Incidental Mutation 'R1982:Lrrc37a'
ID 219991
Institutional Source Beutler Lab
Gene Symbol Lrrc37a
Ensembl Gene ENSMUSG00000078632
Gene Name leucine rich repeat containing 37A
Synonyms LOC237954
MMRRC Submission 039994-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.099) question?
Stock # R1982 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 103341535-103395423 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 103389792 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Proline to Serine at position 1878 (P1878S)
Ref Sequence ENSEMBL: ENSMUSP00000121903 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000153273]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000153273
AA Change: P1878S

PolyPhen 2 Score 0.201 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000121903
Gene: ENSMUSG00000078632
AA Change: P1878S

DomainStartEndE-ValueType
Pfam:LRRC37 199 269 2.6e-15 PFAM
low complexity region 313 329 N/A INTRINSIC
Pfam:LRRC37 363 432 4e-18 PFAM
low complexity region 457 467 N/A INTRINSIC
low complexity region 480 492 N/A INTRINSIC
Pfam:LRRC37 550 619 2.1e-21 PFAM
Pfam:LRRC37 637 704 2.9e-12 PFAM
Pfam:LRRC37 780 851 2.5e-12 PFAM
Pfam:LRRC37 1078 1148 2.7e-18 PFAM
Pfam:LRRC37 1149 1190 2.1e-7 PFAM
Pfam:LRRC37 1187 1258 2.5e-25 PFAM
Pfam:LRRC37 1255 1300 2.6e-7 PFAM
Pfam:LRRC37 1299 1370 2.4e-27 PFAM
Pfam:LRRC37 1369 1420 2.9e-8 PFAM
Pfam:LRRC37 1419 1488 1.3e-24 PFAM
Pfam:LRRC37 1509 1578 9.2e-21 PFAM
Pfam:LRRC37 1575 1620 1.7e-6 PFAM
Pfam:LRRC37 1619 1686 1.7e-20 PFAM
Pfam:LRRC37 1690 1736 7e-10 PFAM
Pfam:LRRC37 1733 1799 7.5e-17 PFAM
Pfam:LRRC37 1789 1854 5.1e-12 PFAM
Pfam:LRRC37 1850 1921 4.2e-21 PFAM
Pfam:LRRC37 1915 1969 1.1e-9 PFAM
low complexity region 2143 2167 N/A INTRINSIC
low complexity region 2185 2209 N/A INTRINSIC
low complexity region 2228 2249 N/A INTRINSIC
low complexity region 2262 2274 N/A INTRINSIC
low complexity region 2284 2297 N/A INTRINSIC
LRR 2419 2438 3.09e1 SMART
LRR 2439 2462 9.96e-1 SMART
LRR 2463 2486 8.24e0 SMART
LRR 2490 2514 3.18e1 SMART
low complexity region 2535 2547 N/A INTRINSIC
coiled coil region 2712 2735 N/A INTRINSIC
low complexity region 2861 2871 N/A INTRINSIC
low complexity region 2937 2950 N/A INTRINSIC
Pfam:LRRC37AB_C 3063 3209 1.1e-77 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk G T 11: 119,904,340 (GRCm39) P252Q probably damaging Het
Adamts4 T C 1: 171,086,503 (GRCm39) V765A probably benign Het
Agfg2 A T 5: 137,662,515 (GRCm39) V184E possibly damaging Het
Alas1 A T 9: 106,115,384 (GRCm39) I48N probably damaging Het
Anks1 T C 17: 28,204,095 (GRCm39) V181A probably damaging Het
Anxa8 A T 14: 33,818,527 (GRCm39) R261S probably damaging Het
Aqp4 T C 18: 15,526,608 (GRCm39) D291G probably damaging Het
Atrn A G 2: 130,812,142 (GRCm39) R696G probably benign Het
Barx2 A C 9: 31,824,308 (GRCm39) I27S probably damaging Het
Btnl1 A T 17: 34,598,725 (GRCm39) I114L possibly damaging Het
Casq1 C T 1: 172,043,097 (GRCm39) A200T probably damaging Het
Ccdc33 T A 9: 58,024,451 (GRCm39) E225D probably benign Het
Cd84 C A 1: 171,712,152 (GRCm39) probably null Het
Ceacam9 T G 7: 16,459,232 (GRCm39) L177R probably benign Het
Cenpi T A X: 133,218,782 (GRCm39) F161L possibly damaging Het
Cep63 T C 9: 102,480,079 (GRCm39) K251E probably damaging Het
Cetn3 A G 13: 81,932,816 (GRCm39) E25G probably damaging Het
Crybg3 T C 16: 59,364,488 (GRCm39) D2378G possibly damaging Het
Ddx19b T C 8: 111,735,975 (GRCm39) T357A possibly damaging Het
Dpep2 A C 8: 106,716,087 (GRCm39) Y266* probably null Het
Dqx1 G A 6: 83,035,558 (GRCm39) D24N probably damaging Het
Dsg4 A T 18: 20,604,269 (GRCm39) Y912F probably damaging Het
Fezf2 G T 14: 12,344,405 (GRCm38) P261T probably benign Het
Fmo1 T C 1: 162,667,325 (GRCm39) I163M possibly damaging Het
Garin1a A G 6: 29,285,921 (GRCm39) T69A probably benign Het
Gatad2a G A 8: 70,365,782 (GRCm39) R428* probably null Het
Gfpt1 T A 6: 87,031,612 (GRCm39) F85I possibly damaging Het
Gimap7 A T 6: 48,701,175 (GRCm39) I254F possibly damaging Het
Glcci1 T C 6: 8,592,980 (GRCm39) S261P probably damaging Het
Glis3 A T 19: 28,508,674 (GRCm39) F437I probably damaging Het
Glp1r C A 17: 31,144,601 (GRCm39) S258* probably null Het
Gpt2 C T 8: 86,242,832 (GRCm39) A288V possibly damaging Het
Grin2c G T 11: 115,151,731 (GRCm39) S76R possibly damaging Het
Guf1 T A 5: 69,724,569 (GRCm39) Y447* probably null Het
H2-T9 T A 17: 36,439,614 (GRCm39) D122V probably damaging Het
Hectd1 A C 12: 51,832,624 (GRCm39) L916V probably damaging Het
Hnf4g A G 3: 3,703,268 (GRCm39) K96E probably damaging Het
Hsh2d G A 8: 72,954,304 (GRCm39) D229N probably benign Het
Ifi207 T G 1: 173,562,805 (GRCm39) M114L probably benign Het
Ifi35 A T 11: 101,349,112 (GRCm39) E252V probably damaging Het
Igsf9b G A 9: 27,233,535 (GRCm39) R345H possibly damaging Het
Itih3 T C 14: 30,645,540 (GRCm39) probably benign Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 53,032,934 (GRCm39) 74 probably benign Het
Kidins220 A T 12: 25,101,193 (GRCm39) M1252L probably benign Het
Kifap3 T A 1: 163,689,591 (GRCm39) L525* probably null Het
Limk2 A T 11: 3,305,461 (GRCm39) D35E probably benign Het
Mansc4 T A 6: 146,977,173 (GRCm39) I148F probably benign Het
Mei1 A G 15: 81,987,513 (GRCm39) N859S probably benign Het
Mib1 A G 18: 10,812,064 (GRCm39) D987G probably damaging Het
Mroh8 A G 2: 157,113,895 (GRCm39) V132A possibly damaging Het
Npnt T C 3: 132,653,893 (GRCm39) I29M probably benign Het
Nrap T C 19: 56,372,537 (GRCm39) D138G probably damaging Het
Or10a3m A G 7: 108,312,902 (GRCm39) Y102C probably damaging Het
Or1e16 A T 11: 73,285,918 (GRCm39) I310N probably benign Het
Or2h1 T A 17: 37,404,700 (GRCm39) E22V probably damaging Het
Or6z7 T C 7: 6,483,931 (GRCm39) M75V probably benign Het
Osbpl5 A C 7: 143,295,408 (GRCm39) probably null Het
Pcna-ps2 T C 19: 9,261,047 (GRCm39) V102A possibly damaging Het
Pik3c2g T C 6: 139,599,546 (GRCm39) S221P probably damaging Het
Plppr3 A G 10: 79,702,259 (GRCm39) I271T probably damaging Het
Ppp4r3c1 A T X: 88,975,051 (GRCm39) V382E probably damaging Het
Pramel25 C A 4: 143,521,720 (GRCm39) H445Q probably benign Het
Prkar1b C T 5: 139,113,398 (GRCm39) A41T probably benign Het
Prkcsh A G 9: 21,924,164 (GRCm39) D458G probably damaging Het
Prr14 G T 7: 127,074,662 (GRCm39) R398L possibly damaging Het
Ptafr A G 4: 132,307,296 (GRCm39) R229G probably damaging Het
Rbp3 T C 14: 33,676,502 (GRCm39) F150S probably damaging Het
Rel C T 11: 23,692,761 (GRCm39) G424D probably benign Het
Rlf T C 4: 121,007,309 (GRCm39) Y557C probably damaging Het
Samt3 A C X: 85,090,740 (GRCm39) M211L probably benign Het
Selenop A T 15: 3,305,176 (GRCm39) I111F probably damaging Het
Slc2a2 G A 3: 28,771,590 (GRCm39) M173I probably benign Het
Slc43a1 G T 2: 84,687,233 (GRCm39) G361V possibly damaging Het
Slit2 G A 5: 48,407,178 (GRCm39) V870M probably damaging Het
Ssxb10 A G X: 8,197,258 (GRCm39) D77G probably benign Het
Stk32b T A 5: 37,806,458 (GRCm39) I29F probably damaging Het
Stra6l T A 4: 45,867,237 (GRCm39) C161* probably null Het
Tecpr2 T A 12: 110,921,219 (GRCm39) M1264K probably benign Het
Tfap2c A T 2: 172,399,156 (GRCm39) I468F probably damaging Het
Ticam1 C T 17: 56,578,555 (GRCm39) R180H probably damaging Het
Tlr4 T A 4: 66,759,272 (GRCm39) N688K probably benign Het
Tmem35b A T 4: 127,019,846 (GRCm39) probably benign Het
Ugt2b34 T C 5: 87,054,172 (GRCm39) E203G probably damaging Het
Vegfa A C 17: 46,329,786 (GRCm39) *393G probably null Het
Vmn2r16 T C 5: 109,511,890 (GRCm39) V699A probably benign Het
Zfp324 T C 7: 12,705,145 (GRCm39) S445P probably damaging Het
Zfp982 T A 4: 147,597,049 (GRCm39) C135* probably null Het
Zfp990 A C 4: 145,263,439 (GRCm39) N146H probably damaging Het
Zfyve26 A G 12: 79,302,017 (GRCm39) Y431H possibly damaging Het
Other mutations in Lrrc37a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00518:Lrrc37a APN 11 103,391,177 (GRCm39) missense probably benign 0.09
IGL01339:Lrrc37a APN 11 103,388,763 (GRCm39) missense unknown
IGL01352:Lrrc37a APN 11 103,390,181 (GRCm39) missense probably benign 0.39
IGL01382:Lrrc37a APN 11 103,389,581 (GRCm39) missense probably damaging 0.99
IGL01395:Lrrc37a APN 11 103,394,687 (GRCm39) missense probably benign 0.24
IGL01645:Lrrc37a APN 11 103,395,090 (GRCm39) missense probably benign 0.01
IGL01925:Lrrc37a APN 11 103,389,245 (GRCm39) missense probably benign 0.01
IGL02006:Lrrc37a APN 11 103,347,317 (GRCm39) missense probably damaging 1.00
IGL02127:Lrrc37a APN 11 103,395,365 (GRCm39) missense probably benign 0.01
IGL02184:Lrrc37a APN 11 103,388,435 (GRCm39) missense unknown
IGL02218:Lrrc37a APN 11 103,391,207 (GRCm39) missense probably benign 0.03
IGL02436:Lrrc37a APN 11 103,389,003 (GRCm39) missense unknown
IGL02487:Lrrc37a APN 11 103,386,863 (GRCm39) missense unknown
IGL02597:Lrrc37a APN 11 103,395,113 (GRCm39) missense probably benign 0.01
IGL02634:Lrrc37a APN 11 103,389,938 (GRCm39) missense probably benign 0.09
IGL02818:Lrrc37a APN 11 103,392,132 (GRCm39) missense possibly damaging 0.47
IGL02829:Lrrc37a APN 11 103,382,000 (GRCm39) missense unknown
IGL02987:Lrrc37a APN 11 103,391,239 (GRCm39) missense probably benign 0.03
IGL03081:Lrrc37a APN 11 103,347,421 (GRCm39) missense unknown
IGL03210:Lrrc37a APN 11 103,390,331 (GRCm39) missense probably benign 0.29
IGL03239:Lrrc37a APN 11 103,390,233 (GRCm39) missense probably benign 0.03
IGL03285:Lrrc37a APN 11 103,388,499 (GRCm39) missense unknown
IGL03296:Lrrc37a APN 11 103,388,499 (GRCm39) missense unknown
IGL03299:Lrrc37a APN 11 103,388,499 (GRCm39) missense unknown
IGL03370:Lrrc37a APN 11 103,388,499 (GRCm39) missense unknown
IGL03390:Lrrc37a APN 11 103,386,857 (GRCm39) missense unknown
Lark UTSW 11 103,355,180 (GRCm39) critical splice donor site probably null
Longspur UTSW 11 103,393,140 (GRCm39) missense probably benign 0.42
F5770:Lrrc37a UTSW 11 103,346,338 (GRCm39) missense possibly damaging 0.95
P0035:Lrrc37a UTSW 11 103,393,958 (GRCm39) missense possibly damaging 0.84
PIT4458001:Lrrc37a UTSW 11 103,395,338 (GRCm39) missense probably benign 0.04
R0112:Lrrc37a UTSW 11 103,391,739 (GRCm39) missense probably benign 0.19
R0194:Lrrc37a UTSW 11 103,390,616 (GRCm39) missense possibly damaging 0.82
R0360:Lrrc37a UTSW 11 103,391,466 (GRCm39) missense possibly damaging 0.89
R0364:Lrrc37a UTSW 11 103,391,466 (GRCm39) missense possibly damaging 0.89
R0395:Lrrc37a UTSW 11 103,355,221 (GRCm39) missense unknown
R0418:Lrrc37a UTSW 11 103,394,264 (GRCm39) missense probably benign 0.03
R0505:Lrrc37a UTSW 11 103,393,851 (GRCm39) missense probably benign 0.10
R0583:Lrrc37a UTSW 11 103,389,263 (GRCm39) missense probably benign 0.01
R1078:Lrrc37a UTSW 11 103,388,457 (GRCm39) missense unknown
R1581:Lrrc37a UTSW 11 103,347,843 (GRCm39) nonsense probably null
R1888:Lrrc37a UTSW 11 103,389,587 (GRCm39) missense probably benign 0.18
R1888:Lrrc37a UTSW 11 103,389,587 (GRCm39) missense probably benign 0.18
R1907:Lrrc37a UTSW 11 103,347,982 (GRCm39) missense unknown
R1991:Lrrc37a UTSW 11 103,391,087 (GRCm39) missense probably benign 0.29
R2017:Lrrc37a UTSW 11 103,391,951 (GRCm39) missense probably benign 0.03
R2103:Lrrc37a UTSW 11 103,391,087 (GRCm39) missense probably benign 0.29
R2110:Lrrc37a UTSW 11 103,388,648 (GRCm39) missense unknown
R2190:Lrrc37a UTSW 11 103,390,869 (GRCm39) missense possibly damaging 0.82
R2252:Lrrc37a UTSW 11 103,392,293 (GRCm39) missense probably benign 0.01
R2253:Lrrc37a UTSW 11 103,392,293 (GRCm39) missense probably benign 0.01
R2894:Lrrc37a UTSW 11 103,388,690 (GRCm39) missense unknown
R2899:Lrrc37a UTSW 11 103,388,690 (GRCm39) missense unknown
R3439:Lrrc37a UTSW 11 103,388,690 (GRCm39) missense unknown
R3899:Lrrc37a UTSW 11 103,388,372 (GRCm39) missense unknown
R3916:Lrrc37a UTSW 11 103,346,344 (GRCm39) missense possibly damaging 0.83
R3921:Lrrc37a UTSW 11 103,392,296 (GRCm39) missense probably benign 0.10
R3977:Lrrc37a UTSW 11 103,348,430 (GRCm39) missense unknown
R4043:Lrrc37a UTSW 11 103,389,479 (GRCm39) missense possibly damaging 0.95
R4077:Lrrc37a UTSW 11 103,388,808 (GRCm39) missense unknown
R4237:Lrrc37a UTSW 11 103,393,115 (GRCm39) missense probably damaging 0.97
R4461:Lrrc37a UTSW 11 103,355,180 (GRCm39) critical splice donor site probably null
R4498:Lrrc37a UTSW 11 103,392,624 (GRCm39) missense probably benign 0.20
R4593:Lrrc37a UTSW 11 103,389,795 (GRCm39) missense possibly damaging 0.64
R4670:Lrrc37a UTSW 11 103,395,363 (GRCm39) missense probably benign 0.10
R4698:Lrrc37a UTSW 11 103,394,930 (GRCm39) missense possibly damaging 0.83
R4750:Lrrc37a UTSW 11 103,346,306 (GRCm39) missense probably benign 0.24
R4805:Lrrc37a UTSW 11 103,395,135 (GRCm39) missense probably benign 0.01
R4940:Lrrc37a UTSW 11 103,388,438 (GRCm39) missense unknown
R4983:Lrrc37a UTSW 11 103,388,444 (GRCm39) missense unknown
R4989:Lrrc37a UTSW 11 103,347,565 (GRCm39) missense unknown
R5046:Lrrc37a UTSW 11 103,389,066 (GRCm39) missense unknown
R5217:Lrrc37a UTSW 11 103,347,780 (GRCm39) missense unknown
R5300:Lrrc37a UTSW 11 103,347,784 (GRCm39) missense unknown
R5509:Lrrc37a UTSW 11 103,391,361 (GRCm39) missense probably benign 0.23
R5550:Lrrc37a UTSW 11 103,389,003 (GRCm39) missense unknown
R5655:Lrrc37a UTSW 11 103,389,381 (GRCm39) missense probably benign 0.28
R5668:Lrrc37a UTSW 11 103,391,001 (GRCm39) missense probably benign 0.03
R5750:Lrrc37a UTSW 11 103,348,923 (GRCm39) missense unknown
R5815:Lrrc37a UTSW 11 103,394,612 (GRCm39) missense probably benign 0.01
R5976:Lrrc37a UTSW 11 103,389,897 (GRCm39) missense possibly damaging 0.73
R5990:Lrrc37a UTSW 11 103,391,784 (GRCm39) missense probably benign 0.19
R6004:Lrrc37a UTSW 11 103,393,362 (GRCm39) missense possibly damaging 0.56
R6019:Lrrc37a UTSW 11 103,347,422 (GRCm39) missense unknown
R6056:Lrrc37a UTSW 11 103,388,484 (GRCm39) missense unknown
R6125:Lrrc37a UTSW 11 103,392,386 (GRCm39) missense probably benign 0.19
R6190:Lrrc37a UTSW 11 103,392,042 (GRCm39) missense possibly damaging 0.67
R6295:Lrrc37a UTSW 11 103,388,459 (GRCm39) missense unknown
R6320:Lrrc37a UTSW 11 103,394,877 (GRCm39) missense probably benign 0.10
R6354:Lrrc37a UTSW 11 103,355,213 (GRCm39) missense unknown
R6375:Lrrc37a UTSW 11 103,391,915 (GRCm39) missense probably benign 0.19
R6406:Lrrc37a UTSW 11 103,388,361 (GRCm39) missense unknown
R6468:Lrrc37a UTSW 11 103,351,666 (GRCm39) missense unknown
R6490:Lrrc37a UTSW 11 103,347,486 (GRCm39) missense unknown
R6502:Lrrc37a UTSW 11 103,383,005 (GRCm39) missense unknown
R6509:Lrrc37a UTSW 11 103,395,240 (GRCm39) missense probably benign 0.04
R6749:Lrrc37a UTSW 11 103,392,923 (GRCm39) missense probably benign 0.29
R6768:Lrrc37a UTSW 11 103,390,949 (GRCm39) missense probably benign 0.36
R6912:Lrrc37a UTSW 11 103,348,369 (GRCm39) missense unknown
R7081:Lrrc37a UTSW 11 103,348,781 (GRCm39) missense unknown
R7083:Lrrc37a UTSW 11 103,394,166 (GRCm39) missense probably benign 0.03
R7154:Lrrc37a UTSW 11 103,393,682 (GRCm39) missense probably benign 0.03
R7195:Lrrc37a UTSW 11 103,348,601 (GRCm39) missense unknown
R7265:Lrrc37a UTSW 11 103,389,767 (GRCm39) missense probably benign 0.09
R7276:Lrrc37a UTSW 11 103,347,572 (GRCm39) missense unknown
R7362:Lrrc37a UTSW 11 103,348,335 (GRCm39) missense unknown
R7450:Lrrc37a UTSW 11 103,389,152 (GRCm39) missense probably benign 0.01
R7458:Lrrc37a UTSW 11 103,388,258 (GRCm39) missense unknown
R7487:Lrrc37a UTSW 11 103,389,045 (GRCm39) missense unknown
R7535:Lrrc37a UTSW 11 103,392,683 (GRCm39) missense possibly damaging 0.68
R7593:Lrrc37a UTSW 11 103,391,778 (GRCm39) missense probably benign 0.03
R7677:Lrrc37a UTSW 11 103,390,464 (GRCm39) missense probably benign 0.26
R7686:Lrrc37a UTSW 11 103,389,062 (GRCm39) missense unknown
R7694:Lrrc37a UTSW 11 103,395,204 (GRCm39) missense probably benign 0.12
R7696:Lrrc37a UTSW 11 103,389,263 (GRCm39) missense probably benign 0.01
R7717:Lrrc37a UTSW 11 103,395,126 (GRCm39) missense probably benign 0.01
R7736:Lrrc37a UTSW 11 103,388,285 (GRCm39) missense unknown
R7841:Lrrc37a UTSW 11 103,391,931 (GRCm39) missense probably benign 0.03
R7885:Lrrc37a UTSW 11 103,393,868 (GRCm39) missense probably benign 0.01
R7888:Lrrc37a UTSW 11 103,392,307 (GRCm39) missense probably benign 0.19
R7993:Lrrc37a UTSW 11 103,348,787 (GRCm39) missense unknown
R8051:Lrrc37a UTSW 11 103,393,952 (GRCm39) missense possibly damaging 0.48
R8082:Lrrc37a UTSW 11 103,348,248 (GRCm39) missense unknown
R8097:Lrrc37a UTSW 11 103,394,925 (GRCm39) missense probably benign 0.04
R8108:Lrrc37a UTSW 11 103,393,883 (GRCm39) missense probably benign 0.24
R8269:Lrrc37a UTSW 11 103,388,724 (GRCm39) missense unknown
R8311:Lrrc37a UTSW 11 103,394,247 (GRCm39) missense probably benign 0.05
R8403:Lrrc37a UTSW 11 103,392,411 (GRCm39) missense probably benign 0.10
R8408:Lrrc37a UTSW 11 103,351,635 (GRCm39) missense unknown
R8529:Lrrc37a UTSW 11 103,348,373 (GRCm39) missense unknown
R8711:Lrrc37a UTSW 11 103,388,350 (GRCm39) nonsense probably null
R8757:Lrrc37a UTSW 11 103,348,766 (GRCm39) missense unknown
R8759:Lrrc37a UTSW 11 103,348,766 (GRCm39) missense unknown
R8769:Lrrc37a UTSW 11 103,389,536 (GRCm39) missense probably benign 0.10
R8785:Lrrc37a UTSW 11 103,347,242 (GRCm39) missense probably damaging 1.00
R8837:Lrrc37a UTSW 11 103,394,795 (GRCm39) missense probably benign 0.43
R8850:Lrrc37a UTSW 11 103,393,481 (GRCm39) missense
R8871:Lrrc37a UTSW 11 103,347,375 (GRCm39) missense unknown
R8894:Lrrc37a UTSW 11 103,347,449 (GRCm39) missense unknown
R8971:Lrrc37a UTSW 11 103,391,490 (GRCm39) missense probably benign 0.19
R8979:Lrrc37a UTSW 11 103,393,833 (GRCm39) missense possibly damaging 0.48
R9012:Lrrc37a UTSW 11 103,389,978 (GRCm39) missense probably benign 0.05
R9047:Lrrc37a UTSW 11 103,391,375 (GRCm39) missense probably damaging 0.97
R9167:Lrrc37a UTSW 11 103,347,658 (GRCm39) missense unknown
R9171:Lrrc37a UTSW 11 103,393,140 (GRCm39) missense probably benign 0.42
R9194:Lrrc37a UTSW 11 103,391,676 (GRCm39) missense probably benign 0.03
R9258:Lrrc37a UTSW 11 103,393,022 (GRCm39) missense probably benign 0.20
R9282:Lrrc37a UTSW 11 103,391,633 (GRCm39) missense probably benign 0.03
R9294:Lrrc37a UTSW 11 103,395,359 (GRCm39) missense probably benign 0.10
R9349:Lrrc37a UTSW 11 103,388,454 (GRCm39) missense unknown
R9560:Lrrc37a UTSW 11 103,347,420 (GRCm39) missense unknown
R9595:Lrrc37a UTSW 11 103,392,552 (GRCm39) missense probably benign 0.01
R9628:Lrrc37a UTSW 11 103,394,330 (GRCm39) missense probably benign 0.03
V7580:Lrrc37a UTSW 11 103,346,338 (GRCm39) missense possibly damaging 0.95
X0018:Lrrc37a UTSW 11 103,390,370 (GRCm39) missense possibly damaging 0.78
Z1176:Lrrc37a UTSW 11 103,391,920 (GRCm39) missense probably benign 0.09
Z1176:Lrrc37a UTSW 11 103,389,860 (GRCm39) missense possibly damaging 0.68
Z1176:Lrrc37a UTSW 11 103,347,312 (GRCm39) missense probably damaging 1.00
Z1177:Lrrc37a UTSW 11 103,391,346 (GRCm39) missense probably benign 0.43
Z1177:Lrrc37a UTSW 11 103,390,793 (GRCm39) missense possibly damaging 0.46
Z1177:Lrrc37a UTSW 11 103,393,853 (GRCm39) missense probably benign 0.20
Z1177:Lrrc37a UTSW 11 103,391,424 (GRCm39) missense probably benign 0.20
Predicted Primers PCR Primer
(F):5'- TGGGGCTTGGAATTACCGTAAG -3'
(R):5'- GGTTCACACTCAGCATCCAC -3'

Sequencing Primer
(F):5'- GCTTGGAATTACCGTAAGTTCTAG -3'
(R):5'- CTCAGCATCCACACCCAAG -3'
Posted On 2014-08-25