Incidental Mutation 'R1983:Zfyve9'
ID 220109
Institutional Source Beutler Lab
Gene Symbol Zfyve9
Ensembl Gene ENSMUSG00000034557
Gene Name zinc finger, FYVE domain containing 9
Synonyms Madhip
MMRRC Submission 039995-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.431) question?
Stock # R1983 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 108494663-108637995 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 108546386 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 874 (D874E)
Ref Sequence ENSEMBL: ENSMUSP00000102268 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042185] [ENSMUST00000106657] [ENSMUST00000106658]
AlphaFold A2A8R0
Predicted Effect possibly damaging
Transcript: ENSMUST00000042185
AA Change: D183E

PolyPhen 2 Score 0.704 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000039852
Gene: ENSMUSG00000034557
AA Change: D183E

DomainStartEndE-ValueType
Blast:FYVE 7 40 4e-7 BLAST
Pfam:SARA 52 92 1e-25 PFAM
Pfam:DUF3480 328 681 1.4e-189 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000106657
AA Change: D874E

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000102268
Gene: ENSMUSG00000034557
AA Change: D874E

DomainStartEndE-ValueType
low complexity region 230 243 N/A INTRINSIC
low complexity region 471 487 N/A INTRINSIC
low complexity region 578 587 N/A INTRINSIC
Blast:FYVE 590 618 7e-6 BLAST
FYVE 663 731 2.38e-26 SMART
Pfam:SARA 745 783 1.3e-22 PFAM
Pfam:DUF3480 1020 1372 1e-178 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000106658
AA Change: D815E

PolyPhen 2 Score 0.705 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000102269
Gene: ENSMUSG00000034557
AA Change: D815E

DomainStartEndE-ValueType
low complexity region 230 243 N/A INTRINSIC
low complexity region 471 487 N/A INTRINSIC
low complexity region 578 587 N/A INTRINSIC
Blast:FYVE 590 618 8e-6 BLAST
FYVE 663 731 2.38e-26 SMART
Pfam:DUF3480 960 1313 5.5e-189 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a double zinc finger motif-containing protein that participates in the transforming growth factor-beta (TGFB) signalling pathway. The encoded protein interacts directly with SMAD2 and SMAD3, and recruits SMAD2 to the TGFB receptor. There are multiple pseudogenes for this gene on chromosomes 2, 15, and X. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2013]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600012H06Rik T A 17: 15,164,272 (GRCm39) V133E probably damaging Het
Aco1 G A 4: 40,175,845 (GRCm39) G160S probably benign Het
Actn2 C T 13: 12,293,696 (GRCm39) R608H probably benign Het
Adora2a A C 10: 75,169,480 (GRCm39) S315R probably benign Het
Arhgap42 T C 9: 9,017,018 (GRCm39) Y382C probably damaging Het
Arsi G A 18: 61,049,723 (GRCm39) G202E probably benign Het
Atg4c A G 4: 99,116,812 (GRCm39) Y318C probably damaging Het
Baz2a C T 10: 127,959,828 (GRCm39) T1408I probably benign Het
Bbx T A 16: 50,029,480 (GRCm39) Q663L possibly damaging Het
Bltp1 A G 3: 36,942,014 (GRCm39) D273G probably null Het
Btbd3 T G 2: 138,125,608 (GRCm39) L264R probably damaging Het
Cfi T C 3: 129,662,194 (GRCm39) I391T probably damaging Het
Chadl T C 15: 81,578,097 (GRCm39) I45V probably benign Het
Chd5 C A 4: 152,469,123 (GRCm39) A1853D possibly damaging Het
Cmas G T 6: 142,716,312 (GRCm39) D251Y probably damaging Het
Cyp2d10 A G 15: 82,290,200 (GRCm39) M90T probably benign Het
D630003M21Rik A G 2: 158,050,341 (GRCm39) F714L probably benign Het
Dguok A T 6: 83,464,110 (GRCm39) Y126* probably null Het
Dnai1 A G 4: 41,603,232 (GRCm39) K172E probably benign Het
Dnai2 T A 11: 114,626,682 (GRCm39) probably null Het
Efcab6 A T 15: 83,777,163 (GRCm39) probably benign Het
Eln A T 5: 134,765,194 (GRCm39) probably null Het
Epor T C 9: 21,870,696 (GRCm39) T395A probably benign Het
Evc2 G T 5: 37,573,275 (GRCm39) E996* probably null Het
Fam124b T A 1: 80,191,364 (GRCm39) E6D probably benign Het
Filip1 T A 9: 79,767,374 (GRCm39) K146N probably damaging Het
Filip1l T C 16: 57,391,637 (GRCm39) S742P probably damaging Het
Fsip2 G T 2: 82,810,175 (GRCm39) V2165L probably benign Het
Gcdh A T 8: 85,617,539 (GRCm39) V227E possibly damaging Het
Gm12185 T C 11: 48,806,183 (GRCm39) N336S probably benign Het
Gm12695 G T 4: 96,627,214 (GRCm39) A399E possibly damaging Het
Gm16503 T A 4: 147,625,749 (GRCm39) V81E unknown Het
Gpr137c T C 14: 45,517,428 (GRCm39) V388A probably benign Het
Hgf A G 5: 16,766,010 (GRCm39) T49A possibly damaging Het
Hspa1a G T 17: 35,189,938 (GRCm39) R322S probably benign Het
Jak3 A T 8: 72,131,019 (GRCm39) Q13L possibly damaging Het
Jak3 A G 8: 72,140,780 (GRCm39) R1098G probably benign Het
Kif11 C T 19: 37,379,224 (GRCm39) T305I possibly damaging Het
Lcor T A 19: 41,546,806 (GRCm39) V130E probably damaging Het
Lmo2 T C 2: 103,811,407 (GRCm39) Y147H probably damaging Het
Lrp1b C T 2: 41,401,416 (GRCm39) probably null Het
Mdga1 G A 17: 30,069,579 (GRCm39) R430C probably damaging Het
Mfsd12 T A 10: 81,198,090 (GRCm39) probably null Het
Mmp27 T A 9: 7,578,898 (GRCm39) probably null Het
Mtnr1a A T 8: 45,540,471 (GRCm39) N144I probably benign Het
Mycbp2 T C 14: 103,383,407 (GRCm39) T3563A probably damaging Het
Myef2 T A 2: 124,940,765 (GRCm39) M355L probably benign Het
Or4a39 A G 2: 89,236,770 (GRCm39) F218L probably benign Het
Or5b104 A G 19: 13,072,748 (GRCm39) I88T probably benign Het
Or5p51 C T 7: 107,444,619 (GRCm39) G107D probably benign Het
Or8k27 T A 2: 86,275,420 (GRCm39) H302L probably benign Het
Parg A G 14: 31,939,653 (GRCm39) K560E probably damaging Het
Pck2 G A 14: 55,781,525 (GRCm39) probably null Het
Pdcd6 T C 13: 74,452,119 (GRCm39) I174V probably benign Het
Pomgnt1 T C 4: 116,009,066 (GRCm39) L57S probably damaging Het
Pomgnt1 C A 4: 116,009,117 (GRCm39) P74Q probably benign Het
Prdm4 T C 10: 85,743,817 (GRCm39) Y146C probably damaging Het
Prl2c2 G C 13: 13,176,786 (GRCm39) T47R probably damaging Het
Prune2 A G 19: 16,998,006 (GRCm39) M248V probably damaging Het
Ric8b T A 10: 84,837,702 (GRCm39) M503K probably damaging Het
Ror2 C T 13: 53,264,444 (GRCm39) V871M probably benign Het
Ryr1 T C 7: 28,758,897 (GRCm39) N3427S possibly damaging Het
Ryr2 A G 13: 11,600,288 (GRCm39) probably null Het
Scimp C T 11: 70,691,540 (GRCm39) V30I probably damaging Het
Skint4 A G 4: 112,003,689 (GRCm39) E374G probably benign Het
Slc6a20a A G 9: 123,469,652 (GRCm39) Y482H probably damaging Het
Slitrk5 A G 14: 111,917,821 (GRCm39) S482G probably benign Het
Spopfm2 T G 3: 94,083,601 (GRCm39) D70A possibly damaging Het
Strc T A 2: 121,201,518 (GRCm39) M1229L possibly damaging Het
Tasor2 G T 13: 3,624,853 (GRCm39) T1699K possibly damaging Het
Terf2 T C 8: 107,809,640 (GRCm39) Y226C probably damaging Het
Tex10 A T 4: 48,460,059 (GRCm39) L431I possibly damaging Het
Tnc A G 4: 63,902,867 (GRCm39) V1470A possibly damaging Het
Ttll13 T C 7: 79,903,364 (GRCm39) I248T possibly damaging Het
Ttn T A 2: 76,587,104 (GRCm39) K21631M probably damaging Het
Ttn T C 2: 76,619,369 (GRCm39) N16031S possibly damaging Het
Uroc1 A T 6: 90,322,351 (GRCm39) S292C probably damaging Het
Vmn1r80 A T 7: 11,927,588 (GRCm39) M233L probably benign Het
Wdr31 A T 4: 62,378,840 (GRCm39) M129K probably damaging Het
Wnk1 A T 6: 119,914,539 (GRCm39) N1754K probably damaging Het
Xirp1 G A 9: 119,845,695 (GRCm39) Q1063* probably null Het
Zfp799 C A 17: 33,041,084 (GRCm39) V32L probably damaging Het
Other mutations in Zfyve9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Zfyve9 APN 4 108,499,304 (GRCm39) missense possibly damaging 0.85
IGL01161:Zfyve9 APN 4 108,538,261 (GRCm39) missense probably damaging 1.00
IGL01404:Zfyve9 APN 4 108,539,348 (GRCm39) missense probably damaging 1.00
IGL01451:Zfyve9 APN 4 108,539,457 (GRCm39) missense probably damaging 0.98
IGL01655:Zfyve9 APN 4 108,499,289 (GRCm39) missense probably damaging 1.00
IGL02567:Zfyve9 APN 4 108,531,720 (GRCm39) missense probably damaging 1.00
IGL02593:Zfyve9 APN 4 108,539,420 (GRCm39) missense possibly damaging 0.73
IGL03169:Zfyve9 APN 4 108,553,022 (GRCm39) missense probably damaging 1.00
IGL03206:Zfyve9 APN 4 108,546,406 (GRCm39) missense possibly damaging 0.88
IGL03288:Zfyve9 APN 4 108,580,996 (GRCm39) splice site probably benign
R0008:Zfyve9 UTSW 4 108,575,902 (GRCm39) missense possibly damaging 0.92
R0008:Zfyve9 UTSW 4 108,575,902 (GRCm39) missense possibly damaging 0.92
R0104:Zfyve9 UTSW 4 108,575,360 (GRCm39) missense probably damaging 1.00
R0104:Zfyve9 UTSW 4 108,575,360 (GRCm39) missense probably damaging 1.00
R0362:Zfyve9 UTSW 4 108,538,166 (GRCm39) missense probably damaging 0.96
R0502:Zfyve9 UTSW 4 108,576,961 (GRCm39) nonsense probably null
R0503:Zfyve9 UTSW 4 108,576,961 (GRCm39) nonsense probably null
R0557:Zfyve9 UTSW 4 108,531,708 (GRCm39) missense probably damaging 0.98
R0835:Zfyve9 UTSW 4 108,575,866 (GRCm39) missense probably damaging 0.99
R1215:Zfyve9 UTSW 4 108,507,426 (GRCm39) missense probably benign 0.32
R1245:Zfyve9 UTSW 4 108,550,508 (GRCm39) intron probably benign
R1527:Zfyve9 UTSW 4 108,552,964 (GRCm39) critical splice donor site probably null
R1638:Zfyve9 UTSW 4 108,542,104 (GRCm39) critical splice donor site probably null
R1653:Zfyve9 UTSW 4 108,517,774 (GRCm39) nonsense probably null
R1728:Zfyve9 UTSW 4 108,575,698 (GRCm39) missense possibly damaging 0.80
R1729:Zfyve9 UTSW 4 108,575,698 (GRCm39) missense possibly damaging 0.80
R1861:Zfyve9 UTSW 4 108,539,492 (GRCm39) splice site probably benign
R2050:Zfyve9 UTSW 4 108,576,500 (GRCm39) missense possibly damaging 0.94
R2050:Zfyve9 UTSW 4 108,575,800 (GRCm39) missense probably benign 0.05
R2246:Zfyve9 UTSW 4 108,546,461 (GRCm39) missense possibly damaging 0.70
R2338:Zfyve9 UTSW 4 108,517,811 (GRCm39) missense probably damaging 1.00
R2697:Zfyve9 UTSW 4 108,553,016 (GRCm39) missense probably damaging 0.99
R3522:Zfyve9 UTSW 4 108,576,940 (GRCm39) missense probably benign 0.45
R4030:Zfyve9 UTSW 4 108,576,898 (GRCm39) missense possibly damaging 0.61
R4247:Zfyve9 UTSW 4 108,576,389 (GRCm39) missense probably benign 0.28
R4273:Zfyve9 UTSW 4 108,538,173 (GRCm39) missense probably damaging 1.00
R4720:Zfyve9 UTSW 4 108,501,565 (GRCm39) missense possibly damaging 0.94
R4835:Zfyve9 UTSW 4 108,575,195 (GRCm39) missense possibly damaging 0.70
R4871:Zfyve9 UTSW 4 108,538,183 (GRCm39) missense probably damaging 1.00
R4881:Zfyve9 UTSW 4 108,584,688 (GRCm39) splice site probably null
R4974:Zfyve9 UTSW 4 108,538,097 (GRCm39) critical splice donor site probably null
R5024:Zfyve9 UTSW 4 108,548,866 (GRCm39) missense probably benign 0.18
R5481:Zfyve9 UTSW 4 108,501,546 (GRCm39) missense probably damaging 1.00
R5660:Zfyve9 UTSW 4 108,576,365 (GRCm39) missense probably benign
R5965:Zfyve9 UTSW 4 108,548,878 (GRCm39) missense possibly damaging 0.53
R5996:Zfyve9 UTSW 4 108,576,557 (GRCm39) missense probably benign 0.07
R6315:Zfyve9 UTSW 4 108,531,685 (GRCm39) missense probably damaging 1.00
R6772:Zfyve9 UTSW 4 108,496,466 (GRCm39) missense probably damaging 1.00
R6865:Zfyve9 UTSW 4 108,501,558 (GRCm39) missense possibly damaging 0.71
R7112:Zfyve9 UTSW 4 108,507,519 (GRCm39) missense probably benign 0.00
R7258:Zfyve9 UTSW 4 108,514,151 (GRCm39) missense possibly damaging 0.94
R7266:Zfyve9 UTSW 4 108,575,744 (GRCm39) missense possibly damaging 0.62
R7287:Zfyve9 UTSW 4 108,575,453 (GRCm39) missense probably benign 0.00
R7356:Zfyve9 UTSW 4 108,576,212 (GRCm39) missense probably benign 0.01
R7389:Zfyve9 UTSW 4 108,550,515 (GRCm39) critical splice donor site probably null
R7729:Zfyve9 UTSW 4 108,548,973 (GRCm39) missense probably benign 0.01
R7780:Zfyve9 UTSW 4 108,576,298 (GRCm39) missense possibly damaging 0.81
R7801:Zfyve9 UTSW 4 108,542,192 (GRCm39) missense possibly damaging 0.50
R8069:Zfyve9 UTSW 4 108,542,215 (GRCm39) missense probably benign 0.32
R8201:Zfyve9 UTSW 4 108,507,474 (GRCm39) missense possibly damaging 0.83
R8221:Zfyve9 UTSW 4 108,576,877 (GRCm39) missense possibly damaging 0.77
R8682:Zfyve9 UTSW 4 108,576,539 (GRCm39) missense probably benign 0.30
R8948:Zfyve9 UTSW 4 108,499,288 (GRCm39) missense possibly damaging 0.84
R8960:Zfyve9 UTSW 4 108,501,558 (GRCm39) missense possibly damaging 0.71
R9123:Zfyve9 UTSW 4 108,575,760 (GRCm39) missense probably benign 0.30
R9135:Zfyve9 UTSW 4 108,539,386 (GRCm39) nonsense probably null
R9439:Zfyve9 UTSW 4 108,501,538 (GRCm39) missense probably benign 0.33
R9449:Zfyve9 UTSW 4 108,576,435 (GRCm39) missense probably damaging 1.00
R9560:Zfyve9 UTSW 4 108,575,334 (GRCm39) missense possibly damaging 0.82
R9603:Zfyve9 UTSW 4 108,499,288 (GRCm39) missense possibly damaging 0.84
R9657:Zfyve9 UTSW 4 108,575,729 (GRCm39) missense probably damaging 1.00
R9691:Zfyve9 UTSW 4 108,576,305 (GRCm39) missense probably benign
R9717:Zfyve9 UTSW 4 108,539,334 (GRCm39) missense probably benign 0.11
Z1176:Zfyve9 UTSW 4 108,499,404 (GRCm39) missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- ATGTTTTCATGGCATTGTGGAA -3'
(R):5'- ATCTCTGTATTACTTGTGGACTTTGTA -3'

Sequencing Primer
(F):5'- TGGAAGTTGTATTTGTTATCAGACAG -3'
(R):5'- CCTGGGCTAGAGATCCTATCTAAG -3'
Posted On 2014-08-25