Mutagenetix > Incidental Mutations

Incidental Mutation 'R1983:Zfyve9'

220109

Institutional Source

Beutler Lab

Gene Symbol

Zfyve9

Ensembl Gene

ENSMUSG00000034557

Gene Name

zinc finger, FYVE domain containing 9

Synonyms

Madhip

MMRRC Submission

039995-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.515) question?

Stock #

R1983 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

108637466-108780798 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 108689189 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 874 (D874E)

Ref Sequence

ENSEMBL: ENSMUSP00000102268 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000042185] [ENSMUST00000106657] [ENSMUST00000106658]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000042185
AA Change: D183E

PolyPhen 2 Score 0.704 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000039852
Gene: ENSMUSG00000034557
AA Change: D183E

Domain	Start	End	E-Value	Type
Blast:FYVE	7	40	4e-7	BLAST
Pfam:SARA	52	92	1e-25	PFAM
Pfam:DUF3480	328	681	1.4e-189	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000106657
AA Change: D874E

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000102268
Gene: ENSMUSG00000034557
AA Change: D874E

Domain	Start	End	E-Value	Type
low complexity region	230	243	N/A	INTRINSIC
low complexity region	471	487	N/A	INTRINSIC
low complexity region	578	587	N/A	INTRINSIC
Blast:FYVE	590	618	7e-6	BLAST
FYVE	663	731	2.38e-26	SMART
Pfam:SARA	745	783	1.3e-22	PFAM
Pfam:DUF3480	1020	1372	1e-178	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000106658
AA Change: D815E

PolyPhen 2 Score 0.705 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000102269
Gene: ENSMUSG00000034557
AA Change: D815E

Domain	Start	End	E-Value	Type
low complexity region	230	243	N/A	INTRINSIC
low complexity region	471	487	N/A	INTRINSIC
low complexity region	578	587	N/A	INTRINSIC
Blast:FYVE	590	618	8e-6	BLAST
FYVE	663	731	2.38e-26	SMART
Pfam:DUF3480	960	1313	5.5e-189	PFAM

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a double zinc finger motif-containing protein that participates in the transforming growth factor-beta (TGFB) signalling pathway. The encoded protein interacts directly with SMAD2 and SMAD3, and recruits SMAD2 to the TGFB receptor. There are multiple pseudogenes for this gene on chromosomes 2, 15, and X. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2013]

Allele List at MGI

Other mutations in this stock

Total: 82 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1600012H06Rik	T	A	17: 14,944,010	V133E	probably damaging	Het
4932438A13Rik	A	G	3: 36,887,865	D273G	probably null	Het
Aco1	G	A	4: 40,175,845	G160S	probably benign	Het
Actn2	C	T	13: 12,278,810	R608H	probably benign	Het
Adora2a	A	C	10: 75,333,646	S315R	probably benign	Het
Arhgap42	T	C	9: 9,017,017	Y382C	probably damaging	Het
Arsi	G	A	18: 60,916,651	G202E	probably benign	Het
Atg4c	A	G	4: 99,228,575	Y318C	probably damaging	Het
Baz2a	C	T	10: 128,123,959	T1408I	probably benign	Het
Bbx	T	A	16: 50,209,117	Q663L	possibly damaging	Het
Btbd3	T	G	2: 138,283,688	L264R	probably damaging	Het
Cfi	T	C	3: 129,868,545	I391T	probably damaging	Het
Chadl	T	C	15: 81,693,896	I45V	probably benign	Het
Chd5	C	A	4: 152,384,666	A1853D	possibly damaging	Het
Cmas	G	T	6: 142,770,586	D251Y	probably damaging	Het
Cyp2d10	A	G	15: 82,405,999	M90T	probably benign	Het
D630003M21Rik	A	G	2: 158,208,421	F714L	probably benign	Het
Dguok	A	T	6: 83,487,128	Y126*	probably null	Het
Dnaic1	A	G	4: 41,603,232	K172E	probably benign	Het
Dnaic2	T	A	11: 114,735,856		probably null	Het
Efcab6	A	T	15: 83,892,962		probably benign	Het
Eln	A	T	5: 134,736,340		probably null	Het
Epor	T	C	9: 21,959,400	T395A	probably benign	Het
Evc2	G	T	5: 37,415,931	E996*	probably null	Het
Fam124b	T	A	1: 80,213,647	E6D	probably benign	Het
Fam208b	G	T	13: 3,574,853	T1699K	possibly damaging	Het
Filip1	T	A	9: 79,860,092	K146N	probably damaging	Het
Filip1l	T	C	16: 57,571,274	S742P	probably damaging	Het
Fsip2	G	T	2: 82,979,831	V2165L	probably benign	Het
Gcdh	A	T	8: 84,890,910	V227E	possibly damaging	Het
Gm10696	T	G	3: 94,176,294	D70A	possibly damaging	Het
Gm12185	T	C	11: 48,915,356	N336S	probably benign	Het
Gm12695	G	T	4: 96,738,977	A399E	possibly damaging	Het
Gm16503	T	A	4: 147,541,292	V81E	unknown	Het
Gpr137c	T	C	14: 45,279,971	V388A	probably benign	Het
Hgf	A	G	5: 16,561,012	T49A	possibly damaging	Het
Hspa1a	G	T	17: 34,970,962	R322S	probably benign	Het
Jak3	A	T	8: 71,678,375	Q13L	possibly damaging	Het
Jak3	A	G	8: 71,688,136	R1098G	probably benign	Het
Kif11	C	T	19: 37,390,776	T305I	possibly damaging	Het
Lcor	T	A	19: 41,558,367	V130E	probably damaging	Het
Lmo2	T	C	2: 103,981,062	Y147H	probably damaging	Het
Lrp1b	C	T	2: 41,511,404		probably null	Het
Mdga1	G	A	17: 29,850,605	R430C	probably damaging	Het
Mfsd12	T	A	10: 81,362,256		probably null	Het
Mmp27	T	A	9: 7,578,897		probably null	Het
Mtnr1a	A	T	8: 45,087,434	N144I	probably benign	Het
Mycbp2	T	C	14: 103,145,971	T3563A	probably damaging	Het
Myef2	T	A	2: 125,098,845	M355L	probably benign	Het
Olfr1065	T	A	2: 86,445,076	H302L	probably benign	Het
Olfr1238	A	G	2: 89,406,426	F218L	probably benign	Het
Olfr1457	A	G	19: 13,095,384	I88T	probably benign	Het
Olfr470	C	T	7: 107,845,412	G107D	probably benign	Het
Parg	A	G	14: 32,217,696	K560E	probably damaging	Het
Pck2	G	A	14: 55,544,068		probably null	Het
Pdcd6	T	C	13: 74,304,000	I174V	probably benign	Het
Pomgnt1	T	C	4: 116,151,869	L57S	probably damaging	Het
Pomgnt1	C	A	4: 116,151,920	P74Q	probably benign	Het
Prdm4	T	C	10: 85,907,953	Y146C	probably damaging	Het
Prl2c2	G	C	13: 13,002,201	T47R	probably damaging	Het
Prune2	A	G	19: 17,020,642	M248V	probably damaging	Het
Ric8b	T	A	10: 85,001,838	M503K	probably damaging	Het
Ror2	C	T	13: 53,110,408	V871M	probably benign	Het
Ryr1	T	C	7: 29,059,472	N3427S	possibly damaging	Het
Ryr2	A	G	13: 11,585,402		probably null	Het
Scimp	C	T	11: 70,800,714	V30I	probably damaging	Het
Skint4	A	G	4: 112,146,492	E374G	probably benign	Het
Slc6a20a	A	G	9: 123,640,587	Y482H	probably damaging	Het
Slitrk5	A	G	14: 111,680,389	S482G	probably benign	Het
Strc	T	A	2: 121,371,037	M1229L	possibly damaging	Het
Terf2	T	C	8: 107,083,008	Y226C	probably damaging	Het
Tex10	A	T	4: 48,460,059	L431I	possibly damaging	Het
Tnc	A	G	4: 63,984,630	V1470A	possibly damaging	Het
Ttll13	T	C	7: 80,253,616	I248T	possibly damaging	Het
Ttn	T	A	2: 76,756,760	K21631M	probably damaging	Het
Ttn	T	C	2: 76,789,025	N16031S	possibly damaging	Het
Uroc1	A	T	6: 90,345,369	S292C	probably damaging	Het
Vmn1r80	A	T	7: 12,193,661	M233L	probably benign	Het
Wdr31	A	T	4: 62,460,603	M129K	probably damaging	Het
Wnk1	A	T	6: 119,937,578	N1754K	probably damaging	Het
Xirp1	G	A	9: 120,016,629	Q1063*	probably null	Het
Zfp799	C	A	17: 32,822,110	V32L	probably damaging	Het

Other mutations in Zfyve9

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00162:Zfyve9	APN	4	108642107	missense	possibly damaging	0.85
IGL01161:Zfyve9	APN	4	108681064	missense	probably damaging	1.00
IGL01404:Zfyve9	APN	4	108682151	missense	probably damaging	1.00
IGL01451:Zfyve9	APN	4	108682260	missense	probably damaging	0.98
IGL01655:Zfyve9	APN	4	108642092	missense	probably damaging	1.00
IGL02567:Zfyve9	APN	4	108674523	missense	probably damaging	1.00
IGL02593:Zfyve9	APN	4	108682223	missense	possibly damaging	0.73
IGL03169:Zfyve9	APN	4	108695825	missense	probably damaging	1.00
IGL03206:Zfyve9	APN	4	108689209	missense	possibly damaging	0.88
IGL03288:Zfyve9	APN	4	108723799	splice site	probably benign
R0008:Zfyve9	UTSW	4	108718705	missense	possibly damaging	0.92
R0008:Zfyve9	UTSW	4	108718705	missense	possibly damaging	0.92
R0104:Zfyve9	UTSW	4	108718163	missense	probably damaging	1.00
R0104:Zfyve9	UTSW	4	108718163	missense	probably damaging	1.00
R0362:Zfyve9	UTSW	4	108680969	missense	probably damaging	0.96
R0502:Zfyve9	UTSW	4	108719764	nonsense	probably null
R0503:Zfyve9	UTSW	4	108719764	nonsense	probably null
R0557:Zfyve9	UTSW	4	108674511	missense	probably damaging	0.98
R0835:Zfyve9	UTSW	4	108718669	missense	probably damaging	0.99
R1215:Zfyve9	UTSW	4	108650229	missense	probably benign	0.32
R1245:Zfyve9	UTSW	4	108693311	intron	probably benign
R1527:Zfyve9	UTSW	4	108695767	critical splice donor site	probably null
R1638:Zfyve9	UTSW	4	108684907	critical splice donor site	probably null
R1653:Zfyve9	UTSW	4	108660577	nonsense	probably null
R1728:Zfyve9	UTSW	4	108718501	missense	possibly damaging	0.80
R1729:Zfyve9	UTSW	4	108718501	missense	possibly damaging	0.80
R1861:Zfyve9	UTSW	4	108682295	splice site	probably benign
R2050:Zfyve9	UTSW	4	108718603	missense	probably benign	0.05
R2050:Zfyve9	UTSW	4	108719303	missense	possibly damaging	0.94
R2246:Zfyve9	UTSW	4	108689264	missense	possibly damaging	0.70
R2338:Zfyve9	UTSW	4	108660614	missense	probably damaging	1.00
R2697:Zfyve9	UTSW	4	108695819	missense	probably damaging	0.99
R3522:Zfyve9	UTSW	4	108719743	missense	probably benign	0.45
R4030:Zfyve9	UTSW	4	108719701	missense	possibly damaging	0.61
R4247:Zfyve9	UTSW	4	108719192	missense	probably benign	0.28
R4273:Zfyve9	UTSW	4	108680976	missense	probably damaging	1.00
R4720:Zfyve9	UTSW	4	108644368	missense	possibly damaging	0.94
R4835:Zfyve9	UTSW	4	108717998	missense	possibly damaging	0.70
R4871:Zfyve9	UTSW	4	108680986	missense	probably damaging	1.00
R4881:Zfyve9	UTSW	4	108727491	splice site	probably null
R4974:Zfyve9	UTSW	4	108680900	critical splice donor site	probably null
R5024:Zfyve9	UTSW	4	108691669	missense	probably benign	0.18
R5481:Zfyve9	UTSW	4	108644349	missense	probably damaging	1.00
R5660:Zfyve9	UTSW	4	108719168	missense	probably benign
R5965:Zfyve9	UTSW	4	108691681	missense	possibly damaging	0.53
R5996:Zfyve9	UTSW	4	108719360	missense	probably benign	0.07
R6315:Zfyve9	UTSW	4	108674488	missense	probably damaging	1.00
R6772:Zfyve9	UTSW	4	108639269	missense	probably damaging	1.00
R6865:Zfyve9	UTSW	4	108644361	missense	possibly damaging	0.71
R7112:Zfyve9	UTSW	4	108650322	missense	probably benign	0.00
R7258:Zfyve9	UTSW	4	108656954	missense	possibly damaging	0.94
R7266:Zfyve9	UTSW	4	108718547	missense	possibly damaging	0.62
R7287:Zfyve9	UTSW	4	108718256	missense	probably benign	0.00
R7356:Zfyve9	UTSW	4	108719015	missense	probably benign	0.01
R7389:Zfyve9	UTSW	4	108693318	critical splice donor site	probably null
R7729:Zfyve9	UTSW	4	108691776	missense	probably benign	0.01
R7780:Zfyve9	UTSW	4	108719101	missense	possibly damaging	0.81
R7801:Zfyve9	UTSW	4	108684995	missense	possibly damaging	0.50
R8069:Zfyve9	UTSW	4	108685018	missense	probably benign	0.32
R8201:Zfyve9	UTSW	4	108650277	missense	possibly damaging	0.83
R8221:Zfyve9	UTSW	4	108719680	missense	possibly damaging	0.77
R8682:Zfyve9	UTSW	4	108719342	missense	probably benign	0.30
R8948:Zfyve9	UTSW	4	108642091	missense	possibly damaging	0.84
R8960:Zfyve9	UTSW	4	108644361	missense	possibly damaging	0.71
Z1176:Zfyve9	UTSW	4	108642207	missense	possibly damaging	0.85

Predicted Primers

PCR Primer
(F):5'- ATGTTTTCATGGCATTGTGGAA -3'
(R):5'- ATCTCTGTATTACTTGTGGACTTTGTA -3'

Sequencing Primer
(F):5'- TGGAAGTTGTATTTGTTATCAGACAG -3'
(R):5'- CCTGGGCTAGAGATCCTATCTAAG -3'

Posted On

2014-08-25