Incidental Mutation 'R1982:Dsg4'
ID 220045
Institutional Source Beutler Lab
Gene Symbol Dsg4
Ensembl Gene ENSMUSG00000001804
Gene Name desmoglein 4
Synonyms CDHF13, lah
MMRRC Submission 039994-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.507) question?
Stock # R1982 (G1)
Quality Score 225
Status Not validated
Chromosome 18
Chromosomal Location 20569232-20604878 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 20604269 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 912 (Y912F)
Ref Sequence ENSEMBL: ENSMUSP00000019426 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019426]
AlphaFold Q7TMD7
Predicted Effect probably damaging
Transcript: ENSMUST00000019426
AA Change: Y912F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000019426
Gene: ENSMUSG00000001804
AA Change: Y912F

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
CA 70 155 1.54e-11 SMART
CA 179 267 4.27e-19 SMART
CA 290 384 5.48e-8 SMART
CA 411 495 9.4e-7 SMART
transmembrane domain 634 656 N/A INTRINSIC
low complexity region 724 736 N/A INTRINSIC
Pfam:Cadherin_C 749 849 3.1e-8 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the cadherin family of proteins that forms an integral transmembrane component of desmosomes, the multiprotein complexes involved in cell adhesion, organization of the cytoskeleton, cell sorting and cell signaling. This gene is expressed in the suprabasal epidermis and hair follicle. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. Certain mutations in this gene are responsible for the lanceolate hair phenotype in mice. This gene is located in a cluster of desmosomal cadherin genes on chromosome 18. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice carrying mutations at this locus exhibit abnormalities in hair growth, vibrissae growth, and a thickened epidermis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk G T 11: 119,904,340 (GRCm39) P252Q probably damaging Het
Adamts4 T C 1: 171,086,503 (GRCm39) V765A probably benign Het
Agfg2 A T 5: 137,662,515 (GRCm39) V184E possibly damaging Het
Alas1 A T 9: 106,115,384 (GRCm39) I48N probably damaging Het
Anks1 T C 17: 28,204,095 (GRCm39) V181A probably damaging Het
Anxa8 A T 14: 33,818,527 (GRCm39) R261S probably damaging Het
Aqp4 T C 18: 15,526,608 (GRCm39) D291G probably damaging Het
Atrn A G 2: 130,812,142 (GRCm39) R696G probably benign Het
Barx2 A C 9: 31,824,308 (GRCm39) I27S probably damaging Het
Btnl1 A T 17: 34,598,725 (GRCm39) I114L possibly damaging Het
Casq1 C T 1: 172,043,097 (GRCm39) A200T probably damaging Het
Ccdc33 T A 9: 58,024,451 (GRCm39) E225D probably benign Het
Cd84 C A 1: 171,712,152 (GRCm39) probably null Het
Ceacam9 T G 7: 16,459,232 (GRCm39) L177R probably benign Het
Cenpi T A X: 133,218,782 (GRCm39) F161L possibly damaging Het
Cep63 T C 9: 102,480,079 (GRCm39) K251E probably damaging Het
Cetn3 A G 13: 81,932,816 (GRCm39) E25G probably damaging Het
Crybg3 T C 16: 59,364,488 (GRCm39) D2378G possibly damaging Het
Ddx19b T C 8: 111,735,975 (GRCm39) T357A possibly damaging Het
Dpep2 A C 8: 106,716,087 (GRCm39) Y266* probably null Het
Dqx1 G A 6: 83,035,558 (GRCm39) D24N probably damaging Het
Fezf2 G T 14: 12,344,405 (GRCm38) P261T probably benign Het
Fmo1 T C 1: 162,667,325 (GRCm39) I163M possibly damaging Het
Garin1a A G 6: 29,285,921 (GRCm39) T69A probably benign Het
Gatad2a G A 8: 70,365,782 (GRCm39) R428* probably null Het
Gfpt1 T A 6: 87,031,612 (GRCm39) F85I possibly damaging Het
Gimap7 A T 6: 48,701,175 (GRCm39) I254F possibly damaging Het
Glcci1 T C 6: 8,592,980 (GRCm39) S261P probably damaging Het
Glis3 A T 19: 28,508,674 (GRCm39) F437I probably damaging Het
Glp1r C A 17: 31,144,601 (GRCm39) S258* probably null Het
Gpt2 C T 8: 86,242,832 (GRCm39) A288V possibly damaging Het
Grin2c G T 11: 115,151,731 (GRCm39) S76R possibly damaging Het
Guf1 T A 5: 69,724,569 (GRCm39) Y447* probably null Het
H2-T9 T A 17: 36,439,614 (GRCm39) D122V probably damaging Het
Hectd1 A C 12: 51,832,624 (GRCm39) L916V probably damaging Het
Hnf4g A G 3: 3,703,268 (GRCm39) K96E probably damaging Het
Hsh2d G A 8: 72,954,304 (GRCm39) D229N probably benign Het
Ifi207 T G 1: 173,562,805 (GRCm39) M114L probably benign Het
Ifi35 A T 11: 101,349,112 (GRCm39) E252V probably damaging Het
Igsf9b G A 9: 27,233,535 (GRCm39) R345H possibly damaging Het
Itih3 T C 14: 30,645,540 (GRCm39) probably benign Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 53,032,934 (GRCm39) 74 probably benign Het
Kidins220 A T 12: 25,101,193 (GRCm39) M1252L probably benign Het
Kifap3 T A 1: 163,689,591 (GRCm39) L525* probably null Het
Limk2 A T 11: 3,305,461 (GRCm39) D35E probably benign Het
Lrrc37a G A 11: 103,389,792 (GRCm39) P1878S probably benign Het
Mansc4 T A 6: 146,977,173 (GRCm39) I148F probably benign Het
Mei1 A G 15: 81,987,513 (GRCm39) N859S probably benign Het
Mib1 A G 18: 10,812,064 (GRCm39) D987G probably damaging Het
Mroh8 A G 2: 157,113,895 (GRCm39) V132A possibly damaging Het
Npnt T C 3: 132,653,893 (GRCm39) I29M probably benign Het
Nrap T C 19: 56,372,537 (GRCm39) D138G probably damaging Het
Or10a3m A G 7: 108,312,902 (GRCm39) Y102C probably damaging Het
Or1e16 A T 11: 73,285,918 (GRCm39) I310N probably benign Het
Or2h1 T A 17: 37,404,700 (GRCm39) E22V probably damaging Het
Or6z7 T C 7: 6,483,931 (GRCm39) M75V probably benign Het
Osbpl5 A C 7: 143,295,408 (GRCm39) probably null Het
Pcna-ps2 T C 19: 9,261,047 (GRCm39) V102A possibly damaging Het
Pik3c2g T C 6: 139,599,546 (GRCm39) S221P probably damaging Het
Plppr3 A G 10: 79,702,259 (GRCm39) I271T probably damaging Het
Ppp4r3c1 A T X: 88,975,051 (GRCm39) V382E probably damaging Het
Pramel25 C A 4: 143,521,720 (GRCm39) H445Q probably benign Het
Prkar1b C T 5: 139,113,398 (GRCm39) A41T probably benign Het
Prkcsh A G 9: 21,924,164 (GRCm39) D458G probably damaging Het
Prr14 G T 7: 127,074,662 (GRCm39) R398L possibly damaging Het
Ptafr A G 4: 132,307,296 (GRCm39) R229G probably damaging Het
Rbp3 T C 14: 33,676,502 (GRCm39) F150S probably damaging Het
Rel C T 11: 23,692,761 (GRCm39) G424D probably benign Het
Rlf T C 4: 121,007,309 (GRCm39) Y557C probably damaging Het
Samt3 A C X: 85,090,740 (GRCm39) M211L probably benign Het
Selenop A T 15: 3,305,176 (GRCm39) I111F probably damaging Het
Slc2a2 G A 3: 28,771,590 (GRCm39) M173I probably benign Het
Slc43a1 G T 2: 84,687,233 (GRCm39) G361V possibly damaging Het
Slit2 G A 5: 48,407,178 (GRCm39) V870M probably damaging Het
Ssxb10 A G X: 8,197,258 (GRCm39) D77G probably benign Het
Stk32b T A 5: 37,806,458 (GRCm39) I29F probably damaging Het
Stra6l T A 4: 45,867,237 (GRCm39) C161* probably null Het
Tecpr2 T A 12: 110,921,219 (GRCm39) M1264K probably benign Het
Tfap2c A T 2: 172,399,156 (GRCm39) I468F probably damaging Het
Ticam1 C T 17: 56,578,555 (GRCm39) R180H probably damaging Het
Tlr4 T A 4: 66,759,272 (GRCm39) N688K probably benign Het
Tmem35b A T 4: 127,019,846 (GRCm39) probably benign Het
Ugt2b34 T C 5: 87,054,172 (GRCm39) E203G probably damaging Het
Vegfa A C 17: 46,329,786 (GRCm39) *393G probably null Het
Vmn2r16 T C 5: 109,511,890 (GRCm39) V699A probably benign Het
Zfp324 T C 7: 12,705,145 (GRCm39) S445P probably damaging Het
Zfp982 T A 4: 147,597,049 (GRCm39) C135* probably null Het
Zfp990 A C 4: 145,263,439 (GRCm39) N146H probably damaging Het
Zfyve26 A G 12: 79,302,017 (GRCm39) Y431H possibly damaging Het
Other mutations in Dsg4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00708:Dsg4 APN 18 20,594,383 (GRCm39) missense probably benign 0.22
IGL01723:Dsg4 APN 18 20,599,567 (GRCm39) missense probably damaging 1.00
IGL02249:Dsg4 APN 18 20,594,361 (GRCm39) missense possibly damaging 0.69
IGL02445:Dsg4 APN 18 20,579,307 (GRCm39) splice site probably benign
IGL02553:Dsg4 APN 18 20,595,577 (GRCm39) missense probably benign
IGL02578:Dsg4 APN 18 20,604,250 (GRCm39) missense possibly damaging 0.94
IGL02634:Dsg4 APN 18 20,591,637 (GRCm39) missense probably benign 0.01
IGL02677:Dsg4 APN 18 20,597,933 (GRCm39) missense possibly damaging 0.62
IGL02741:Dsg4 APN 18 20,604,553 (GRCm39) missense probably benign
IGL02747:Dsg4 APN 18 20,579,995 (GRCm39) missense probably damaging 0.97
IGL03342:Dsg4 APN 18 20,584,880 (GRCm39) missense probably damaging 1.00
burrito UTSW 18 20,584,919 (GRCm39) missense possibly damaging 0.81
woodshed UTSW 18 20,584,929 (GRCm39) nonsense probably null
R0043:Dsg4 UTSW 18 20,586,029 (GRCm39) missense probably damaging 1.00
R0375:Dsg4 UTSW 18 20,603,936 (GRCm39) missense probably damaging 1.00
R0537:Dsg4 UTSW 18 20,591,628 (GRCm39) missense probably damaging 1.00
R0619:Dsg4 UTSW 18 20,594,416 (GRCm39) missense probably benign 0.00
R0622:Dsg4 UTSW 18 20,582,845 (GRCm39) missense possibly damaging 0.51
R0765:Dsg4 UTSW 18 20,587,703 (GRCm39) splice site probably benign
R0786:Dsg4 UTSW 18 20,582,429 (GRCm39) critical splice donor site probably null
R1114:Dsg4 UTSW 18 20,599,540 (GRCm39) missense possibly damaging 0.62
R1249:Dsg4 UTSW 18 20,579,929 (GRCm39) nonsense probably null
R1372:Dsg4 UTSW 18 20,582,733 (GRCm39) splice site probably null
R1382:Dsg4 UTSW 18 20,598,181 (GRCm39) missense probably benign 0.00
R1392:Dsg4 UTSW 18 20,579,304 (GRCm39) splice site probably benign
R1442:Dsg4 UTSW 18 20,595,717 (GRCm39) missense possibly damaging 0.76
R1503:Dsg4 UTSW 18 20,582,736 (GRCm39) missense probably damaging 1.00
R1704:Dsg4 UTSW 18 20,604,646 (GRCm39) missense probably damaging 1.00
R1716:Dsg4 UTSW 18 20,595,518 (GRCm39) nonsense probably null
R1765:Dsg4 UTSW 18 20,589,888 (GRCm39) missense probably benign 0.01
R1817:Dsg4 UTSW 18 20,604,302 (GRCm39) missense probably damaging 1.00
R2025:Dsg4 UTSW 18 20,599,693 (GRCm39) nonsense probably null
R2097:Dsg4 UTSW 18 20,604,101 (GRCm39) missense probably damaging 1.00
R2198:Dsg4 UTSW 18 20,594,499 (GRCm39) missense probably benign
R3551:Dsg4 UTSW 18 20,584,813 (GRCm39) missense probably damaging 1.00
R3742:Dsg4 UTSW 18 20,604,058 (GRCm39) missense probably damaging 1.00
R3853:Dsg4 UTSW 18 20,582,291 (GRCm39) missense probably benign
R3955:Dsg4 UTSW 18 20,582,432 (GRCm39) splice site probably null
R4006:Dsg4 UTSW 18 20,604,022 (GRCm39) missense probably damaging 0.97
R4012:Dsg4 UTSW 18 20,584,919 (GRCm39) missense possibly damaging 0.81
R4171:Dsg4 UTSW 18 20,591,636 (GRCm39) nonsense probably null
R4254:Dsg4 UTSW 18 20,604,595 (GRCm39) missense probably benign 0.07
R4504:Dsg4 UTSW 18 20,594,493 (GRCm39) missense probably benign 0.00
R4559:Dsg4 UTSW 18 20,603,978 (GRCm39) missense probably damaging 1.00
R4607:Dsg4 UTSW 18 20,604,302 (GRCm39) missense probably damaging 1.00
R4612:Dsg4 UTSW 18 20,595,470 (GRCm39) missense probably benign 0.10
R4683:Dsg4 UTSW 18 20,594,466 (GRCm39) missense probably benign
R4700:Dsg4 UTSW 18 20,589,965 (GRCm39) missense possibly damaging 0.91
R4749:Dsg4 UTSW 18 20,579,888 (GRCm39) missense possibly damaging 0.88
R4775:Dsg4 UTSW 18 20,604,184 (GRCm39) missense possibly damaging 0.48
R4809:Dsg4 UTSW 18 20,599,678 (GRCm39) missense possibly damaging 0.82
R5276:Dsg4 UTSW 18 20,579,896 (GRCm39) missense probably benign 0.21
R5426:Dsg4 UTSW 18 20,591,541 (GRCm39) missense probably damaging 1.00
R5767:Dsg4 UTSW 18 20,595,549 (GRCm39) nonsense probably null
R5982:Dsg4 UTSW 18 20,598,226 (GRCm39) missense possibly damaging 0.76
R6280:Dsg4 UTSW 18 20,599,724 (GRCm39) missense probably damaging 1.00
R6305:Dsg4 UTSW 18 20,582,847 (GRCm39) missense probably damaging 1.00
R6489:Dsg4 UTSW 18 20,604,420 (GRCm39) missense possibly damaging 0.93
R7013:Dsg4 UTSW 18 20,591,578 (GRCm39) missense possibly damaging 0.58
R7040:Dsg4 UTSW 18 20,584,909 (GRCm39) missense probably benign 0.01
R7196:Dsg4 UTSW 18 20,599,537 (GRCm39) missense probably damaging 1.00
R7432:Dsg4 UTSW 18 20,579,323 (GRCm39) nonsense probably null
R7438:Dsg4 UTSW 18 20,599,685 (GRCm39) missense probably damaging 0.96
R7490:Dsg4 UTSW 18 20,584,993 (GRCm39) splice site probably null
R7612:Dsg4 UTSW 18 20,604,047 (GRCm39) missense probably damaging 1.00
R7639:Dsg4 UTSW 18 20,582,769 (GRCm39) missense probably damaging 1.00
R7905:Dsg4 UTSW 18 20,587,726 (GRCm39) missense probably damaging 1.00
R8251:Dsg4 UTSW 18 20,604,221 (GRCm39) missense probably damaging 1.00
R8326:Dsg4 UTSW 18 20,582,788 (GRCm39) missense probably benign 0.31
R8554:Dsg4 UTSW 18 20,586,100 (GRCm39) missense probably damaging 1.00
R8911:Dsg4 UTSW 18 20,584,929 (GRCm39) nonsense probably null
R9059:Dsg4 UTSW 18 20,604,182 (GRCm39) missense possibly damaging 0.62
R9508:Dsg4 UTSW 18 20,604,070 (GRCm39) missense probably damaging 1.00
R9607:Dsg4 UTSW 18 20,586,047 (GRCm39) missense probably benign 0.00
R9765:Dsg4 UTSW 18 20,604,334 (GRCm39) missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- ACAGAGATTGAACCCTTCCCTTC -3'
(R):5'- TGTTACTGTTGCCCATGTCAG -3'

Sequencing Primer
(F):5'- TTCACACCAGGCCTGTATACC -3'
(R):5'- GTTGCCCATGTCAGGTATACCAG -3'
Posted On 2014-08-25