Incidental Mutation 'R1982:Grin2c'
ID 219993
Institutional Source Beutler Lab
Gene Symbol Grin2c
Ensembl Gene ENSMUSG00000020734
Gene Name glutamate receptor, ionotropic, NMDA2C (epsilon 3)
Synonyms NR2C, GluRepsilon3, NMDAR2C
MMRRC Submission 039994-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.234) question?
Stock # R1982 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 115249169-115267243 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 115260905 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Arginine at position 76 (S76R)
Ref Sequence ENSEMBL: ENSMUSP00000102164 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003351] [ENSMUST00000106554]
AlphaFold Q01098
Predicted Effect possibly damaging
Transcript: ENSMUST00000003351
AA Change: S76R

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000003351
Gene: ENSMUSG00000020734
AA Change: S76R

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:ANF_receptor 99 299 5.1e-12 PFAM
PBPe 440 796 1.11e-79 SMART
Lig_chan-Glu_bd 448 500 2.79e-18 SMART
transmembrane domain 816 835 N/A INTRINSIC
Pfam:NMDAR2_C 837 924 6.8e-15 PFAM
low complexity region 941 975 N/A INTRINSIC
low complexity region 1041 1058 N/A INTRINSIC
low complexity region 1063 1076 N/A INTRINSIC
low complexity region 1173 1182 N/A INTRINSIC
low complexity region 1194 1203 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000106554
AA Change: S76R

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000102164
Gene: ENSMUSG00000020734
AA Change: S76R

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:ANF_receptor 100 306 6.9e-10 PFAM
PBPe 440 796 1.11e-79 SMART
Lig_chan-Glu_bd 448 500 2.79e-18 SMART
transmembrane domain 816 835 N/A INTRINSIC
Pfam:NMDAR2_C 837 926 1.1e-13 PFAM
low complexity region 941 975 N/A INTRINSIC
low complexity region 1041 1058 N/A INTRINSIC
low complexity region 1063 1076 N/A INTRINSIC
low complexity region 1173 1182 N/A INTRINSIC
low complexity region 1194 1203 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the N-methyl-D-aspartate (NMDA) receptor, which is a subtype of ionotropic glutamate receptor. NMDA receptors are found in the central nervous system, are permeable to cations and have an important role in physiological processes such as learning, memory, and synaptic development. The receptor is a tetramer of different subunits (typically heterodimer of subunit 1 with one or more of subunits 2A-D), forming a channel that is permeable to calcium, potassium, and sodium, and whose properties are determined by subunit composition. Alterations in the subunit composition of the receptor are associated with pathophysiological conditions such as Parkinson's disease, Alzheimer's disease, depression, and schizophrenia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2013]
PHENOTYPE: Homozygotes for targeted null mutations exhibit deficits in motor coordination and reduced granule cell responses to N-methy-D-aspartate in brain slices. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930415L06Rik A T X: 89,931,445 V382E probably damaging Het
Aatk G T 11: 120,013,514 P252Q probably damaging Het
Adamts4 T C 1: 171,258,934 V765A probably benign Het
Agfg2 A T 5: 137,664,253 V184E possibly damaging Het
Alas1 A T 9: 106,238,185 I48N probably damaging Het
Anks1 T C 17: 27,985,121 V181A probably damaging Het
Anxa8 A T 14: 34,096,570 R261S probably damaging Het
Aqp4 T C 18: 15,393,551 D291G probably damaging Het
Atrn A G 2: 130,970,222 R696G probably benign Het
Barx2 A C 9: 31,913,012 I27S probably damaging Het
Btnl1 A T 17: 34,379,751 I114L possibly damaging Het
Casq1 C T 1: 172,215,530 A200T probably damaging Het
Ccdc33 T A 9: 58,117,168 E225D probably benign Het
Cd84 C A 1: 171,884,585 probably null Het
Ceacam9 T G 7: 16,725,307 L177R probably benign Het
Cenpi T A X: 134,318,033 F161L possibly damaging Het
Cep63 T C 9: 102,602,880 K251E probably damaging Het
Cetn3 A G 13: 81,784,697 E25G probably damaging Het
Crybg3 T C 16: 59,544,125 D2378G possibly damaging Het
Ddx19b T C 8: 111,009,343 T357A possibly damaging Het
Dpep2 A C 8: 105,989,455 Y266* probably null Het
Dqx1 G A 6: 83,058,577 D24N probably damaging Het
Dsg4 A T 18: 20,471,212 Y912F probably damaging Het
Fam71f2 A G 6: 29,285,922 T69A probably benign Het
Fezf2 G T 14: 12,344,405 P261T probably benign Het
Fmo1 T C 1: 162,839,756 I163M possibly damaging Het
Gatad2a G A 8: 69,913,132 R428* probably null Het
Gfpt1 T A 6: 87,054,630 F85I possibly damaging Het
Gimap7 A T 6: 48,724,241 I254F possibly damaging Het
Glcci1 T C 6: 8,592,980 S261P probably damaging Het
Glis3 A T 19: 28,531,274 F437I probably damaging Het
Glp1r C A 17: 30,925,627 S258* probably null Het
Gm13023 C A 4: 143,795,150 H445Q probably benign Het
Gm7030 T A 17: 36,128,722 D122V probably damaging Het
Gpt2 C T 8: 85,516,203 A288V possibly damaging Het
Guf1 T A 5: 69,567,226 Y447* probably null Het
Hectd1 A C 12: 51,785,841 L916V probably damaging Het
Hnf4g A G 3: 3,638,208 K96E probably damaging Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Ifi207 T G 1: 173,735,239 M114L probably benign Het
Ifi35 A T 11: 101,458,286 E252V probably damaging Het
Igsf9b G A 9: 27,322,239 R345H possibly damaging Het
Itih3 T C 14: 30,923,583 probably benign Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 74 probably benign Het
Kidins220 A T 12: 25,051,194 M1252L probably benign Het
Kifap3 T A 1: 163,862,022 L525* probably null Het
Limk2 A T 11: 3,355,461 D35E probably benign Het
Lrrc37a G A 11: 103,498,966 P1878S probably benign Het
Mansc4 T A 6: 147,075,675 I148F probably benign Het
Mei1 A G 15: 82,103,312 N859S probably benign Het
Mib1 A G 18: 10,812,064 D987G probably damaging Het
Mroh8 A G 2: 157,271,975 V132A possibly damaging Het
Npnt T C 3: 132,948,132 I29M probably benign Het
Nrap T C 19: 56,384,105 D138G probably damaging Het
Olfr1 A T 11: 73,395,092 I310N probably benign Het
Olfr5 T C 7: 6,480,932 M75V probably benign Het
Olfr512 A G 7: 108,713,695 Y102C probably damaging Het
Olfr91 T A 17: 37,093,808 E22V probably damaging Het
Osbpl5 A C 7: 143,741,671 probably null Het
Pcna-ps2 T C 19: 9,283,683 V102A possibly damaging Het
Pik3c2g T C 6: 139,622,548 S221P probably damaging Het
Plppr3 A G 10: 79,866,425 I271T probably damaging Het
Prkar1b C T 5: 139,127,643 A41T probably benign Het
Prkcsh A G 9: 22,012,868 D458G probably damaging Het
Prr14 G T 7: 127,475,490 R398L possibly damaging Het
Ptafr A G 4: 132,579,985 R229G probably damaging Het
Rbp3 T C 14: 33,954,545 F150S probably damaging Het
Rel C T 11: 23,742,761 G424D probably benign Het
Rlf T C 4: 121,150,112 Y557C probably damaging Het
Samt3 A C X: 86,047,134 M211L probably benign Het
Selenop A T 15: 3,275,694 I111F probably damaging Het
Slc2a2 G A 3: 28,717,441 M173I probably benign Het
Slc43a1 G T 2: 84,856,889 G361V possibly damaging Het
Slit2 G A 5: 48,249,836 V870M probably damaging Het
Ssxb10 A G X: 8,331,019 D77G probably benign Het
Stk32b T A 5: 37,649,114 I29F probably damaging Het
Stra6l T A 4: 45,867,237 C161* probably null Het
Tecpr2 T A 12: 110,954,785 M1264K probably benign Het
Tfap2c A T 2: 172,557,236 I468F probably damaging Het
Ticam1 C T 17: 56,271,555 R180H probably damaging Het
Tlr4 T A 4: 66,841,035 N688K probably benign Het
Tmem35b A T 4: 127,126,053 probably benign Het
Ugt2b34 T C 5: 86,906,313 E203G probably damaging Het
Vegfa A C 17: 46,018,860 *393G probably null Het
Vmn2r16 T C 5: 109,364,024 V699A probably benign Het
Zfp324 T C 7: 12,971,218 S445P probably damaging Het
Zfp982 T A 4: 147,512,592 C135* probably null Het
Zfp990 A C 4: 145,536,869 N146H probably damaging Het
Zfyve26 A G 12: 79,255,243 Y431H possibly damaging Het
Other mutations in Grin2c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01019:Grin2c APN 11 115258110 missense possibly damaging 0.94
IGL01306:Grin2c APN 11 115256194 missense probably benign 0.01
IGL01408:Grin2c APN 11 115260882 missense probably damaging 1.00
IGL01539:Grin2c APN 11 115250106 missense probably benign 0.32
IGL01931:Grin2c APN 11 115253910 missense probably damaging 1.00
IGL01964:Grin2c APN 11 115253847 missense probably damaging 1.00
IGL02796:Grin2c APN 11 115250717 splice site probably benign
IGL02956:Grin2c APN 11 115257959 missense possibly damaging 0.86
IGL03221:Grin2c APN 11 115254044 splice site probably benign
ANU23:Grin2c UTSW 11 115256194 missense probably benign 0.01
BB007:Grin2c UTSW 11 115256237 missense probably benign 0.01
BB017:Grin2c UTSW 11 115256237 missense probably benign 0.01
PIT4362001:Grin2c UTSW 11 115249633 missense probably benign
R0011:Grin2c UTSW 11 115255750 missense probably damaging 1.00
R0011:Grin2c UTSW 11 115255750 missense probably damaging 1.00
R0112:Grin2c UTSW 11 115251134 missense probably damaging 1.00
R0355:Grin2c UTSW 11 115260728 splice site probably benign
R0681:Grin2c UTSW 11 115249653 missense probably benign
R0791:Grin2c UTSW 11 115250646 missense probably damaging 1.00
R0792:Grin2c UTSW 11 115250646 missense probably damaging 1.00
R1512:Grin2c UTSW 11 115253850 missense probably damaging 1.00
R1572:Grin2c UTSW 11 115256074 missense possibly damaging 0.92
R1654:Grin2c UTSW 11 115260853 missense probably benign 0.21
R1803:Grin2c UTSW 11 115260732 critical splice donor site probably null
R2050:Grin2c UTSW 11 115257419 missense possibly damaging 0.89
R2196:Grin2c UTSW 11 115250666 missense probably benign 0.34
R2442:Grin2c UTSW 11 115251134 missense probably damaging 1.00
R2509:Grin2c UTSW 11 115251068 nonsense probably null
R3440:Grin2c UTSW 11 115250643 missense probably damaging 1.00
R3965:Grin2c UTSW 11 115260994 missense probably damaging 1.00
R4618:Grin2c UTSW 11 115252747 missense probably damaging 1.00
R4735:Grin2c UTSW 11 115249596 missense possibly damaging 0.63
R4856:Grin2c UTSW 11 115260790 missense probably damaging 1.00
R4886:Grin2c UTSW 11 115260790 missense probably damaging 1.00
R5277:Grin2c UTSW 11 115253813 missense probably damaging 1.00
R5334:Grin2c UTSW 11 115256055 missense possibly damaging 0.76
R5553:Grin2c UTSW 11 115252725 missense probably null 0.96
R5711:Grin2c UTSW 11 115250289 missense probably benign 0.32
R5784:Grin2c UTSW 11 115258295 missense possibly damaging 0.94
R5849:Grin2c UTSW 11 115260991 missense probably benign
R6421:Grin2c UTSW 11 115251130 missense probably damaging 1.00
R6461:Grin2c UTSW 11 115255696 missense possibly damaging 0.96
R6658:Grin2c UTSW 11 115258282 missense possibly damaging 0.64
R7205:Grin2c UTSW 11 115251050 missense probably damaging 0.99
R7611:Grin2c UTSW 11 115252685 missense probably damaging 1.00
R7637:Grin2c UTSW 11 115256259 splice site probably null
R7751:Grin2c UTSW 11 115253870 missense probably damaging 1.00
R7847:Grin2c UTSW 11 115260978 missense possibly damaging 0.68
R7920:Grin2c UTSW 11 115254144 missense probably benign 0.33
R7930:Grin2c UTSW 11 115256237 missense probably benign 0.01
R7940:Grin2c UTSW 11 115255281 missense probably damaging 1.00
R7956:Grin2c UTSW 11 115250148 missense probably benign 0.16
R8081:Grin2c UTSW 11 115249893 missense probably damaging 0.98
R8249:Grin2c UTSW 11 115253837 missense probably damaging 0.98
R8447:Grin2c UTSW 11 115257389 missense probably benign 0.01
R9034:Grin2c UTSW 11 115251239 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTATAGACAGGCACCTTGGGG -3'
(R):5'- CTGATTTCTCTGCAGGACCC -3'

Sequencing Primer
(F):5'- TTGGGGGTGAGGACCAC -3'
(R):5'- AGGACCCTCCAGTGGACATG -3'
Posted On 2014-08-25