Mutagenetix > Incidental Mutation

Incidental Mutation 'R1982:Kidins220'

219997

Institutional Source

Beutler Lab

Gene Symbol

Kidins220

Ensembl Gene

ENSMUSG00000036333

Gene Name

kinase D-interacting substrate 220

Synonyms

C330002I19Rik, 3110039L19Rik

MMRRC Submission

039994-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1982 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

24974925-25063152 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 25051194 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Leucine at position 1252 (M1252L)

Ref Sequence

ENSEMBL: ENSMUSP00000063999 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000066652] [ENSMUST00000220459] [ENSMUST00000222941]

AlphaFold

E9Q9B7

Predicted Effect

probably benign
Transcript: ENSMUST00000066652
AA Change: M1252L

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000063999
Gene: ENSMUSG00000036333
AA Change: M1252L

Domain	Start	End	E-Value	Type
ANK	37	66	1.11e-7	SMART
ANK	70	99	2.25e-3	SMART
ANK	103	132	4.78e-7	SMART
ANK	136	165	5.53e-3	SMART
ANK	169	198	2.52e-6	SMART
ANK	202	231	6.26e-2	SMART
ANK	235	264	1.22e-4	SMART
ANK	268	297	6.92e-4	SMART
ANK	301	330	1.57e-2	SMART
ANK	334	363	9.78e-4	SMART
ANK	367	398	4.6e0	SMART
Pfam:KAP_NTPase	440	953	1.2e-112	PFAM
low complexity region	1077	1092	N/A	INTRINSIC
low complexity region	1096	1107	N/A	INTRINSIC
low complexity region	1382	1396	N/A	INTRINSIC
low complexity region	1422	1452	N/A	INTRINSIC
low complexity region	1509	1520	N/A	INTRINSIC
low complexity region	1544	1555	N/A	INTRINSIC
low complexity region	1561	1567	N/A	INTRINSIC
low complexity region	1596	1609	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000220459
AA Change: M1131L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000220622

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000221423

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000221622

Predicted Effect

unknown
Transcript: ENSMUST00000222013
AA Change: M1040L

Predicted Effect

probably benign
Transcript: ENSMUST00000222481

Predicted Effect

probably benign
Transcript: ENSMUST00000222941
AA Change: M1222L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane protein that is preferentially expressed in the nervous system where it controls neuronal cell survival, differentiation into exons and dendrites, and synaptic plasticity. The encoded protein interacts with membrane receptors, cytosolic signaling components, and cytoskeletal proteins, serving as a scaffold that mediates crosstalk between the neurotrophin pathway and several other intracellular signaling pathways. Aberrant expression of this gene is associated with the onset of various neuropsychiatric disorders and neurodegenerative diseases, including Alzheimer's disease. Naturally occurring mutations in this gene are associated with a syndrome characterized by spastic paraplegia, intellectual disability, nystagmus and obesity. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2017]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality. Mice heterozygous for a knock-out allele exhibit decreased dendritic complexity in the barrel somatosensory cortex and dentate gyrus neurons. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 89 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930415L06Rik	A	T	X: 89,931,445	V382E	probably damaging	Het
Aatk	G	T	11: 120,013,514	P252Q	probably damaging	Het
Adamts4	T	C	1: 171,258,934	V765A	probably benign	Het
Agfg2	A	T	5: 137,664,253	V184E	possibly damaging	Het
Alas1	A	T	9: 106,238,185	I48N	probably damaging	Het
Anks1	T	C	17: 27,985,121	V181A	probably damaging	Het
Anxa8	A	T	14: 34,096,570	R261S	probably damaging	Het
Aqp4	T	C	18: 15,393,551	D291G	probably damaging	Het
Atrn	A	G	2: 130,970,222	R696G	probably benign	Het
Barx2	A	C	9: 31,913,012	I27S	probably damaging	Het
Btnl1	A	T	17: 34,379,751	I114L	possibly damaging	Het
Casq1	C	T	1: 172,215,530	A200T	probably damaging	Het
Ccdc33	T	A	9: 58,117,168	E225D	probably benign	Het
Cd84	C	A	1: 171,884,585		probably null	Het
Ceacam9	T	G	7: 16,725,307	L177R	probably benign	Het
Cenpi	T	A	X: 134,318,033	F161L	possibly damaging	Het
Cep63	T	C	9: 102,602,880	K251E	probably damaging	Het
Cetn3	A	G	13: 81,784,697	E25G	probably damaging	Het
Crybg3	T	C	16: 59,544,125	D2378G	possibly damaging	Het
Ddx19b	T	C	8: 111,009,343	T357A	possibly damaging	Het
Dpep2	A	C	8: 105,989,455	Y266*	probably null	Het
Dqx1	G	A	6: 83,058,577	D24N	probably damaging	Het
Dsg4	A	T	18: 20,471,212	Y912F	probably damaging	Het
Fam71f2	A	G	6: 29,285,922	T69A	probably benign	Het
Fezf2	G	T	14: 12,344,405	P261T	probably benign	Het
Fmo1	T	C	1: 162,839,756	I163M	possibly damaging	Het
Gatad2a	G	A	8: 69,913,132	R428*	probably null	Het
Gfpt1	T	A	6: 87,054,630	F85I	possibly damaging	Het
Gimap7	A	T	6: 48,724,241	I254F	possibly damaging	Het
Glcci1	T	C	6: 8,592,980	S261P	probably damaging	Het
Glis3	A	T	19: 28,531,274	F437I	probably damaging	Het
Glp1r	C	A	17: 30,925,627	S258*	probably null	Het
Gm13023	C	A	4: 143,795,150	H445Q	probably benign	Het
Gm7030	T	A	17: 36,128,722	D122V	probably damaging	Het
Gpt2	C	T	8: 85,516,203	A288V	possibly damaging	Het
Grin2c	G	T	11: 115,260,905	S76R	possibly damaging	Het
Guf1	T	A	5: 69,567,226	Y447*	probably null	Het
Hectd1	A	C	12: 51,785,841	L916V	probably damaging	Het
Hnf4g	A	G	3: 3,638,208	K96E	probably damaging	Het
Hsh2d	G	A	8: 72,200,460	D229N	probably benign	Het
Ifi207	T	G	1: 173,735,239	M114L	probably benign	Het
Ifi35	A	T	11: 101,458,286	E252V	probably damaging	Het
Igsf9b	G	A	9: 27,322,239	R345H	possibly damaging	Het
Itih3	T	C	14: 30,923,583		probably benign	Het
Kcnh8	GAGACCAACGAGCAGCTGATGCTTCAGA	GAGA	17: 52,725,906	74	probably benign	Het
Kifap3	T	A	1: 163,862,022	L525*	probably null	Het
Limk2	A	T	11: 3,355,461	D35E	probably benign	Het
Lrrc37a	G	A	11: 103,498,966	P1878S	probably benign	Het
Mansc4	T	A	6: 147,075,675	I148F	probably benign	Het
Mei1	A	G	15: 82,103,312	N859S	probably benign	Het
Mib1	A	G	18: 10,812,064	D987G	probably damaging	Het
Mroh8	A	G	2: 157,271,975	V132A	possibly damaging	Het
Npnt	T	C	3: 132,948,132	I29M	probably benign	Het
Nrap	T	C	19: 56,384,105	D138G	probably damaging	Het
Olfr1	A	T	11: 73,395,092	I310N	probably benign	Het
Olfr5	T	C	7: 6,480,932	M75V	probably benign	Het
Olfr512	A	G	7: 108,713,695	Y102C	probably damaging	Het
Olfr91	T	A	17: 37,093,808	E22V	probably damaging	Het
Osbpl5	A	C	7: 143,741,671		probably null	Het
Pcna-ps2	T	C	19: 9,283,683	V102A	possibly damaging	Het
Pik3c2g	T	C	6: 139,622,548	S221P	probably damaging	Het
Plppr3	A	G	10: 79,866,425	I271T	probably damaging	Het
Prkar1b	C	T	5: 139,127,643	A41T	probably benign	Het
Prkcsh	A	G	9: 22,012,868	D458G	probably damaging	Het
Prr14	G	T	7: 127,475,490	R398L	possibly damaging	Het
Ptafr	A	G	4: 132,579,985	R229G	probably damaging	Het
Rbp3	T	C	14: 33,954,545	F150S	probably damaging	Het
Rel	C	T	11: 23,742,761	G424D	probably benign	Het
Rlf	T	C	4: 121,150,112	Y557C	probably damaging	Het
Samt3	A	C	X: 86,047,134	M211L	probably benign	Het
Selenop	A	T	15: 3,275,694	I111F	probably damaging	Het
Slc2a2	G	A	3: 28,717,441	M173I	probably benign	Het
Slc43a1	G	T	2: 84,856,889	G361V	possibly damaging	Het
Slit2	G	A	5: 48,249,836	V870M	probably damaging	Het
Ssxb10	A	G	X: 8,331,019	D77G	probably benign	Het
Stk32b	T	A	5: 37,649,114	I29F	probably damaging	Het
Stra6l	T	A	4: 45,867,237	C161*	probably null	Het
Tecpr2	T	A	12: 110,954,785	M1264K	probably benign	Het
Tfap2c	A	T	2: 172,557,236	I468F	probably damaging	Het
Ticam1	C	T	17: 56,271,555	R180H	probably damaging	Het
Tlr4	T	A	4: 66,841,035	N688K	probably benign	Het
Tmem35b	A	T	4: 127,126,053		probably benign	Het
Ugt2b34	T	C	5: 86,906,313	E203G	probably damaging	Het
Vegfa	A	C	17: 46,018,860	*393G	probably null	Het
Vmn2r16	T	C	5: 109,364,024	V699A	probably benign	Het
Zfp324	T	C	7: 12,971,218	S445P	probably damaging	Het
Zfp982	T	A	4: 147,512,592	C135*	probably null	Het
Zfp990	A	C	4: 145,536,869	N146H	probably damaging	Het
Zfyve26	A	G	12: 79,255,243	Y431H	possibly damaging	Het

Other mutations in Kidins220

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00551:Kidins220	APN	12	25038560	splice site	probably benign
IGL00959:Kidins220	APN	12	25051133	missense	possibly damaging	0.74
IGL00978:Kidins220	APN	12	25057474	missense	probably damaging	1.00
IGL01144:Kidins220	APN	12	25010926	missense	probably damaging	1.00
IGL01326:Kidins220	APN	12	25038499	missense	probably damaging	0.97
IGL01545:Kidins220	APN	12	25040460	missense	possibly damaging	0.66
IGL01802:Kidins220	APN	12	24995000	missense	probably damaging	1.00
IGL01875:Kidins220	APN	12	25057729	missense	probably benign	0.00
IGL02160:Kidins220	APN	12	25004111	missense	probably damaging	1.00
IGL02383:Kidins220	APN	12	24997333	splice site	probably benign
IGL02673:Kidins220	APN	12	24994992	missense	probably damaging	1.00
IGL02800:Kidins220	APN	12	25003093	missense	probably damaging	1.00
IGL03345:Kidins220	APN	12	25003045	missense	probably damaging	1.00
IGL03379:Kidins220	APN	12	25008448	missense	probably damaging	0.99
IGL03412:Kidins220	APN	12	24999345	missense	probably damaging	1.00
P0043:Kidins220	UTSW	12	25008156	missense	probably damaging	1.00
R0011:Kidins220	UTSW	12	24999352	missense	probably damaging	0.99
R0011:Kidins220	UTSW	12	24999352	missense	probably damaging	0.99
R0269:Kidins220	UTSW	12	25040512	missense	probably damaging	0.98
R0280:Kidins220	UTSW	12	25010141	missense	probably damaging	1.00
R0334:Kidins220	UTSW	12	25008069	missense	probably damaging	1.00
R1601:Kidins220	UTSW	12	25005088	missense	probably benign	0.35
R1778:Kidins220	UTSW	12	25013446	splice site	probably benign
R1808:Kidins220	UTSW	12	25003009	missense	probably benign	0.00
R1855:Kidins220	UTSW	12	25056591	missense	probably damaging	1.00
R1965:Kidins220	UTSW	12	24994906	missense	probably damaging	1.00
R2069:Kidins220	UTSW	12	24987006	splice site	probably benign
R2101:Kidins220	UTSW	12	25057423	missense	probably damaging	1.00
R2124:Kidins220	UTSW	12	25041303	critical splice donor site	probably null
R2371:Kidins220	UTSW	12	25057324	missense	probably damaging	1.00
R2405:Kidins220	UTSW	12	25011509	missense	probably damaging	0.99
R3522:Kidins220	UTSW	12	24990758	missense	probably damaging	1.00
R3877:Kidins220	UTSW	12	25001565	splice site	probably benign
R3915:Kidins220	UTSW	12	25053958	missense	possibly damaging	0.93
R4023:Kidins220	UTSW	12	25057144	splice site	probably null
R4287:Kidins220	UTSW	12	25056846	missense	possibly damaging	0.81
R4476:Kidins220	UTSW	12	25011001	missense	probably damaging	1.00
R4495:Kidins220	UTSW	12	25038302	splice site	probably null
R4627:Kidins220	UTSW	12	25057042	missense	possibly damaging	0.89
R4807:Kidins220	UTSW	12	25057285	missense	probably damaging	1.00
R4899:Kidins220	UTSW	12	25013443	critical splice donor site	probably null
R4960:Kidins220	UTSW	12	24992260	nonsense	probably null
R5118:Kidins220	UTSW	12	24992297	missense	probably damaging	1.00
R5183:Kidins220	UTSW	12	25051126	missense	probably benign	0.17
R5238:Kidins220	UTSW	12	25003010	missense	probably benign	0.31
R5580:Kidins220	UTSW	12	25047897	missense	probably benign	0.00
R5707:Kidins220	UTSW	12	25013391	missense	probably damaging	1.00
R5813:Kidins220	UTSW	12	25057140	nonsense	probably null
R6131:Kidins220	UTSW	12	24992314	splice site	probably null
R6146:Kidins220	UTSW	12	25052813	missense	probably damaging	1.00
R6151:Kidins220	UTSW	12	25056909	missense	possibly damaging	0.65
R6160:Kidins220	UTSW	12	24997311	missense	probably damaging	1.00
R6187:Kidins220	UTSW	12	25051308	splice site	probably null
R6289:Kidins220	UTSW	12	25056616	missense	probably damaging	1.00
R6321:Kidins220	UTSW	12	25057534	missense	probably benign	0.09
R6450:Kidins220	UTSW	12	25057191	missense	probably benign
R6513:Kidins220	UTSW	12	25038435	missense	possibly damaging	0.94
R6652:Kidins220	UTSW	12	25010060	splice site	probably null
R6711:Kidins220	UTSW	12	24998751	missense	probably damaging	0.96
R6858:Kidins220	UTSW	12	25008543	missense	possibly damaging	0.85
R7102:Kidins220	UTSW	12	25057663	missense	probably benign	0.00
R7112:Kidins220	UTSW	12	25004019	missense	probably damaging	1.00
R7139:Kidins220	UTSW	12	24994821	missense	probably damaging	1.00
R7140:Kidins220	UTSW	12	25036624	missense	probably damaging	1.00
R7271:Kidins220	UTSW	12	25011571	missense	probably benign	0.21
R7361:Kidins220	UTSW	12	25057000	missense	probably benign	0.01
R7509:Kidins220	UTSW	12	24982361	missense	probably damaging	0.98
R7510:Kidins220	UTSW	12	24992269	missense	possibly damaging	0.88
R7783:Kidins220	UTSW	12	24988556	missense	probably damaging	1.00
R7796:Kidins220	UTSW	12	24982351	missense	probably damaging	0.96
R7831:Kidins220	UTSW	12	25061231	missense	possibly damaging	0.90
R8074:Kidins220	UTSW	12	25057716	missense	probably benign	0.29
R8214:Kidins220	UTSW	12	24994855	missense	probably damaging	1.00
R8304:Kidins220	UTSW	12	25057128	missense	probably benign	0.01
R8313:Kidins220	UTSW	12	25004111	missense	probably damaging	1.00
R8346:Kidins220	UTSW	12	25036534	missense	probably damaging	1.00
R8392:Kidins220	UTSW	12	24990728	missense	probably damaging	1.00
R8482:Kidins220	UTSW	12	25040528	missense	probably benign	0.00
R8722:Kidins220	UTSW	12	25001594	missense	probably benign
R8831:Kidins220	UTSW	12	25036455	missense	possibly damaging	0.70
R8960:Kidins220	UTSW	12	25056915	missense	probably benign	0.05
R9193:Kidins220	UTSW	12	24986967	missense	possibly damaging	0.79
R9267:Kidins220	UTSW	12	24988559	missense	probably benign	0.29
R9303:Kidins220	UTSW	12	25057111	missense	probably benign	0.36
R9343:Kidins220	UTSW	12	25008079	missense	probably damaging	1.00
R9526:Kidins220	UTSW	12	25038384	missense	probably damaging	1.00
R9644:Kidins220	UTSW	12	25011019	missense	probably damaging	1.00
R9655:Kidins220	UTSW	12	24997296	missense	probably damaging	1.00
R9664:Kidins220	UTSW	12	25056896	missense	probably benign	0.39

Predicted Primers

PCR Primer
(F):5'- ACTCGTTACATGTCAGATAGCTG -3'
(R):5'- TAGACACTGGTTAAGTAGCGC -3'

Sequencing Primer
(F):5'- ATTCTATATGCATTGGCTGTGATTTC -3'
(R):5'- CACTGGTTAAGTAGCGCTGTAATTC -3'

Posted On

2014-08-25