Mutagenetix > Incidental Mutation

Incidental Mutation 'R1982:Lrrc37a'

219991

Institutional Source

Beutler Lab

Gene Symbol

Lrrc37a

Ensembl Gene

ENSMUSG00000078632

Gene Name

leucine rich repeat containing 37A

Synonyms

LOC237954

MMRRC Submission

039994-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.097) question?

Stock #

R1982 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

103451955-103504597 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 103498966 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Proline to Serine at position 1878 (P1878S)

Ref Sequence

ENSEMBL: ENSMUSP00000121903 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000153273]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000153273
AA Change: P1878S

PolyPhen 2 Score 0.201 (Sensitivity: 0.92; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000121903
Gene: ENSMUSG00000078632
AA Change: P1878S

Domain	Start	End	E-Value	Type
Pfam:LRRC37	199	269	2.6e-15	PFAM
low complexity region	313	329	N/A	INTRINSIC
Pfam:LRRC37	363	432	4e-18	PFAM
low complexity region	457	467	N/A	INTRINSIC
low complexity region	480	492	N/A	INTRINSIC
Pfam:LRRC37	550	619	2.1e-21	PFAM
Pfam:LRRC37	637	704	2.9e-12	PFAM
Pfam:LRRC37	780	851	2.5e-12	PFAM
Pfam:LRRC37	1078	1148	2.7e-18	PFAM
Pfam:LRRC37	1149	1190	2.1e-7	PFAM
Pfam:LRRC37	1187	1258	2.5e-25	PFAM
Pfam:LRRC37	1255	1300	2.6e-7	PFAM
Pfam:LRRC37	1299	1370	2.4e-27	PFAM
Pfam:LRRC37	1369	1420	2.9e-8	PFAM
Pfam:LRRC37	1419	1488	1.3e-24	PFAM
Pfam:LRRC37	1509	1578	9.2e-21	PFAM
Pfam:LRRC37	1575	1620	1.7e-6	PFAM
Pfam:LRRC37	1619	1686	1.7e-20	PFAM
Pfam:LRRC37	1690	1736	7e-10	PFAM
Pfam:LRRC37	1733	1799	7.5e-17	PFAM
Pfam:LRRC37	1789	1854	5.1e-12	PFAM
Pfam:LRRC37	1850	1921	4.2e-21	PFAM
Pfam:LRRC37	1915	1969	1.1e-9	PFAM
low complexity region	2143	2167	N/A	INTRINSIC
low complexity region	2185	2209	N/A	INTRINSIC
low complexity region	2228	2249	N/A	INTRINSIC
low complexity region	2262	2274	N/A	INTRINSIC
low complexity region	2284	2297	N/A	INTRINSIC
LRR	2419	2438	3.09e1	SMART
LRR	2439	2462	9.96e-1	SMART
LRR	2463	2486	8.24e0	SMART
LRR	2490	2514	3.18e1	SMART
low complexity region	2535	2547	N/A	INTRINSIC
coiled coil region	2712	2735	N/A	INTRINSIC
low complexity region	2861	2871	N/A	INTRINSIC
low complexity region	2937	2950	N/A	INTRINSIC
Pfam:LRRC37AB_C	3063	3209	1.1e-77	PFAM

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.5%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 89 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930415L06Rik	A	T	X: 89,931,445	V382E	probably damaging	Het
Aatk	G	T	11: 120,013,514	P252Q	probably damaging	Het
Adamts4	T	C	1: 171,258,934	V765A	probably benign	Het
Agfg2	A	T	5: 137,664,253	V184E	possibly damaging	Het
Alas1	A	T	9: 106,238,185	I48N	probably damaging	Het
Anks1	T	C	17: 27,985,121	V181A	probably damaging	Het
Anxa8	A	T	14: 34,096,570	R261S	probably damaging	Het
Aqp4	T	C	18: 15,393,551	D291G	probably damaging	Het
Atrn	A	G	2: 130,970,222	R696G	probably benign	Het
Barx2	A	C	9: 31,913,012	I27S	probably damaging	Het
Btnl1	A	T	17: 34,379,751	I114L	possibly damaging	Het
Casq1	C	T	1: 172,215,530	A200T	probably damaging	Het
Ccdc33	T	A	9: 58,117,168	E225D	probably benign	Het
Cd84	C	A	1: 171,884,585		probably null	Het
Ceacam9	T	G	7: 16,725,307	L177R	probably benign	Het
Cenpi	T	A	X: 134,318,033	F161L	possibly damaging	Het
Cep63	T	C	9: 102,602,880	K251E	probably damaging	Het
Cetn3	A	G	13: 81,784,697	E25G	probably damaging	Het
Crybg3	T	C	16: 59,544,125	D2378G	possibly damaging	Het
Ddx19b	T	C	8: 111,009,343	T357A	possibly damaging	Het
Dpep2	A	C	8: 105,989,455	Y266*	probably null	Het
Dqx1	G	A	6: 83,058,577	D24N	probably damaging	Het
Dsg4	A	T	18: 20,471,212	Y912F	probably damaging	Het
Fam71f2	A	G	6: 29,285,922	T69A	probably benign	Het
Fezf2	G	T	14: 12,344,405	P261T	probably benign	Het
Fmo1	T	C	1: 162,839,756	I163M	possibly damaging	Het
Gatad2a	G	A	8: 69,913,132	R428*	probably null	Het
Gfpt1	T	A	6: 87,054,630	F85I	possibly damaging	Het
Gimap7	A	T	6: 48,724,241	I254F	possibly damaging	Het
Glcci1	T	C	6: 8,592,980	S261P	probably damaging	Het
Glis3	A	T	19: 28,531,274	F437I	probably damaging	Het
Glp1r	C	A	17: 30,925,627	S258*	probably null	Het
Gm13023	C	A	4: 143,795,150	H445Q	probably benign	Het
Gm7030	T	A	17: 36,128,722	D122V	probably damaging	Het
Gpt2	C	T	8: 85,516,203	A288V	possibly damaging	Het
Grin2c	G	T	11: 115,260,905	S76R	possibly damaging	Het
Guf1	T	A	5: 69,567,226	Y447*	probably null	Het
Hectd1	A	C	12: 51,785,841	L916V	probably damaging	Het
Hnf4g	A	G	3: 3,638,208	K96E	probably damaging	Het
Hsh2d	G	A	8: 72,200,460	D229N	probably benign	Het
Ifi207	T	G	1: 173,735,239	M114L	probably benign	Het
Ifi35	A	T	11: 101,458,286	E252V	probably damaging	Het
Igsf9b	G	A	9: 27,322,239	R345H	possibly damaging	Het
Itih3	T	C	14: 30,923,583		probably benign	Het
Kcnh8	GAGACCAACGAGCAGCTGATGCTTCAGA	GAGA	17: 52,725,906	74	probably benign	Het
Kidins220	A	T	12: 25,051,194	M1252L	probably benign	Het
Kifap3	T	A	1: 163,862,022	L525*	probably null	Het
Limk2	A	T	11: 3,355,461	D35E	probably benign	Het
Mansc4	T	A	6: 147,075,675	I148F	probably benign	Het
Mei1	A	G	15: 82,103,312	N859S	probably benign	Het
Mib1	A	G	18: 10,812,064	D987G	probably damaging	Het
Mroh8	A	G	2: 157,271,975	V132A	possibly damaging	Het
Npnt	T	C	3: 132,948,132	I29M	probably benign	Het
Nrap	T	C	19: 56,384,105	D138G	probably damaging	Het
Olfr1	A	T	11: 73,395,092	I310N	probably benign	Het
Olfr5	T	C	7: 6,480,932	M75V	probably benign	Het
Olfr512	A	G	7: 108,713,695	Y102C	probably damaging	Het
Olfr91	T	A	17: 37,093,808	E22V	probably damaging	Het
Osbpl5	A	C	7: 143,741,671		probably null	Het
Pcna-ps2	T	C	19: 9,283,683	V102A	possibly damaging	Het
Pik3c2g	T	C	6: 139,622,548	S221P	probably damaging	Het
Plppr3	A	G	10: 79,866,425	I271T	probably damaging	Het
Prkar1b	C	T	5: 139,127,643	A41T	probably benign	Het
Prkcsh	A	G	9: 22,012,868	D458G	probably damaging	Het
Prr14	G	T	7: 127,475,490	R398L	possibly damaging	Het
Ptafr	A	G	4: 132,579,985	R229G	probably damaging	Het
Rbp3	T	C	14: 33,954,545	F150S	probably damaging	Het
Rel	C	T	11: 23,742,761	G424D	probably benign	Het
Rlf	T	C	4: 121,150,112	Y557C	probably damaging	Het
Samt3	A	C	X: 86,047,134	M211L	probably benign	Het
Selenop	A	T	15: 3,275,694	I111F	probably damaging	Het
Slc2a2	G	A	3: 28,717,441	M173I	probably benign	Het
Slc43a1	G	T	2: 84,856,889	G361V	possibly damaging	Het
Slit2	G	A	5: 48,249,836	V870M	probably damaging	Het
Ssxb10	A	G	X: 8,331,019	D77G	probably benign	Het
Stk32b	T	A	5: 37,649,114	I29F	probably damaging	Het
Stra6l	T	A	4: 45,867,237	C161*	probably null	Het
Tecpr2	T	A	12: 110,954,785	M1264K	probably benign	Het
Tfap2c	A	T	2: 172,557,236	I468F	probably damaging	Het
Ticam1	C	T	17: 56,271,555	R180H	probably damaging	Het
Tlr4	T	A	4: 66,841,035	N688K	probably benign	Het
Tmem35b	A	T	4: 127,126,053		probably benign	Het
Ugt2b34	T	C	5: 86,906,313	E203G	probably damaging	Het
Vegfa	A	C	17: 46,018,860	*393G	probably null	Het
Vmn2r16	T	C	5: 109,364,024	V699A	probably benign	Het
Zfp324	T	C	7: 12,971,218	S445P	probably damaging	Het
Zfp982	T	A	4: 147,512,592	C135*	probably null	Het
Zfp990	A	C	4: 145,536,869	N146H	probably damaging	Het
Zfyve26	A	G	12: 79,255,243	Y431H	possibly damaging	Het

Other mutations in Lrrc37a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00518:Lrrc37a	APN	11	103500351	missense	probably benign	0.09
IGL01339:Lrrc37a	APN	11	103497937	missense	unknown
IGL01352:Lrrc37a	APN	11	103499355	missense	probably benign	0.39
IGL01382:Lrrc37a	APN	11	103498755	missense	probably damaging	0.99
IGL01395:Lrrc37a	APN	11	103503861	missense	probably benign	0.24
IGL01645:Lrrc37a	APN	11	103504264	missense	probably benign	0.01
IGL01925:Lrrc37a	APN	11	103498419	missense	probably benign	0.01
IGL02006:Lrrc37a	APN	11	103456491	missense	probably damaging	1.00
IGL02127:Lrrc37a	APN	11	103504539	missense	probably benign	0.01
IGL02184:Lrrc37a	APN	11	103497609	missense	unknown
IGL02218:Lrrc37a	APN	11	103500381	missense	probably benign	0.03
IGL02436:Lrrc37a	APN	11	103498177	missense	unknown
IGL02487:Lrrc37a	APN	11	103496037	missense	unknown
IGL02597:Lrrc37a	APN	11	103504287	missense	probably benign	0.01
IGL02634:Lrrc37a	APN	11	103499112	missense	probably benign	0.09
IGL02818:Lrrc37a	APN	11	103501306	missense	possibly damaging	0.47
IGL02829:Lrrc37a	APN	11	103491174	missense	unknown
IGL02987:Lrrc37a	APN	11	103500413	missense	probably benign	0.03
IGL03081:Lrrc37a	APN	11	103456595	missense	unknown
IGL03210:Lrrc37a	APN	11	103499505	missense	probably benign	0.29
IGL03239:Lrrc37a	APN	11	103499407	missense	probably benign	0.03
IGL03285:Lrrc37a	APN	11	103497673	missense	unknown
IGL03296:Lrrc37a	APN	11	103497673	missense	unknown
IGL03299:Lrrc37a	APN	11	103497673	missense	unknown
IGL03370:Lrrc37a	APN	11	103497673	missense	unknown
IGL03390:Lrrc37a	APN	11	103496031	missense	unknown
Lark	UTSW	11	103464354	critical splice donor site	probably null
Longspur	UTSW	11	103502314	missense	probably benign	0.42
F5770:Lrrc37a	UTSW	11	103455512	missense	possibly damaging	0.95
P0035:Lrrc37a	UTSW	11	103503132	missense	possibly damaging	0.84
PIT4458001:Lrrc37a	UTSW	11	103504512	missense	probably benign	0.04
R0112:Lrrc37a	UTSW	11	103500913	missense	probably benign	0.19
R0194:Lrrc37a	UTSW	11	103499790	missense	possibly damaging	0.82
R0360:Lrrc37a	UTSW	11	103500640	missense	possibly damaging	0.89
R0364:Lrrc37a	UTSW	11	103500640	missense	possibly damaging	0.89
R0395:Lrrc37a	UTSW	11	103464395	missense	unknown
R0418:Lrrc37a	UTSW	11	103503438	missense	probably benign	0.03
R0505:Lrrc37a	UTSW	11	103503025	missense	probably benign	0.10
R0583:Lrrc37a	UTSW	11	103498437	missense	probably benign	0.01
R1078:Lrrc37a	UTSW	11	103497631	missense	unknown
R1581:Lrrc37a	UTSW	11	103457017	nonsense	probably null
R1888:Lrrc37a	UTSW	11	103498761	missense	probably benign	0.18
R1888:Lrrc37a	UTSW	11	103498761	missense	probably benign	0.18
R1907:Lrrc37a	UTSW	11	103457156	missense	unknown
R1991:Lrrc37a	UTSW	11	103500261	missense	probably benign	0.29
R2017:Lrrc37a	UTSW	11	103501125	missense	probably benign	0.03
R2103:Lrrc37a	UTSW	11	103500261	missense	probably benign	0.29
R2110:Lrrc37a	UTSW	11	103497822	missense	unknown
R2190:Lrrc37a	UTSW	11	103500043	missense	possibly damaging	0.82
R2252:Lrrc37a	UTSW	11	103501467	missense	probably benign	0.01
R2253:Lrrc37a	UTSW	11	103501467	missense	probably benign	0.01
R2894:Lrrc37a	UTSW	11	103497864	missense	unknown
R2899:Lrrc37a	UTSW	11	103497864	missense	unknown
R3439:Lrrc37a	UTSW	11	103497864	missense	unknown
R3899:Lrrc37a	UTSW	11	103497546	missense	unknown
R3916:Lrrc37a	UTSW	11	103455518	missense	possibly damaging	0.83
R3921:Lrrc37a	UTSW	11	103501470	missense	probably benign	0.10
R3977:Lrrc37a	UTSW	11	103457604	missense	unknown
R4043:Lrrc37a	UTSW	11	103498653	missense	possibly damaging	0.95
R4077:Lrrc37a	UTSW	11	103497982	missense	unknown
R4237:Lrrc37a	UTSW	11	103502289	missense	probably damaging	0.97
R4461:Lrrc37a	UTSW	11	103464354	critical splice donor site	probably null
R4498:Lrrc37a	UTSW	11	103501798	missense	probably benign	0.20
R4593:Lrrc37a	UTSW	11	103498969	missense	possibly damaging	0.64
R4670:Lrrc37a	UTSW	11	103504537	missense	probably benign	0.10
R4698:Lrrc37a	UTSW	11	103504104	missense	possibly damaging	0.83
R4750:Lrrc37a	UTSW	11	103455480	missense	probably benign	0.24
R4805:Lrrc37a	UTSW	11	103504309	missense	probably benign	0.01
R4940:Lrrc37a	UTSW	11	103497612	missense	unknown
R4983:Lrrc37a	UTSW	11	103497618	missense	unknown
R4989:Lrrc37a	UTSW	11	103456739	missense	unknown
R5046:Lrrc37a	UTSW	11	103498240	missense	unknown
R5217:Lrrc37a	UTSW	11	103456954	missense	unknown
R5300:Lrrc37a	UTSW	11	103456958	missense	unknown
R5509:Lrrc37a	UTSW	11	103500535	missense	probably benign	0.23
R5550:Lrrc37a	UTSW	11	103498177	missense	unknown
R5655:Lrrc37a	UTSW	11	103498555	missense	probably benign	0.28
R5668:Lrrc37a	UTSW	11	103500175	missense	probably benign	0.03
R5750:Lrrc37a	UTSW	11	103458097	missense	unknown
R5815:Lrrc37a	UTSW	11	103503786	missense	probably benign	0.01
R5976:Lrrc37a	UTSW	11	103499071	missense	possibly damaging	0.73
R5990:Lrrc37a	UTSW	11	103500958	missense	probably benign	0.19
R6004:Lrrc37a	UTSW	11	103502536	missense	possibly damaging	0.56
R6019:Lrrc37a	UTSW	11	103456596	missense	unknown
R6056:Lrrc37a	UTSW	11	103497658	missense	unknown
R6125:Lrrc37a	UTSW	11	103501560	missense	probably benign	0.19
R6190:Lrrc37a	UTSW	11	103501216	missense	possibly damaging	0.67
R6295:Lrrc37a	UTSW	11	103497633	missense	unknown
R6320:Lrrc37a	UTSW	11	103504051	missense	probably benign	0.10
R6354:Lrrc37a	UTSW	11	103464387	missense	unknown
R6375:Lrrc37a	UTSW	11	103501089	missense	probably benign	0.19
R6406:Lrrc37a	UTSW	11	103497535	missense	unknown
R6468:Lrrc37a	UTSW	11	103460840	missense	unknown
R6490:Lrrc37a	UTSW	11	103456660	missense	unknown
R6502:Lrrc37a	UTSW	11	103492179	missense	unknown
R6509:Lrrc37a	UTSW	11	103504414	missense	probably benign	0.04
R6749:Lrrc37a	UTSW	11	103502097	missense	probably benign	0.29
R6768:Lrrc37a	UTSW	11	103500123	missense	probably benign	0.36
R6912:Lrrc37a	UTSW	11	103457543	missense	unknown
R7081:Lrrc37a	UTSW	11	103457955	missense	unknown
R7083:Lrrc37a	UTSW	11	103503340	missense	probably benign	0.03
R7154:Lrrc37a	UTSW	11	103502856	missense	probably benign	0.03
R7195:Lrrc37a	UTSW	11	103457775	missense	unknown
R7265:Lrrc37a	UTSW	11	103498941	missense	probably benign	0.09
R7276:Lrrc37a	UTSW	11	103456746	missense	unknown
R7362:Lrrc37a	UTSW	11	103457509	missense	unknown
R7450:Lrrc37a	UTSW	11	103498326	missense	probably benign	0.01
R7458:Lrrc37a	UTSW	11	103497432	missense	unknown
R7487:Lrrc37a	UTSW	11	103498219	missense	unknown
R7535:Lrrc37a	UTSW	11	103501857	missense	possibly damaging	0.68
R7593:Lrrc37a	UTSW	11	103500952	missense	probably benign	0.03
R7677:Lrrc37a	UTSW	11	103499638	missense	probably benign	0.26
R7686:Lrrc37a	UTSW	11	103498236	missense	unknown
R7694:Lrrc37a	UTSW	11	103504378	missense	probably benign	0.12
R7696:Lrrc37a	UTSW	11	103498437	missense	probably benign	0.01
R7717:Lrrc37a	UTSW	11	103504300	missense	probably benign	0.01
R7736:Lrrc37a	UTSW	11	103497459	missense	unknown
R7841:Lrrc37a	UTSW	11	103501105	missense	probably benign	0.03
R7885:Lrrc37a	UTSW	11	103503042	missense	probably benign	0.01
R7888:Lrrc37a	UTSW	11	103501481	missense	probably benign	0.19
R7993:Lrrc37a	UTSW	11	103457961	missense	unknown
R8051:Lrrc37a	UTSW	11	103503126	missense	possibly damaging	0.48
R8082:Lrrc37a	UTSW	11	103457422	missense	unknown
R8097:Lrrc37a	UTSW	11	103504099	missense	probably benign	0.04
R8108:Lrrc37a	UTSW	11	103503057	missense	probably benign	0.24
R8269:Lrrc37a	UTSW	11	103497898	missense	unknown
R8311:Lrrc37a	UTSW	11	103503421	missense	probably benign	0.05
R8403:Lrrc37a	UTSW	11	103501585	missense	probably benign	0.10
R8408:Lrrc37a	UTSW	11	103460809	missense	unknown
R8529:Lrrc37a	UTSW	11	103457547	missense	unknown
R8711:Lrrc37a	UTSW	11	103497524	nonsense	probably null
R8757:Lrrc37a	UTSW	11	103457940	missense	unknown
R8759:Lrrc37a	UTSW	11	103457940	missense	unknown
R8769:Lrrc37a	UTSW	11	103498710	missense	probably benign	0.10
R8785:Lrrc37a	UTSW	11	103456416	missense	probably damaging	1.00
R8837:Lrrc37a	UTSW	11	103503969	missense	probably benign	0.43
R8850:Lrrc37a	UTSW	11	103502655	missense
R8871:Lrrc37a	UTSW	11	103456549	missense	unknown
R8894:Lrrc37a	UTSW	11	103456623	missense	unknown
R8971:Lrrc37a	UTSW	11	103500664	missense	probably benign	0.19
R8979:Lrrc37a	UTSW	11	103503007	missense	possibly damaging	0.48
R9012:Lrrc37a	UTSW	11	103499152	missense	probably benign	0.05
R9047:Lrrc37a	UTSW	11	103500549	missense	probably damaging	0.97
R9167:Lrrc37a	UTSW	11	103456832	missense	unknown
R9171:Lrrc37a	UTSW	11	103502314	missense	probably benign	0.42
R9194:Lrrc37a	UTSW	11	103500850	missense	probably benign	0.03
R9258:Lrrc37a	UTSW	11	103502196	missense	probably benign	0.20
R9282:Lrrc37a	UTSW	11	103500807	missense	probably benign	0.03
R9294:Lrrc37a	UTSW	11	103504533	missense	probably benign	0.10
R9349:Lrrc37a	UTSW	11	103497628	missense	unknown
R9560:Lrrc37a	UTSW	11	103456594	missense	unknown
R9595:Lrrc37a	UTSW	11	103501726	missense	probably benign	0.01
R9628:Lrrc37a	UTSW	11	103503504	missense	probably benign	0.03
V7580:Lrrc37a	UTSW	11	103455512	missense	possibly damaging	0.95
X0018:Lrrc37a	UTSW	11	103499544	missense	possibly damaging	0.78
Z1176:Lrrc37a	UTSW	11	103456486	missense	probably damaging	1.00
Z1176:Lrrc37a	UTSW	11	103499034	missense	possibly damaging	0.68
Z1176:Lrrc37a	UTSW	11	103501094	missense	probably benign	0.09
Z1177:Lrrc37a	UTSW	11	103499967	missense	possibly damaging	0.46
Z1177:Lrrc37a	UTSW	11	103500520	missense	probably benign	0.43
Z1177:Lrrc37a	UTSW	11	103500598	missense	probably benign	0.20
Z1177:Lrrc37a	UTSW	11	103503027	missense	probably benign	0.20

Predicted Primers

PCR Primer
(F):5'- TGGGGCTTGGAATTACCGTAAG -3'
(R):5'- GGTTCACACTCAGCATCCAC -3'

Sequencing Primer
(F):5'- GCTTGGAATTACCGTAAGTTCTAG -3'
(R):5'- CTCAGCATCCACACCCAAG -3'

Posted On

2014-08-25