Incidental Mutation 'R1982:Crybg3'
ID 220023
Institutional Source Beutler Lab
Gene Symbol Crybg3
Ensembl Gene ENSMUSG00000022723
Gene Name beta-gamma crystallin domain containing 3
MMRRC Submission 039994-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.116) question?
Stock # R1982 (G1)
Quality Score 225
Status Not validated
Chromosome 16
Chromosomal Location 59490775-59600979 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 59544125 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 2378 (D2378G)
Ref Sequence ENSEMBL: ENSMUSP00000156047 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044604] [ENSMUST00000139989] [ENSMUST00000172910]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000044604
AA Change: D664G

PolyPhen 2 Score 0.205 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000037682
Gene: ENSMUSG00000022723
AA Change: D664G

low complexity region 258 273 N/A INTRINSIC
low complexity region 282 290 N/A INTRINSIC
XTALbg 430 516 2.78e-4 SMART
Pfam:Crystall 536 599 3.3e-7 PFAM
XTALbg 614 699 1.2e-21 SMART
XTALbg 707 790 5.73e-19 SMART
XTALbg 803 881 6.87e-5 SMART
XTALbg 889 969 1.28e-7 SMART
RICIN 972 1104 8.16e-14 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129350
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139989
SMART Domains Protein: ENSMUSP00000122663
Gene: ENSMUSG00000022723

XTALbg 1 86 2.15e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000172910
AA Change: D2378G

PolyPhen 2 Score 0.851 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect probably benign
Transcript: ENSMUST00000179383
AA Change: D664G

PolyPhen 2 Score 0.205 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000137452
Gene: ENSMUSG00000022723
AA Change: D664G

low complexity region 390 405 N/A INTRINSIC
low complexity region 414 422 N/A INTRINSIC
XTALbg 562 648 2.78e-4 SMART
Pfam:Crystall 668 731 1e-6 PFAM
XTALbg 746 831 1.2e-21 SMART
XTALbg 839 922 5.73e-19 SMART
XTALbg 935 1013 6.87e-5 SMART
XTALbg 1021 1101 1.28e-7 SMART
RICIN 1104 1236 8.16e-14 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930415L06Rik A T X: 89,931,445 V382E probably damaging Het
Aatk G T 11: 120,013,514 P252Q probably damaging Het
Adamts4 T C 1: 171,258,934 V765A probably benign Het
Agfg2 A T 5: 137,664,253 V184E possibly damaging Het
Alas1 A T 9: 106,238,185 I48N probably damaging Het
Anks1 T C 17: 27,985,121 V181A probably damaging Het
Anxa8 A T 14: 34,096,570 R261S probably damaging Het
Aqp4 T C 18: 15,393,551 D291G probably damaging Het
Atrn A G 2: 130,970,222 R696G probably benign Het
Barx2 A C 9: 31,913,012 I27S probably damaging Het
Btnl1 A T 17: 34,379,751 I114L possibly damaging Het
Casq1 C T 1: 172,215,530 A200T probably damaging Het
Ccdc33 T A 9: 58,117,168 E225D probably benign Het
Cd84 C A 1: 171,884,585 probably null Het
Ceacam9 T G 7: 16,725,307 L177R probably benign Het
Cenpi T A X: 134,318,033 F161L possibly damaging Het
Cep63 T C 9: 102,602,880 K251E probably damaging Het
Cetn3 A G 13: 81,784,697 E25G probably damaging Het
Ddx19b T C 8: 111,009,343 T357A possibly damaging Het
Dpep2 A C 8: 105,989,455 Y266* probably null Het
Dqx1 G A 6: 83,058,577 D24N probably damaging Het
Dsg4 A T 18: 20,471,212 Y912F probably damaging Het
Fam71f2 A G 6: 29,285,922 T69A probably benign Het
Fezf2 G T 14: 12,344,405 P261T probably benign Het
Fmo1 T C 1: 162,839,756 I163M possibly damaging Het
Gatad2a G A 8: 69,913,132 R428* probably null Het
Gfpt1 T A 6: 87,054,630 F85I possibly damaging Het
Gimap7 A T 6: 48,724,241 I254F possibly damaging Het
Glcci1 T C 6: 8,592,980 S261P probably damaging Het
Glis3 A T 19: 28,531,274 F437I probably damaging Het
Glp1r C A 17: 30,925,627 S258* probably null Het
Gm13023 C A 4: 143,795,150 H445Q probably benign Het
Gm7030 T A 17: 36,128,722 D122V probably damaging Het
Gpt2 C T 8: 85,516,203 A288V possibly damaging Het
Grin2c G T 11: 115,260,905 S76R possibly damaging Het
Guf1 T A 5: 69,567,226 Y447* probably null Het
Hectd1 A C 12: 51,785,841 L916V probably damaging Het
Hnf4g A G 3: 3,638,208 K96E probably damaging Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Ifi207 T G 1: 173,735,239 M114L probably benign Het
Ifi35 A T 11: 101,458,286 E252V probably damaging Het
Igsf9b G A 9: 27,322,239 R345H possibly damaging Het
Itih3 T C 14: 30,923,583 probably benign Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 74 probably benign Het
Kidins220 A T 12: 25,051,194 M1252L probably benign Het
Kifap3 T A 1: 163,862,022 L525* probably null Het
Limk2 A T 11: 3,355,461 D35E probably benign Het
Lrrc37a G A 11: 103,498,966 P1878S probably benign Het
Mansc4 T A 6: 147,075,675 I148F probably benign Het
Mei1 A G 15: 82,103,312 N859S probably benign Het
Mib1 A G 18: 10,812,064 D987G probably damaging Het
Mroh8 A G 2: 157,271,975 V132A possibly damaging Het
Npnt T C 3: 132,948,132 I29M probably benign Het
Nrap T C 19: 56,384,105 D138G probably damaging Het
Olfr1 A T 11: 73,395,092 I310N probably benign Het
Olfr5 T C 7: 6,480,932 M75V probably benign Het
Olfr512 A G 7: 108,713,695 Y102C probably damaging Het
Olfr91 T A 17: 37,093,808 E22V probably damaging Het
Osbpl5 A C 7: 143,741,671 probably null Het
Pcna-ps2 T C 19: 9,283,683 V102A possibly damaging Het
Pik3c2g T C 6: 139,622,548 S221P probably damaging Het
Plppr3 A G 10: 79,866,425 I271T probably damaging Het
Prkar1b C T 5: 139,127,643 A41T probably benign Het
Prkcsh A G 9: 22,012,868 D458G probably damaging Het
Prr14 G T 7: 127,475,490 R398L possibly damaging Het
Ptafr A G 4: 132,579,985 R229G probably damaging Het
Rbp3 T C 14: 33,954,545 F150S probably damaging Het
Rel C T 11: 23,742,761 G424D probably benign Het
Rlf T C 4: 121,150,112 Y557C probably damaging Het
Samt3 A C X: 86,047,134 M211L probably benign Het
Selenop A T 15: 3,275,694 I111F probably damaging Het
Slc2a2 G A 3: 28,717,441 M173I probably benign Het
Slc43a1 G T 2: 84,856,889 G361V possibly damaging Het
Slit2 G A 5: 48,249,836 V870M probably damaging Het
Ssxb10 A G X: 8,331,019 D77G probably benign Het
Stk32b T A 5: 37,649,114 I29F probably damaging Het
Stra6l T A 4: 45,867,237 C161* probably null Het
Tecpr2 T A 12: 110,954,785 M1264K probably benign Het
Tfap2c A T 2: 172,557,236 I468F probably damaging Het
Ticam1 C T 17: 56,271,555 R180H probably damaging Het
Tlr4 T A 4: 66,841,035 N688K probably benign Het
Tmem35b A T 4: 127,126,053 probably benign Het
Ugt2b34 T C 5: 86,906,313 E203G probably damaging Het
Vegfa A C 17: 46,018,860 *393G probably null Het
Vmn2r16 T C 5: 109,364,024 V699A probably benign Het
Zfp324 T C 7: 12,971,218 S445P probably damaging Het
Zfp982 T A 4: 147,512,592 C135* probably null Het
Zfp990 A C 4: 145,536,869 N146H probably damaging Het
Zfyve26 A G 12: 79,255,243 Y431H possibly damaging Het
Other mutations in Crybg3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Crybg3 APN 16 59530440 missense probably benign 0.15
IGL01305:Crybg3 APN 16 59529227 missense probably damaging 1.00
IGL01809:Crybg3 APN 16 59524853 critical splice donor site probably benign 0.00
IGL02247:Crybg3 APN 16 59503150 missense probably damaging 1.00
IGL02252:Crybg3 APN 16 59552524 splice site probably benign
IGL03036:Crybg3 APN 16 59555179 missense possibly damaging 0.68
IGL03202:Crybg3 APN 16 59494709 missense probably damaging 1.00
IGL03232:Crybg3 APN 16 59530368 missense probably damaging 1.00
ANU22:Crybg3 UTSW 16 59529227 missense probably damaging 1.00
R0052:Crybg3 UTSW 16 59565656 splice site probably benign
R0335:Crybg3 UTSW 16 59544140 missense probably damaging 1.00
R0691:Crybg3 UTSW 16 59565211 critical splice donor site probably null
R1511:Crybg3 UTSW 16 59554112 missense probably benign 0.01
R1579:Crybg3 UTSW 16 59530198 missense probably damaging 1.00
R1965:Crybg3 UTSW 16 59503237 missense probably damaging 1.00
R2225:Crybg3 UTSW 16 59554678 missense probably damaging 1.00
R4074:Crybg3 UTSW 16 59555757 unclassified probably benign
R4210:Crybg3 UTSW 16 59544051 missense probably damaging 1.00
R4393:Crybg3 UTSW 16 59560095 unclassified probably benign
R4394:Crybg3 UTSW 16 59560095 unclassified probably benign
R4397:Crybg3 UTSW 16 59560095 unclassified probably benign
R4427:Crybg3 UTSW 16 59543199 missense probably damaging 1.00
R4578:Crybg3 UTSW 16 59530201 missense probably damaging 1.00
R4720:Crybg3 UTSW 16 59539817 missense probably damaging 1.00
R4917:Crybg3 UTSW 16 59530419 missense probably benign 0.14
R5007:Crybg3 UTSW 16 59558100 unclassified probably benign
R5020:Crybg3 UTSW 16 59554796 missense possibly damaging 0.55
R5155:Crybg3 UTSW 16 59524901 missense possibly damaging 0.91
R5306:Crybg3 UTSW 16 59559993 unclassified probably benign
R5342:Crybg3 UTSW 16 59522149 missense probably damaging 1.00
R5687:Crybg3 UTSW 16 59559166 missense probably benign 0.00
R5763:Crybg3 UTSW 16 59554610 missense possibly damaging 0.74
R5860:Crybg3 UTSW 16 59565269 missense probably damaging 1.00
R5950:Crybg3 UTSW 16 59493571 unclassified probably benign
R6007:Crybg3 UTSW 16 59554474 nonsense probably null
R6042:Crybg3 UTSW 16 59550475 missense possibly damaging 0.70
R6049:Crybg3 UTSW 16 59544054 missense probably benign 0.00
R6242:Crybg3 UTSW 16 59555690 missense probably benign
R6301:Crybg3 UTSW 16 59530338 missense probably damaging 1.00
R6408:Crybg3 UTSW 16 59495690 missense possibly damaging 0.71
R6724:Crybg3 UTSW 16 59544138 missense probably benign 0.13
R6745:Crybg3 UTSW 16 59552244 missense possibly damaging 0.93
R6777:Crybg3 UTSW 16 59558315 unclassified probably benign
R6843:Crybg3 UTSW 16 59559796 missense probably benign 0.22
R6914:Crybg3 UTSW 16 59539820 missense possibly damaging 0.89
R6942:Crybg3 UTSW 16 59539820 missense possibly damaging 0.89
R7033:Crybg3 UTSW 16 59554165 missense probably damaging 1.00
R7091:Crybg3 UTSW 16 59557168 missense possibly damaging 0.77
R7133:Crybg3 UTSW 16 59536804 missense probably damaging 1.00
R7193:Crybg3 UTSW 16 59559593 missense possibly damaging 0.87
R7204:Crybg3 UTSW 16 59558890 missense probably benign 0.00
R7398:Crybg3 UTSW 16 59557325 missense probably benign 0.38
R7666:Crybg3 UTSW 16 59559337 nonsense probably null
R7691:Crybg3 UTSW 16 59556134 missense not run
R7714:Crybg3 UTSW 16 59558873 missense probably benign 0.19
R7860:Crybg3 UTSW 16 59555242 missense probably benign 0.04
R7901:Crybg3 UTSW 16 59557544 missense probably damaging 0.98
R8371:Crybg3 UTSW 16 59557051 missense probably benign 0.00
R8394:Crybg3 UTSW 16 59558288 missense probably benign 0.06
R8438:Crybg3 UTSW 16 59565292 missense probably benign 0.02
R8529:Crybg3 UTSW 16 59556621 missense probably damaging 0.98
R8699:Crybg3 UTSW 16 59554928 missense probably damaging 1.00
R8766:Crybg3 UTSW 16 59555333 missense probably benign 0.05
R8767:Crybg3 UTSW 16 59556137 missense probably benign
R8789:Crybg3 UTSW 16 59554996 missense probably benign 0.00
R8871:Crybg3 UTSW 16 59558156 missense probably benign
R8878:Crybg3 UTSW 16 59560184 missense probably benign 0.09
R8894:Crybg3 UTSW 16 59522189 missense probably damaging 0.97
R8928:Crybg3 UTSW 16 59494760 missense probably benign 0.31
R8928:Crybg3 UTSW 16 59556352 missense probably benign 0.40
R8939:Crybg3 UTSW 16 59556149 missense probably benign 0.00
R9010:Crybg3 UTSW 16 59554339 missense probably damaging 0.98
R9266:Crybg3 UTSW 16 59552181 missense probably damaging 0.99
R9348:Crybg3 UTSW 16 59600893 start codon destroyed probably null 0.66
R9353:Crybg3 UTSW 16 59600744 critical splice donor site probably null
R9406:Crybg3 UTSW 16 59558476 missense probably benign 0.42
R9429:Crybg3 UTSW 16 59555193 missense probably benign 0.08
R9464:Crybg3 UTSW 16 59555757 unclassified probably benign
RF007:Crybg3 UTSW 16 59556704 missense possibly damaging 0.94
Z1177:Crybg3 UTSW 16 59555393 nonsense probably null
Z1177:Crybg3 UTSW 16 59556478 missense probably benign 0.09
Z1187:Crybg3 UTSW 16 59506245 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
Posted On 2014-08-25