benign 0.16
Amun-ra UTSW 11 23757026 nonsense probably null
Fleur UTSW 11 unclassified
giza UTSW 11 23757010 missense probably damaging 1.00
Horus UTSW 11 23753215 critical splice donor site probably null
osirus UTSW 11 23742713 missense probably benign 0.00
Seth UTSW 11 23748855 missense probably damaging 1.00
R0766:Rel UTSW 11 23757010 missense probably damaging 1.00
R0924:Rel UTSW 11 23742439 missense probably benign 0.02
R0930:Rel UTSW 11 23742439 missense probably benign 0.02
R1312:Rel UTSW 11 23757010 missense probably damaging 1.00
R1339:Rel UTSW 11 23745763 missense probably damaging 1.00
R1584:Rel UTSW 11 23745546 missense probably damaging 1.00
R1980:Rel UTSW 11 23742761 missense probably benign
R1981:Rel UTSW 11 23742761 missense probably benign
R2513:Rel UTSW 11 23745823 missense probably damaging 1.00
R2870:Rel UTSW 11 23761129 missense probably benign
R2870:Rel UTSW 11 23761129 missense probably benign
R2871:Rel UTSW 11 23761129 missense probably benign
R2871:Rel UTSW 11 23761129 missense probably benign
R2872:Rel UTSW 11 23761129 missense probably benign
R2872:Rel UTSW 11 23761129 missense probably benign
R3617:Rel UTSW 11 23745780 missense probably damaging 1.00
R3976:Rel UTSW 11 23742939 missense probably benign 0.07
R4010:Rel UTSW 11 23761138 missense probably benign
R4067:Rel UTSW 11 23753215 critical splice donor site probably null
R5345:Rel UTSW 11 23742462 missense probably benign 0.00
R5866:Rel UTSW 11 23742724 nonsense probably null
R6032:Rel UTSW 11 23742684 missense probably benign 0.02
R6032:Rel UTSW 11 23742684 missense probably benign 0.02
R6562:Rel UTSW 11 23757026 nonsense probably null
R6886:Rel UTSW 11 23744304 missense probably benign 0.03
R7516:Rel UTSW 11 23742785 missense probably benign 0.00
R7522:Rel UTSW 11 23770676 splice site probably null
R7663:Rel UTSW 11 23742713 missense probably benign 0.00
R7873:Rel UTSW 11 23742957 missense probably benign 0.00
R7960:Rel UTSW 11 23744493 missense probably damaging 0.98
R8679:Rel UTSW 11 23742430 missense probably benign
R8819:Rel UTSW 11 23745626 missense probably damaging 1.00
R9001:Rel UTSW 11 23748855 missense probably damaging 1.00
R9215:Rel UTSW 11 23748870 missense probably benign 0.00
Z1176:Rel UTSW 11 23745472 missense probably damaging 0.99
Predicted Primers PCR Primer

Sequencing Primer
Posted On 2014-08-25