Incidental Mutation 'R1982:Nrap'
Institutional Source Beutler Lab
Gene Symbol Nrap
Ensembl Gene ENSMUSG00000049134
Gene Namenebulin-related anchoring protein
MMRRC Submission 039994-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1982 (G1)
Quality Score225
Status Not validated
Chromosomal Location56320035-56390037 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 56384105 bp
Amino Acid Change Aspartic acid to Glycine at position 138 (D138G)
Ref Sequence ENSEMBL: ENSMUSP00000128196 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040711] [ENSMUST00000073536] [ENSMUST00000095947] [ENSMUST00000166203] [ENSMUST00000167239]
Predicted Effect possibly damaging
Transcript: ENSMUST00000040711
AA Change: D138G

PolyPhen 2 Score 0.824 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000048364
Gene: ENSMUSG00000049134
AA Change: D138G

LIM 5 57 5.39e-11 SMART
NEBU 64 94 2.17e1 SMART
NEBU 168 197 1.94e-4 SMART
NEBU 202 232 1.39e-5 SMART
NEBU 239 268 2.23e-4 SMART
NEBU 308 337 2.83e-6 SMART
NEBU 346 376 3.82e-3 SMART
NEBU 382 412 1.18e-3 SMART
NEBU 450 480 8.97e-9 SMART
NEBU 485 515 1.73e-10 SMART
NEBU 521 551 8.12e-7 SMART
NEBU 555 585 1.73e-1 SMART
NEBU 590 620 2.33e-7 SMART
NEBU 621 651 1.49e-5 SMART
NEBU 655 686 5.12e-4 SMART
NEBU 689 719 8.12e-7 SMART
NEBU 724 754 2.64e-6 SMART
NEBU 760 790 3.48e-6 SMART
NEBU 798 828 2.35e-3 SMART
NEBU 833 863 6.11e-2 SMART
NEBU 864 894 1.69e-4 SMART
NEBU 899 929 3.88e-4 SMART
NEBU 932 962 4e-6 SMART
NEBU 967 997 4.22e-5 SMART
NEBU 1003 1033 2.64e-6 SMART
NEBU 1041 1071 3.68e-5 SMART
NEBU 1076 1106 4.16e-4 SMART
NEBU 1107 1137 1.1e-3 SMART
NEBU 1142 1172 1.68e1 SMART
NEBU 1175 1205 4.59e-6 SMART
NEBU 1210 1240 4.06e-7 SMART
NEBU 1246 1276 1.99e-1 SMART
NEBU 1284 1314 1.85e-1 SMART
NEBU 1319 1349 1.39e-5 SMART
NEBU 1350 1380 4.03e-2 SMART
NEBU 1385 1415 1.76e-2 SMART
NEBU 1418 1448 2.09e0 SMART
NEBU 1453 1483 6.4e-5 SMART
NEBU 1489 1519 8.63e-1 SMART
NEBU 1527 1557 1.33e-2 SMART
NEBU 1562 1592 1.84e-5 SMART
NEBU 1593 1623 7.24e-4 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000073536
AA Change: D138G

PolyPhen 2 Score 0.824 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000073228
Gene: ENSMUSG00000049134
AA Change: D138G

LIM 5 57 5.39e-11 SMART
NEBU 64 94 2.17e1 SMART
NEBU 168 197 1.94e-4 SMART
NEBU 202 232 1.39e-5 SMART
NEBU 239 268 2.23e-4 SMART
NEBU 308 337 2.83e-6 SMART
NEBU 346 376 7.24e-4 SMART
NEBU 381 411 3.46e-1 SMART
NEBU 417 447 1.18e-3 SMART
NEBU 485 515 8.97e-9 SMART
NEBU 520 550 1.73e-10 SMART
NEBU 556 586 8.12e-7 SMART
NEBU 590 620 1.73e-1 SMART
NEBU 625 655 2.33e-7 SMART
NEBU 656 686 1.49e-5 SMART
NEBU 690 721 5.12e-4 SMART
NEBU 724 754 8.12e-7 SMART
NEBU 759 789 2.64e-6 SMART
NEBU 795 825 3.48e-6 SMART
NEBU 833 863 2.35e-3 SMART
NEBU 868 898 6.11e-2 SMART
NEBU 899 929 1.69e-4 SMART
NEBU 934 964 3.88e-4 SMART
NEBU 967 997 4e-6 SMART
NEBU 1002 1032 4.22e-5 SMART
NEBU 1038 1068 2.64e-6 SMART
NEBU 1076 1106 3.68e-5 SMART
NEBU 1111 1141 4.16e-4 SMART
NEBU 1142 1172 1.1e-3 SMART
NEBU 1177 1207 1.68e1 SMART
NEBU 1210 1240 4.59e-6 SMART
NEBU 1245 1275 4.06e-7 SMART
NEBU 1281 1311 1.99e-1 SMART
NEBU 1319 1349 1.85e-1 SMART
NEBU 1354 1384 1.39e-5 SMART
NEBU 1385 1415 4.03e-2 SMART
NEBU 1420 1450 1.76e-2 SMART
NEBU 1453 1483 2.09e0 SMART
NEBU 1488 1518 6.4e-5 SMART
NEBU 1524 1554 8.63e-1 SMART
NEBU 1562 1592 1.33e-2 SMART
NEBU 1597 1627 1.84e-5 SMART
NEBU 1628 1658 7.24e-4 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000095947
AA Change: D56G

PolyPhen 2 Score 0.890 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000093640
Gene: ENSMUSG00000049134
AA Change: D56G

NEBU 86 115 1.2e-6 SMART
NEBU 120 150 9.1e-8 SMART
NEBU 157 186 1.4e-6 SMART
NEBU 226 255 1.8e-8 SMART
NEBU 264 294 2.5e-5 SMART
NEBU 300 330 7.8e-6 SMART
NEBU 368 398 6e-11 SMART
NEBU 403 433 1.1e-12 SMART
NEBU 439 469 5.2e-9 SMART
NEBU 473 503 1.1e-3 SMART
NEBU 508 538 1.5e-9 SMART
NEBU 539 569 1e-7 SMART
NEBU 573 604 3.3e-6 SMART
NEBU 607 637 5.4e-9 SMART
NEBU 642 672 1.7e-8 SMART
NEBU 678 708 2.3e-8 SMART
NEBU 716 746 1.5e-5 SMART
NEBU 751 781 4.1e-4 SMART
NEBU 782 812 1.1e-6 SMART
NEBU 817 847 2.6e-6 SMART
NEBU 850 880 2.6e-8 SMART
NEBU 885 915 2.7e-7 SMART
NEBU 921 951 1.7e-8 SMART
NEBU 959 989 2.4e-7 SMART
NEBU 994 1024 2.7e-6 SMART
NEBU 1025 1055 7.2e-6 SMART
NEBU 1060 1090 1.1e-1 SMART
NEBU 1093 1123 3e-8 SMART
NEBU 1128 1158 2.6e-9 SMART
NEBU 1164 1194 1.3e-3 SMART
NEBU 1202 1232 1.2e-3 SMART
NEBU 1237 1267 8.8e-8 SMART
NEBU 1268 1298 2.7e-4 SMART
NEBU 1303 1333 1.2e-4 SMART
NEBU 1336 1366 1.4e-2 SMART
NEBU 1371 1401 4.3e-7 SMART
NEBU 1407 1437 5.6e-3 SMART
NEBU 1445 1475 8.8e-5 SMART
NEBU 1480 1510 1.2e-7 SMART
NEBU 1511 1541 4.8e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000166203
AA Change: D138G

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000132582
Gene: ENSMUSG00000049134
AA Change: D138G

LIM 5 57 5.39e-11 SMART
NEBU 64 94 2.17e1 SMART
NEBU 168 197 1.94e-4 SMART
NEBU 202 232 1.39e-5 SMART
NEBU 239 268 2.23e-4 SMART
NEBU 308 337 2.83e-6 SMART
NEBU 346 376 7.24e-4 SMART
NEBU 381 411 3.46e-1 SMART
NEBU 417 447 1.18e-3 SMART
NEBU 485 515 8.97e-9 SMART
NEBU 520 550 1.06e-10 SMART
NEBU 554 584 1.73e-1 SMART
NEBU 589 619 2.33e-7 SMART
NEBU 620 650 1.49e-5 SMART
NEBU 654 685 5.12e-4 SMART
NEBU 688 718 8.12e-7 SMART
NEBU 723 753 2.64e-6 SMART
NEBU 759 789 3.48e-6 SMART
NEBU 797 827 2.35e-3 SMART
NEBU 832 862 6.11e-2 SMART
NEBU 863 893 1.69e-4 SMART
NEBU 898 928 3.88e-4 SMART
NEBU 931 961 4e-6 SMART
NEBU 966 996 4.22e-5 SMART
NEBU 1002 1032 2.64e-6 SMART
NEBU 1040 1070 3.68e-5 SMART
NEBU 1075 1105 4.16e-4 SMART
NEBU 1106 1136 1.1e-3 SMART
NEBU 1141 1171 1.68e1 SMART
NEBU 1174 1204 4.59e-6 SMART
NEBU 1209 1239 4.06e-7 SMART
NEBU 1245 1275 1.99e-1 SMART
NEBU 1283 1313 1.85e-1 SMART
NEBU 1318 1348 1.39e-5 SMART
NEBU 1349 1379 4.03e-2 SMART
NEBU 1384 1414 1.76e-2 SMART
NEBU 1417 1447 2.09e0 SMART
NEBU 1452 1482 6.4e-5 SMART
NEBU 1488 1518 8.63e-1 SMART
NEBU 1526 1556 1.33e-2 SMART
NEBU 1561 1591 1.84e-5 SMART
NEBU 1592 1622 7.24e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000167239
AA Change: D138G

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000128196
Gene: ENSMUSG00000049134
AA Change: D138G

LIM 5 57 5.39e-11 SMART
NEBU 64 94 2.17e1 SMART
NEBU 168 197 1.94e-4 SMART
NEBU 202 232 1.39e-5 SMART
NEBU 239 268 2.23e-4 SMART
NEBU 308 337 2.83e-6 SMART
NEBU 346 376 3.82e-3 SMART
NEBU 382 412 1.18e-3 SMART
NEBU 450 480 8.97e-9 SMART
NEBU 485 515 1.73e-10 SMART
NEBU 521 551 8.12e-7 SMART
NEBU 555 585 1.73e-1 SMART
NEBU 590 620 2.33e-7 SMART
NEBU 621 651 1.49e-5 SMART
NEBU 655 686 5.12e-4 SMART
NEBU 689 719 8.12e-7 SMART
NEBU 724 754 2.64e-6 SMART
NEBU 760 790 3.48e-6 SMART
NEBU 798 828 2.35e-3 SMART
NEBU 833 863 6.11e-2 SMART
NEBU 864 894 1.69e-4 SMART
NEBU 899 929 3.88e-4 SMART
NEBU 932 962 4e-6 SMART
NEBU 967 997 4.22e-5 SMART
NEBU 1003 1033 2.64e-6 SMART
NEBU 1041 1071 3.68e-5 SMART
NEBU 1076 1106 4.16e-4 SMART
NEBU 1107 1137 1.1e-3 SMART
NEBU 1142 1172 1.68e1 SMART
NEBU 1175 1205 4.59e-6 SMART
NEBU 1210 1240 4.06e-7 SMART
NEBU 1246 1276 1.99e-1 SMART
NEBU 1284 1314 1.85e-1 SMART
NEBU 1319 1349 1.39e-5 SMART
NEBU 1350 1380 4.03e-2 SMART
NEBU 1385 1415 3.06e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000169099
SMART Domains Protein: ENSMUSP00000125889
Gene: ENSMUSG00000049134

NEBU 32 61 2.83e-6 SMART
NEBU 70 100 7.24e-4 SMART
NEBU 105 135 3.46e-1 SMART
NEBU 141 171 1.18e-3 SMART
NEBU 209 239 8.97e-9 SMART
NEBU 244 274 1.73e-10 SMART
NEBU 280 310 8.12e-7 SMART
NEBU 314 344 1.73e-1 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930415L06Rik A T X: 89,931,445 V382E probably damaging Het
Aatk G T 11: 120,013,514 P252Q probably damaging Het
Adamts4 T C 1: 171,258,934 V765A probably benign Het
Agfg2 A T 5: 137,664,253 V184E possibly damaging Het
Alas1 A T 9: 106,238,185 I48N probably damaging Het
Anks1 T C 17: 27,985,121 V181A probably damaging Het
Anxa8 A T 14: 34,096,570 R261S probably damaging Het
Aqp4 T C 18: 15,393,551 D291G probably damaging Het
Atrn A G 2: 130,970,222 R696G probably benign Het
Barx2 A C 9: 31,913,012 I27S probably damaging Het
Btnl1 A T 17: 34,379,751 I114L possibly damaging Het
Casq1 C T 1: 172,215,530 A200T probably damaging Het
Ccdc33 T A 9: 58,117,168 E225D probably benign Het
Cd84 C A 1: 171,884,585 probably null Het
Ceacam9 T G 7: 16,725,307 L177R probably benign Het
Cenpi T A X: 134,318,033 F161L possibly damaging Het
Cep63 T C 9: 102,602,880 K251E probably damaging Het
Cetn3 A G 13: 81,784,697 E25G probably damaging Het
Crybg3 T C 16: 59,544,125 D2378G possibly damaging Het
Ddx19b T C 8: 111,009,343 T357A possibly damaging Het
Dpep2 A C 8: 105,989,455 Y266* probably null Het
Dqx1 G A 6: 83,058,577 D24N probably damaging Het
Dsg4 A T 18: 20,471,212 Y912F probably damaging Het
Fam71f2 A G 6: 29,285,922 T69A probably benign Het
Fezf2 G T 14: 12,344,405 P261T probably benign Het
Fmo1 T C 1: 162,839,756 I163M possibly damaging Het
Gatad2a G A 8: 69,913,132 R428* probably null Het
Gfpt1 T A 6: 87,054,630 F85I possibly damaging Het
Gimap7 A T 6: 48,724,241 I254F possibly damaging Het
Glcci1 T C 6: 8,592,980 S261P probably damaging Het
Glis3 A T 19: 28,531,274 F437I probably damaging Het
Glp1r C A 17: 30,925,627 S258* probably null Het
Gm13023 C A 4: 143,795,150 H445Q probably benign Het
Gm7030 T A 17: 36,128,722 D122V probably damaging Het
Gpt2 C T 8: 85,516,203 A288V possibly damaging Het
Grin2c G T 11: 115,260,905 S76R possibly damaging Het
Guf1 T A 5: 69,567,226 Y447* probably null Het
Hectd1 A C 12: 51,785,841 L916V probably damaging Het
Hnf4g A G 3: 3,638,208 K96E probably damaging Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Ifi207 T G 1: 173,735,239 M114L probably benign Het
Ifi35 A T 11: 101,458,286 E252V probably damaging Het
Igsf9b G A 9: 27,322,239 R345H possibly damaging Het
Itih3 T C 14: 30,923,583 probably benign Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Kidins220 A T 12: 25,051,194 M1252L probably benign Het
Kifap3 T A 1: 163,862,022 L525* probably null Het
Limk2 A T 11: 3,355,461 D35E probably benign Het
Lrrc37a G A 11: 103,498,966 P1878S probably benign Het
Mansc4 T A 6: 147,075,675 I148F probably benign Het
Mei1 A G 15: 82,103,312 N859S probably benign Het
Mib1 A G 18: 10,812,064 D987G probably damaging Het
Mroh8 A G 2: 157,271,975 V132A possibly damaging Het
Npnt T C 3: 132,948,132 I29M probably benign Het
Olfr1 A T 11: 73,395,092 I310N probably benign Het
Olfr5 T C 7: 6,480,932 M75V probably benign Het
Olfr512 A G 7: 108,713,695 Y102C probably damaging Het
Olfr91 T A 17: 37,093,808 E22V probably damaging Het
Osbpl5 A C 7: 143,741,671 probably null Het
Pcna-ps2 T C 19: 9,283,683 V102A possibly damaging Het
Pik3c2g T C 6: 139,622,548 S221P probably damaging Het
Plppr3 A G 10: 79,866,425 I271T probably damaging Het
Prkar1b C T 5: 139,127,643 A41T probably benign Het
Prkcsh A G 9: 22,012,868 D458G probably damaging Het
Prr14 G T 7: 127,475,490 R398L possibly damaging Het
Ptafr A G 4: 132,579,985 R229G probably damaging Het
Rbp3 T C 14: 33,954,545 F150S probably damaging Het
Rel C T 11: 23,742,761 G424D probably benign Het
Rlf T C 4: 121,150,112 Y557C probably damaging Het
Samt3 A C X: 86,047,134 M211L probably benign Het
Selenop A T 15: 3,275,694 I111F probably damaging Het
Slc2a2 G A 3: 28,717,441 M173I probably benign Het
Slc43a1 G T 2: 84,856,889 G361V possibly damaging Het
Slit2 G A 5: 48,249,836 V870M probably damaging Het
Ssxb10 A G X: 8,331,019 D77G probably benign Het
Stk32b T A 5: 37,649,114 I29F probably damaging Het
Stra6l T A 4: 45,867,237 C161* probably null Het
Tecpr2 T A 12: 110,954,785 M1264K probably benign Het
Tfap2c A T 2: 172,557,236 I468F probably damaging Het
Ticam1 C T 17: 56,271,555 R180H probably damaging Het
Tlr4 T A 4: 66,841,035 N688K probably benign Het
Tmem35b A T 4: 127,126,053 probably benign Het
Ugt2b34 T C 5: 86,906,313 E203G probably damaging Het
Vegfa A C 17: 46,018,860 *393G probably null Het
Vmn2r16 T C 5: 109,364,024 V699A probably benign Het
Zfp324 T C 7: 12,971,218 S445P probably damaging Het
Zfp982 T A 4: 147,512,592 C135* probably null Het
Zfp990 A C 4: 145,536,869 N146H probably damaging Het
Zfyve26 A G 12: 79,255,243 Y431H possibly damaging Het
Other mutations in Nrap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00500:Nrap APN 19 56372909 missense probably damaging 1.00
IGL00570:Nrap APN 19 56338113 missense probably benign 0.10
IGL00946:Nrap APN 19 56340626 splice site probably null
IGL01070:Nrap APN 19 56329084 missense probably damaging 1.00
IGL01111:Nrap APN 19 56345558 missense probably damaging 1.00
IGL01138:Nrap APN 19 56355538 missense probably damaging 1.00
IGL01290:Nrap APN 19 56361748 missense probably damaging 1.00
IGL01352:Nrap APN 19 56379836 missense probably benign 0.00
IGL01372:Nrap APN 19 56329102 critical splice acceptor site probably null
IGL01395:Nrap APN 19 56361793 missense probably damaging 1.00
IGL01413:Nrap APN 19 56389391 missense probably damaging 0.99
IGL01734:Nrap APN 19 56350309 missense probably damaging 1.00
IGL01933:Nrap APN 19 56388818 missense probably damaging 1.00
IGL02156:Nrap APN 19 56321000 missense probably damaging 1.00
IGL02415:Nrap APN 19 56382309 missense probably damaging 1.00
IGL02447:Nrap APN 19 56345519 nonsense probably null
IGL02864:Nrap APN 19 56350374 missense probably damaging 1.00
IGL02993:Nrap APN 19 56345533 missense probably damaging 1.00
IGL03003:Nrap APN 19 56321952 missense probably damaging 1.00
IGL03006:Nrap APN 19 56347164 missense probably benign 0.02
IGL03084:Nrap APN 19 56365454 missense probably damaging 1.00
IGL03136:Nrap APN 19 56342255 missense possibly damaging 0.69
IGL03272:Nrap APN 19 56345568 intron probably benign
IGL03389:Nrap APN 19 56351716 missense probably benign 0.10
R0116:Nrap UTSW 19 56355546 missense probably damaging 1.00
R0374:Nrap UTSW 19 56351622 missense probably damaging 1.00
R0715:Nrap UTSW 19 56357325 missense probably damaging 0.98
R0828:Nrap UTSW 19 56345558 missense probably damaging 1.00
R0883:Nrap UTSW 19 56345474 missense probably damaging 1.00
R1416:Nrap UTSW 19 56327293 missense possibly damaging 0.60
R1459:Nrap UTSW 19 56384130 missense probably benign 0.00
R1616:Nrap UTSW 19 56389823 missense probably damaging 1.00
R1676:Nrap UTSW 19 56335255 missense probably damaging 1.00
R1687:Nrap UTSW 19 56355529 missense probably damaging 0.99
R1766:Nrap UTSW 19 56335042 missense probably damaging 0.99
R1792:Nrap UTSW 19 56379158 missense probably benign 0.00
R1817:Nrap UTSW 19 56384055 unclassified probably benign
R1972:Nrap UTSW 19 56357353 missense probably damaging 1.00
R2258:Nrap UTSW 19 56321962 missense possibly damaging 0.80
R2448:Nrap UTSW 19 56322030 missense possibly damaging 0.90
R3034:Nrap UTSW 19 56364005 missense probably damaging 1.00
R3801:Nrap UTSW 19 56321779 missense probably damaging 1.00
R3804:Nrap UTSW 19 56321779 missense probably damaging 1.00
R3923:Nrap UTSW 19 56380256 missense probably damaging 0.99
R3964:Nrap UTSW 19 56342144 missense probably damaging 1.00
R3965:Nrap UTSW 19 56342144 missense probably damaging 1.00
R3966:Nrap UTSW 19 56342144 missense probably damaging 1.00
R3980:Nrap UTSW 19 56381552 missense probably benign 0.01
R4182:Nrap UTSW 19 56350327 missense probably damaging 1.00
R4499:Nrap UTSW 19 56351481 missense probably damaging 0.97
R4573:Nrap UTSW 19 56342338 critical splice acceptor site probably null
R4603:Nrap UTSW 19 56335024 critical splice donor site probably null
R4689:Nrap UTSW 19 56386026 missense probably damaging 0.97
R4749:Nrap UTSW 19 56380237 missense probably damaging 0.96
R4845:Nrap UTSW 19 56351470 missense probably benign 0.16
R4937:Nrap UTSW 19 56347220 missense probably damaging 1.00
R4962:Nrap UTSW 19 56378143 missense probably damaging 1.00
R5156:Nrap UTSW 19 56371845 missense possibly damaging 0.94
R5181:Nrap UTSW 19 56345528 missense possibly damaging 0.85
R5202:Nrap UTSW 19 56335151 missense probably damaging 1.00
R5262:Nrap UTSW 19 56320223 missense possibly damaging 0.95
R5301:Nrap UTSW 19 56379109 missense probably damaging 1.00
R5380:Nrap UTSW 19 56381603 missense probably damaging 1.00
R5576:Nrap UTSW 19 56321982 missense probably damaging 0.99
R5631:Nrap UTSW 19 56354121 missense probably benign 0.19
R5754:Nrap UTSW 19 56389484 missense possibly damaging 0.55
R5799:Nrap UTSW 19 56342169 nonsense probably null
R5899:Nrap UTSW 19 56340574 missense possibly damaging 0.80
R5910:Nrap UTSW 19 56342311 missense probably benign 0.00
R5994:Nrap UTSW 19 56351599 nonsense probably null
R6124:Nrap UTSW 19 56386026 missense probably damaging 0.97
R6149:Nrap UTSW 19 56389453 missense possibly damaging 0.79
R6182:Nrap UTSW 19 56361698 missense probably benign
R6245:Nrap UTSW 19 56354221 missense probably damaging 1.00
R6245:Nrap UTSW 19 56379875 missense possibly damaging 0.80
R6270:Nrap UTSW 19 56320198 missense probably benign 0.00
R6274:Nrap UTSW 19 56361721 missense probably benign 0.21
R6340:Nrap UTSW 19 56347184 missense probably damaging 1.00
R6547:Nrap UTSW 19 56351566 missense probably benign 0.00
R6734:Nrap UTSW 19 56345509 missense probably damaging 0.99
R6770:Nrap UTSW 19 56382537 intron probably null
R6812:Nrap UTSW 19 56351676 missense probably damaging 1.00
R6843:Nrap UTSW 19 56380219 missense probably damaging 1.00
R7207:Nrap UTSW 19 56345521 missense probably damaging 1.00
R7214:Nrap UTSW 19 56378135 missense probably benign 0.09
R7313:Nrap UTSW 19 56342268 missense probably damaging 0.97
R7515:Nrap UTSW 19 56366427 missense possibly damaging 0.94
R7662:Nrap UTSW 19 56320283 missense probably benign 0.00
R7819:Nrap UTSW 19 56335288 missense probably benign
R7836:Nrap UTSW 19 56350297 missense probably benign 0.00
R7895:Nrap UTSW 19 56354152 missense probably benign 0.00
R8041:Nrap UTSW 19 56364336 nonsense probably null
R8046:Nrap UTSW 19 56320251 missense possibly damaging 0.46
R8066:Nrap UTSW 19 56354130 missense possibly damaging 0.94
R8129:Nrap UTSW 19 56366636 intron probably null
R8188:Nrap UTSW 19 56336578 nonsense probably null
R8323:Nrap UTSW 19 56389823 missense probably benign 0.00
R8353:Nrap UTSW 19 56323920 missense probably damaging 1.00
X0028:Nrap UTSW 19 56335220 nonsense probably null
Z1176:Nrap UTSW 19 56345517 frame shift probably null
Z1177:Nrap UTSW 19 56338092 missense probably damaging 1.00
Z1177:Nrap UTSW 19 56344764 missense probably benign 0.01
Predicted Primers PCR Primer

Sequencing Primer
Posted On2014-08-25