Incidental Mutation 'R1982:Aqp4'
ID 220043
Institutional Source Beutler Lab
Gene Symbol Aqp4
Ensembl Gene ENSMUSG00000024411
Gene Name aquaporin 4
Synonyms aquaporin-4
MMRRC Submission 039994-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.195) question?
Stock # R1982 (G1)
Quality Score 225
Status Not validated
Chromosome 18
Chromosomal Location 15389394-15403684 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 15393551 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 291 (D291G)
Ref Sequence ENSEMBL: ENSMUSP00000078088 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079081]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000079081
AA Change: D291G

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000078088
Gene: ENSMUSG00000024411
AA Change: D291G

DomainStartEndE-ValueType
Pfam:MIP 29 248 8.7e-76 PFAM
Meta Mutation Damage Score 0.1057 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the aquaporin family of intrinsic membrane proteins that function as water-selective channels in the plasma membranes of many cells. This protein is the predominant aquaporin found in brain and has an important role in brain water homeostasis. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. A recent study provided evidence for translational readthrough in this gene and expression of an additional C-terminally extended isoform via the use of an alternative in-frame translation termination codon. [provided by RefSeq, Dec 2015]
PHENOTYPE: Homozygotes for a targeted mutation exhibit decreased urine osmolality associated with reduced water permeability in inner medullary collecting ducts, increased survival rates and reduced brain edema after acute water intoxication and ischemic stroke, aswell as significant hearing impairment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930415L06Rik A T X: 89,931,445 V382E probably damaging Het
Aatk G T 11: 120,013,514 P252Q probably damaging Het
Adamts4 T C 1: 171,258,934 V765A probably benign Het
Agfg2 A T 5: 137,664,253 V184E possibly damaging Het
Alas1 A T 9: 106,238,185 I48N probably damaging Het
Anks1 T C 17: 27,985,121 V181A probably damaging Het
Anxa8 A T 14: 34,096,570 R261S probably damaging Het
Atrn A G 2: 130,970,222 R696G probably benign Het
Barx2 A C 9: 31,913,012 I27S probably damaging Het
Btnl1 A T 17: 34,379,751 I114L possibly damaging Het
Casq1 C T 1: 172,215,530 A200T probably damaging Het
Ccdc33 T A 9: 58,117,168 E225D probably benign Het
Cd84 C A 1: 171,884,585 probably null Het
Ceacam9 T G 7: 16,725,307 L177R probably benign Het
Cenpi T A X: 134,318,033 F161L possibly damaging Het
Cep63 T C 9: 102,602,880 K251E probably damaging Het
Cetn3 A G 13: 81,784,697 E25G probably damaging Het
Crybg3 T C 16: 59,544,125 D2378G possibly damaging Het
Ddx19b T C 8: 111,009,343 T357A possibly damaging Het
Dpep2 A C 8: 105,989,455 Y266* probably null Het
Dqx1 G A 6: 83,058,577 D24N probably damaging Het
Dsg4 A T 18: 20,471,212 Y912F probably damaging Het
Fam71f2 A G 6: 29,285,922 T69A probably benign Het
Fezf2 G T 14: 12,344,405 P261T probably benign Het
Fmo1 T C 1: 162,839,756 I163M possibly damaging Het
Gatad2a G A 8: 69,913,132 R428* probably null Het
Gfpt1 T A 6: 87,054,630 F85I possibly damaging Het
Gimap7 A T 6: 48,724,241 I254F possibly damaging Het
Glcci1 T C 6: 8,592,980 S261P probably damaging Het
Glis3 A T 19: 28,531,274 F437I probably damaging Het
Glp1r C A 17: 30,925,627 S258* probably null Het
Gm13023 C A 4: 143,795,150 H445Q probably benign Het
Gm7030 T A 17: 36,128,722 D122V probably damaging Het
Gpt2 C T 8: 85,516,203 A288V possibly damaging Het
Grin2c G T 11: 115,260,905 S76R possibly damaging Het
Guf1 T A 5: 69,567,226 Y447* probably null Het
Hectd1 A C 12: 51,785,841 L916V probably damaging Het
Hnf4g A G 3: 3,638,208 K96E probably damaging Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Ifi207 T G 1: 173,735,239 M114L probably benign Het
Ifi35 A T 11: 101,458,286 E252V probably damaging Het
Igsf9b G A 9: 27,322,239 R345H possibly damaging Het
Itih3 T C 14: 30,923,583 probably benign Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 74 probably benign Het
Kidins220 A T 12: 25,051,194 M1252L probably benign Het
Kifap3 T A 1: 163,862,022 L525* probably null Het
Limk2 A T 11: 3,355,461 D35E probably benign Het
Lrrc37a G A 11: 103,498,966 P1878S probably benign Het
Mansc4 T A 6: 147,075,675 I148F probably benign Het
Mei1 A G 15: 82,103,312 N859S probably benign Het
Mib1 A G 18: 10,812,064 D987G probably damaging Het
Mroh8 A G 2: 157,271,975 V132A possibly damaging Het
Npnt T C 3: 132,948,132 I29M probably benign Het
Nrap T C 19: 56,384,105 D138G probably damaging Het
Olfr1 A T 11: 73,395,092 I310N probably benign Het
Olfr5 T C 7: 6,480,932 M75V probably benign Het
Olfr512 A G 7: 108,713,695 Y102C probably damaging Het
Olfr91 T A 17: 37,093,808 E22V probably damaging Het
Osbpl5 A C 7: 143,741,671 probably null Het
Pcna-ps2 T C 19: 9,283,683 V102A possibly damaging Het
Pik3c2g T C 6: 139,622,548 S221P probably damaging Het
Plppr3 A G 10: 79,866,425 I271T probably damaging Het
Prkar1b C T 5: 139,127,643 A41T probably benign Het
Prkcsh A G 9: 22,012,868 D458G probably damaging Het
Prr14 G T 7: 127,475,490 R398L possibly damaging Het
Ptafr A G 4: 132,579,985 R229G probably damaging Het
Rbp3 T C 14: 33,954,545 F150S probably damaging Het
Rel C T 11: 23,742,761 G424D probably benign Het
Rlf T C 4: 121,150,112 Y557C probably damaging Het
Samt3 A C X: 86,047,134 M211L probably benign Het
Selenop A T 15: 3,275,694 I111F probably damaging Het
Slc2a2 G A 3: 28,717,441 M173I probably benign Het
Slc43a1 G T 2: 84,856,889 G361V possibly damaging Het
Slit2 G A 5: 48,249,836 V870M probably damaging Het
Ssxb10 A G X: 8,331,019 D77G probably benign Het
Stk32b T A 5: 37,649,114 I29F probably damaging Het
Stra6l T A 4: 45,867,237 C161* probably null Het
Tecpr2 T A 12: 110,954,785 M1264K probably benign Het
Tfap2c A T 2: 172,557,236 I468F probably damaging Het
Ticam1 C T 17: 56,271,555 R180H probably damaging Het
Tlr4 T A 4: 66,841,035 N688K probably benign Het
Tmem35b A T 4: 127,126,053 probably benign Het
Ugt2b34 T C 5: 86,906,313 E203G probably damaging Het
Vegfa A C 17: 46,018,860 *393G probably null Het
Vmn2r16 T C 5: 109,364,024 V699A probably benign Het
Zfp324 T C 7: 12,971,218 S445P probably damaging Het
Zfp982 T A 4: 147,512,592 C135* probably null Het
Zfp990 A C 4: 145,536,869 N146H probably damaging Het
Zfyve26 A G 12: 79,255,243 Y431H possibly damaging Het
Other mutations in Aqp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00929:Aqp4 APN 18 15393599 missense probably benign 0.01
IGL01700:Aqp4 APN 18 15399865 missense probably benign 0.44
IGL02409:Aqp4 APN 18 15399725 missense probably benign 0.02
IGL02812:Aqp4 APN 18 15397575 splice site probably null
IGL03157:Aqp4 APN 18 15399980 missense probably benign 0.18
IGL03196:Aqp4 APN 18 15393509 missense probably benign 0.19
R0358:Aqp4 UTSW 18 15398245 missense probably benign
R1061:Aqp4 UTSW 18 15398191 missense probably damaging 1.00
R1981:Aqp4 UTSW 18 15393551 missense probably damaging 0.98
R2274:Aqp4 UTSW 18 15393480 missense probably benign
R3033:Aqp4 UTSW 18 15393560 missense possibly damaging 0.80
R4608:Aqp4 UTSW 18 15398126 missense probably benign 0.25
R4817:Aqp4 UTSW 18 15399758 missense probably damaging 1.00
R4882:Aqp4 UTSW 18 15398254 missense possibly damaging 0.73
R5870:Aqp4 UTSW 18 15399889 missense probably damaging 1.00
R6235:Aqp4 UTSW 18 15398113 missense probably damaging 1.00
R6334:Aqp4 UTSW 18 15393591 missense probably benign
R6856:Aqp4 UTSW 18 15399896 missense possibly damaging 0.88
R7753:Aqp4 UTSW 18 15399976 missense probably benign 0.00
R7839:Aqp4 UTSW 18 15399680 missense possibly damaging 0.51
R8191:Aqp4 UTSW 18 15398165 missense probably benign
R8206:Aqp4 UTSW 18 15393659 missense possibly damaging 0.88
R8759:Aqp4 UTSW 18 15399991 missense probably benign
R9614:Aqp4 UTSW 18 15393630 missense probably benign 0.01
T0970:Aqp4 UTSW 18 15399883 missense probably damaging 1.00
Z1177:Aqp4 UTSW 18 15399881 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- GTGTGAAGCAAGAAACCCGC -3'
(R):5'- TCCTCAGATATATTGGGTTGGAC -3'

Sequencing Primer
(F):5'- ACAAATCTGTTTCCTTAATGGGTGGC -3'
(R):5'- CCAATCATGGGCGCTGTG -3'
Posted On 2014-08-25