Mutagenetix > Incidental Mutation

Incidental Mutation 'R1982:Dsg4'

220045

Institutional Source

Beutler Lab

Gene Symbol

Dsg4

Ensembl Gene

ENSMUSG00000001804

Gene Name

desmoglein 4

Synonyms

lah, CDHF13

MMRRC Submission

039994-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.546) question?

Stock #

R1982 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

20436175-20471821 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 20471212 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Phenylalanine at position 912 (Y912F)

Ref Sequence

ENSEMBL: ENSMUSP00000019426 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000019426]

AlphaFold

Q7TMD7

Predicted Effect

probably damaging
Transcript: ENSMUST00000019426
AA Change: Y912F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000019426
Gene: ENSMUSG00000001804
AA Change: Y912F

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
CA	70	155	1.54e-11	SMART
CA	179	267	4.27e-19	SMART
CA	290	384	5.48e-8	SMART
CA	411	495	9.4e-7	SMART
transmembrane domain	634	656	N/A	INTRINSIC
low complexity region	724	736	N/A	INTRINSIC
Pfam:Cadherin_C	749	849	3.1e-8	PFAM

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.5%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a member of the cadherin family of proteins that forms an integral transmembrane component of desmosomes, the multiprotein complexes involved in cell adhesion, organization of the cytoskeleton, cell sorting and cell signaling. This gene is expressed in the suprabasal epidermis and hair follicle. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. Certain mutations in this gene are responsible for the lanceolate hair phenotype in mice. This gene is located in a cluster of desmosomal cadherin genes on chromosome 18. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice carrying mutations at this locus exhibit abnormalities in hair growth, vibrissae growth, and a thickened epidermis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 89 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930415L06Rik	A	T	X: 89,931,445	V382E	probably damaging	Het
Aatk	G	T	11: 120,013,514	P252Q	probably damaging	Het
Adamts4	T	C	1: 171,258,934	V765A	probably benign	Het
Agfg2	A	T	5: 137,664,253	V184E	possibly damaging	Het
Alas1	A	T	9: 106,238,185	I48N	probably damaging	Het
Anks1	T	C	17: 27,985,121	V181A	probably damaging	Het
Anxa8	A	T	14: 34,096,570	R261S	probably damaging	Het
Aqp4	T	C	18: 15,393,551	D291G	probably damaging	Het
Atrn	A	G	2: 130,970,222	R696G	probably benign	Het
Barx2	A	C	9: 31,913,012	I27S	probably damaging	Het
Btnl1	A	T	17: 34,379,751	I114L	possibly damaging	Het
Casq1	C	T	1: 172,215,530	A200T	probably damaging	Het
Ccdc33	T	A	9: 58,117,168	E225D	probably benign	Het
Cd84	C	A	1: 171,884,585		probably null	Het
Ceacam9	T	G	7: 16,725,307	L177R	probably benign	Het
Cenpi	T	A	X: 134,318,033	F161L	possibly damaging	Het
Cep63	T	C	9: 102,602,880	K251E	probably damaging	Het
Cetn3	A	G	13: 81,784,697	E25G	probably damaging	Het
Crybg3	T	C	16: 59,544,125	D2378G	possibly damaging	Het
Ddx19b	T	C	8: 111,009,343	T357A	possibly damaging	Het
Dpep2	A	C	8: 105,989,455	Y266*	probably null	Het
Dqx1	G	A	6: 83,058,577	D24N	probably damaging	Het
Fam71f2	A	G	6: 29,285,922	T69A	probably benign	Het
Fezf2	G	T	14: 12,344,405	P261T	probably benign	Het
Fmo1	T	C	1: 162,839,756	I163M	possibly damaging	Het
Gatad2a	G	A	8: 69,913,132	R428*	probably null	Het
Gfpt1	T	A	6: 87,054,630	F85I	possibly damaging	Het
Gimap7	A	T	6: 48,724,241	I254F	possibly damaging	Het
Glcci1	T	C	6: 8,592,980	S261P	probably damaging	Het
Glis3	A	T	19: 28,531,274	F437I	probably damaging	Het
Glp1r	C	A	17: 30,925,627	S258*	probably null	Het
Gm13023	C	A	4: 143,795,150	H445Q	probably benign	Het
Gm7030	T	A	17: 36,128,722	D122V	probably damaging	Het
Gpt2	C	T	8: 85,516,203	A288V	possibly damaging	Het
Grin2c	G	T	11: 115,260,905	S76R	possibly damaging	Het
Guf1	T	A	5: 69,567,226	Y447*	probably null	Het
Hectd1	A	C	12: 51,785,841	L916V	probably damaging	Het
Hnf4g	A	G	3: 3,638,208	K96E	probably damaging	Het
Hsh2d	G	A	8: 72,200,460	D229N	probably benign	Het
Ifi207	T	G	1: 173,735,239	M114L	probably benign	Het
Ifi35	A	T	11: 101,458,286	E252V	probably damaging	Het
Igsf9b	G	A	9: 27,322,239	R345H	possibly damaging	Het
Itih3	T	C	14: 30,923,583		probably benign	Het
Kcnh8	GAGACCAACGAGCAGCTGATGCTTCAGA	GAGA	17: 52,725,906	74	probably benign	Het
Kidins220	A	T	12: 25,051,194	M1252L	probably benign	Het
Kifap3	T	A	1: 163,862,022	L525*	probably null	Het
Limk2	A	T	11: 3,355,461	D35E	probably benign	Het
Lrrc37a	G	A	11: 103,498,966	P1878S	probably benign	Het
Mansc4	T	A	6: 147,075,675	I148F	probably benign	Het
Mei1	A	G	15: 82,103,312	N859S	probably benign	Het
Mib1	A	G	18: 10,812,064	D987G	probably damaging	Het
Mroh8	A	G	2: 157,271,975	V132A	possibly damaging	Het
Npnt	T	C	3: 132,948,132	I29M	probably benign	Het
Nrap	T	C	19: 56,384,105	D138G	probably damaging	Het
Olfr1	A	T	11: 73,395,092	I310N	probably benign	Het
Olfr5	T	C	7: 6,480,932	M75V	probably benign	Het
Olfr512	A	G	7: 108,713,695	Y102C	probably damaging	Het
Olfr91	T	A	17: 37,093,808	E22V	probably damaging	Het
Osbpl5	A	C	7: 143,741,671		probably null	Het
Pcna-ps2	T	C	19: 9,283,683	V102A	possibly damaging	Het
Pik3c2g	T	C	6: 139,622,548	S221P	probably damaging	Het
Plppr3	A	G	10: 79,866,425	I271T	probably damaging	Het
Prkar1b	C	T	5: 139,127,643	A41T	probably benign	Het
Prkcsh	A	G	9: 22,012,868	D458G	probably damaging	Het
Prr14	G	T	7: 127,475,490	R398L	possibly damaging	Het
Ptafr	A	G	4: 132,579,985	R229G	probably damaging	Het
Rbp3	T	C	14: 33,954,545	F150S	probably damaging	Het
Rel	C	T	11: 23,742,761	G424D	probably benign	Het
Rlf	T	C	4: 121,150,112	Y557C	probably damaging	Het
Samt3	A	C	X: 86,047,134	M211L	probably benign	Het
Selenop	A	T	15: 3,275,694	I111F	probably damaging	Het
Slc2a2	G	A	3: 28,717,441	M173I	probably benign	Het
Slc43a1	G	T	2: 84,856,889	G361V	possibly damaging	Het
Slit2	G	A	5: 48,249,836	V870M	probably damaging	Het
Ssxb10	A	G	X: 8,331,019	D77G	probably benign	Het
Stk32b	T	A	5: 37,649,114	I29F	probably damaging	Het
Stra6l	T	A	4: 45,867,237	C161*	probably null	Het
Tecpr2	T	A	12: 110,954,785	M1264K	probably benign	Het
Tfap2c	A	T	2: 172,557,236	I468F	probably damaging	Het
Ticam1	C	T	17: 56,271,555	R180H	probably damaging	Het
Tlr4	T	A	4: 66,841,035	N688K	probably benign	Het
Tmem35b	A	T	4: 127,126,053		probably benign	Het
Ugt2b34	T	C	5: 86,906,313	E203G	probably damaging	Het
Vegfa	A	C	17: 46,018,860	*393G	probably null	Het
Vmn2r16	T	C	5: 109,364,024	V699A	probably benign	Het
Zfp324	T	C	7: 12,971,218	S445P	probably damaging	Het
Zfp982	T	A	4: 147,512,592	C135*	probably null	Het
Zfp990	A	C	4: 145,536,869	N146H	probably damaging	Het
Zfyve26	A	G	12: 79,255,243	Y431H	possibly damaging	Het

Other mutations in Dsg4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00708:Dsg4	APN	18	20461326	missense	probably benign	0.22
IGL01723:Dsg4	APN	18	20466510	missense	probably damaging	1.00
IGL02249:Dsg4	APN	18	20461304	missense	possibly damaging	0.69
IGL02445:Dsg4	APN	18	20446250	splice site	probably benign
IGL02553:Dsg4	APN	18	20462520	missense	probably benign
IGL02578:Dsg4	APN	18	20471193	missense	possibly damaging	0.94
IGL02634:Dsg4	APN	18	20458580	missense	probably benign	0.01
IGL02677:Dsg4	APN	18	20464876	missense	possibly damaging	0.62
IGL02741:Dsg4	APN	18	20471496	missense	probably benign
IGL02747:Dsg4	APN	18	20446938	missense	probably damaging	0.97
IGL03342:Dsg4	APN	18	20451823	missense	probably damaging	1.00
burrito	UTSW	18	20451862	missense	possibly damaging	0.81
woodshed	UTSW	18	20451872	nonsense	probably null
R0043:Dsg4	UTSW	18	20452972	missense	probably damaging	1.00
R0375:Dsg4	UTSW	18	20470879	missense	probably damaging	1.00
R0537:Dsg4	UTSW	18	20458571	missense	probably damaging	1.00
R0619:Dsg4	UTSW	18	20461359	missense	probably benign	0.00
R0622:Dsg4	UTSW	18	20449788	missense	possibly damaging	0.51
R0765:Dsg4	UTSW	18	20454646	splice site	probably benign
R0786:Dsg4	UTSW	18	20449372	critical splice donor site	probably null
R1114:Dsg4	UTSW	18	20466483	missense	possibly damaging	0.62
R1249:Dsg4	UTSW	18	20446872	nonsense	probably null
R1372:Dsg4	UTSW	18	20449676	splice site	probably null
R1382:Dsg4	UTSW	18	20465124	missense	probably benign	0.00
R1392:Dsg4	UTSW	18	20446247	splice site	probably benign
R1442:Dsg4	UTSW	18	20462660	missense	possibly damaging	0.76
R1503:Dsg4	UTSW	18	20449679	missense	probably damaging	1.00
R1704:Dsg4	UTSW	18	20471589	missense	probably damaging	1.00
R1716:Dsg4	UTSW	18	20462461	nonsense	probably null
R1765:Dsg4	UTSW	18	20456831	missense	probably benign	0.01
R1817:Dsg4	UTSW	18	20471245	missense	probably damaging	1.00
R2025:Dsg4	UTSW	18	20466636	nonsense	probably null
R2097:Dsg4	UTSW	18	20471044	missense	probably damaging	1.00
R2198:Dsg4	UTSW	18	20461442	missense	probably benign
R3551:Dsg4	UTSW	18	20451756	missense	probably damaging	1.00
R3742:Dsg4	UTSW	18	20471001	missense	probably damaging	1.00
R3853:Dsg4	UTSW	18	20449234	missense	probably benign
R3955:Dsg4	UTSW	18	20449375	splice site	probably null
R4006:Dsg4	UTSW	18	20470965	missense	probably damaging	0.97
R4012:Dsg4	UTSW	18	20451862	missense	possibly damaging	0.81
R4171:Dsg4	UTSW	18	20458579	nonsense	probably null
R4254:Dsg4	UTSW	18	20471538	missense	probably benign	0.07
R4504:Dsg4	UTSW	18	20461436	missense	probably benign	0.00
R4559:Dsg4	UTSW	18	20470921	missense	probably damaging	1.00
R4607:Dsg4	UTSW	18	20471245	missense	probably damaging	1.00
R4612:Dsg4	UTSW	18	20462413	missense	probably benign	0.10
R4683:Dsg4	UTSW	18	20461409	missense	probably benign
R4700:Dsg4	UTSW	18	20456908	missense	possibly damaging	0.91
R4749:Dsg4	UTSW	18	20446831	missense	possibly damaging	0.88
R4775:Dsg4	UTSW	18	20471127	missense	possibly damaging	0.48
R4809:Dsg4	UTSW	18	20466621	missense	possibly damaging	0.82
R5276:Dsg4	UTSW	18	20446839	missense	probably benign	0.21
R5426:Dsg4	UTSW	18	20458484	missense	probably damaging	1.00
R5767:Dsg4	UTSW	18	20462492	nonsense	probably null
R5982:Dsg4	UTSW	18	20465169	missense	possibly damaging	0.76
R6280:Dsg4	UTSW	18	20466667	missense	probably damaging	1.00
R6305:Dsg4	UTSW	18	20449790	missense	probably damaging	1.00
R6489:Dsg4	UTSW	18	20471363	missense	possibly damaging	0.93
R7013:Dsg4	UTSW	18	20458521	missense	possibly damaging	0.58
R7040:Dsg4	UTSW	18	20451852	missense	probably benign	0.01
R7196:Dsg4	UTSW	18	20466480	missense	probably damaging	1.00
R7432:Dsg4	UTSW	18	20446266	nonsense	probably null
R7438:Dsg4	UTSW	18	20466628	missense	probably damaging	0.96
R7490:Dsg4	UTSW	18	20451936	splice site	probably null
R7612:Dsg4	UTSW	18	20470990	missense	probably damaging	1.00
R7639:Dsg4	UTSW	18	20449712	missense	probably damaging	1.00
R7905:Dsg4	UTSW	18	20454669	missense	probably damaging	1.00
R8251:Dsg4	UTSW	18	20471164	missense	probably damaging	1.00
R8326:Dsg4	UTSW	18	20449731	missense	probably benign	0.31
R8554:Dsg4	UTSW	18	20453043	missense	probably damaging	1.00
R8911:Dsg4	UTSW	18	20451872	nonsense	probably null
R9059:Dsg4	UTSW	18	20471125	missense	possibly damaging	0.62
R9508:Dsg4	UTSW	18	20471013	missense	probably damaging	1.00
R9607:Dsg4	UTSW	18	20452990	missense	probably benign	0.00
R9765:Dsg4	UTSW	18	20471277	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- ACAGAGATTGAACCCTTCCCTTC -3'
(R):5'- TGTTACTGTTGCCCATGTCAG -3'

Sequencing Primer
(F):5'- TTCACACCAGGCCTGTATACC -3'
(R):5'- GTTGCCCATGTCAGGTATACCAG -3'

Posted On

2014-08-25