Incidental Mutation 'R1983:Hgf'
ID220123
Institutional Source Beutler Lab
Gene Symbol Hgf
Ensembl Gene ENSMUSG00000028864
Gene Namehepatocyte growth factor
SynonymsHGF/SF, NK1, C230052L06Rik, scatter factor, NK2, SF/HGF
MMRRC Submission 039995-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1983 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location16553495-16620152 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 16561012 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 49 (T49A)
Ref Sequence ENSEMBL: ENSMUSP00000143424 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030683] [ENSMUST00000196645] [ENSMUST00000199581]
Predicted Effect possibly damaging
Transcript: ENSMUST00000030683
AA Change: T49A

PolyPhen 2 Score 0.534 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000030683
Gene: ENSMUSG00000028864
AA Change: T49A

DomainStartEndE-ValueType
low complexity region 7 25 N/A INTRINSIC
PAN_AP 38 123 6.47e-13 SMART
KR 127 209 3.03e-46 SMART
KR 210 291 9.04e-45 SMART
KR 304 386 7.35e-45 SMART
KR 390 472 1.02e-38 SMART
Tryp_SPc 495 719 5.6e-55 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195957
Predicted Effect possibly damaging
Transcript: ENSMUST00000196645
AA Change: T49A

PolyPhen 2 Score 0.534 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000142517
Gene: ENSMUSG00000028864
AA Change: T49A

DomainStartEndE-ValueType
low complexity region 7 25 N/A INTRINSIC
PAN_AP 38 123 6.47e-13 SMART
KR 127 204 3.76e-42 SMART
KR 205 286 9.04e-45 SMART
KR 299 381 7.35e-45 SMART
KR 385 467 1.02e-38 SMART
Tryp_SPc 490 714 5.6e-55 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000199581
AA Change: T49A

PolyPhen 2 Score 0.534 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000143424
Gene: ENSMUSG00000028864
AA Change: T49A

DomainStartEndE-ValueType
low complexity region 7 25 N/A INTRINSIC
PAN_AP 38 123 6.47e-13 SMART
KR 127 209 3.03e-46 SMART
KR 210 291 9.04e-45 SMART
KR 304 386 7.35e-45 SMART
KR 390 472 1.02e-38 SMART
Tryp_SPc 495 719 5.6e-55 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199900
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200189
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a protein that binds to the hepatocyte growth factor receptor to regulate cell growth, cell motility and morphogenesis in numerous cell and tissue types. The encoded preproprotein is proteolytically processed to generate multiple protein products, including the hepatocyte growth factor alpha and beta chains, which heterodimerize to form the mature active protein. Although this protein is a member of the peptidase S1 family of serine proteases, it lacks peptidase activity. Homozygous knockout mice for this gene exhibit embryonic lethality due to impaired development of the placenta and liver. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygotes for targeted null mutations exhibit reduced embryonic livers, impaired migration of dermomyotome precursors affecting skeletal muscle formation, defective navigation of hypoglossal motor axons, abnormal placentas, and prenatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600012H06Rik T A 17: 14,944,010 V133E probably damaging Het
4932438A13Rik A G 3: 36,887,865 D273G probably null Het
Aco1 G A 4: 40,175,845 G160S probably benign Het
Actn2 C T 13: 12,278,810 R608H probably benign Het
Adora2a A C 10: 75,333,646 S315R probably benign Het
Arhgap42 T C 9: 9,017,017 Y382C probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Atg4c A G 4: 99,228,575 Y318C probably damaging Het
Baz2a C T 10: 128,123,959 T1408I probably benign Het
Bbx T A 16: 50,209,117 Q663L possibly damaging Het
Btbd3 T G 2: 138,283,688 L264R probably damaging Het
Cfi T C 3: 129,868,545 I391T probably damaging Het
Chadl T C 15: 81,693,896 I45V probably benign Het
Chd5 C A 4: 152,384,666 A1853D possibly damaging Het
Cmas G T 6: 142,770,586 D251Y probably damaging Het
Cyp2d10 A G 15: 82,405,999 M90T probably benign Het
D630003M21Rik A G 2: 158,208,421 F714L probably benign Het
Dguok A T 6: 83,487,128 Y126* probably null Het
Dnaic1 A G 4: 41,603,232 K172E probably benign Het
Dnaic2 T A 11: 114,735,856 probably null Het
Efcab6 A T 15: 83,892,962 probably benign Het
Eln A T 5: 134,736,340 probably null Het
Epor T C 9: 21,959,400 T395A probably benign Het
Evc2 G T 5: 37,415,931 E996* probably null Het
Fam124b T A 1: 80,213,647 E6D probably benign Het
Fam208b G T 13: 3,574,853 T1699K possibly damaging Het
Filip1 T A 9: 79,860,092 K146N probably damaging Het
Filip1l T C 16: 57,571,274 S742P probably damaging Het
Fsip2 G T 2: 82,979,831 V2165L probably benign Het
Gcdh A T 8: 84,890,910 V227E possibly damaging Het
Gm10696 T G 3: 94,176,294 D70A possibly damaging Het
Gm12185 T C 11: 48,915,356 N336S probably benign Het
Gm12695 G T 4: 96,738,977 A399E possibly damaging Het
Gm16503 T A 4: 147,541,292 V81E unknown Het
Gpr137c T C 14: 45,279,971 V388A probably benign Het
Hspa1a G T 17: 34,970,962 R322S probably benign Het
Jak3 A T 8: 71,678,375 Q13L possibly damaging Het
Jak3 A G 8: 71,688,136 R1098G probably benign Het
Kif11 C T 19: 37,390,776 T305I possibly damaging Het
Lcor T A 19: 41,558,367 V130E probably damaging Het
Lmo2 T C 2: 103,981,062 Y147H probably damaging Het
Lrp1b C T 2: 41,511,404 probably null Het
Mdga1 G A 17: 29,850,605 R430C probably damaging Het
Mfsd12 T A 10: 81,362,256 probably null Het
Mmp27 T A 9: 7,578,897 probably null Het
Mtnr1a A T 8: 45,087,434 N144I probably benign Het
Mycbp2 T C 14: 103,145,971 T3563A probably damaging Het
Myef2 T A 2: 125,098,845 M355L probably benign Het
Olfr1065 T A 2: 86,445,076 H302L probably benign Het
Olfr1238 A G 2: 89,406,426 F218L probably benign Het
Olfr1457 A G 19: 13,095,384 I88T probably benign Het
Olfr470 C T 7: 107,845,412 G107D probably benign Het
Parg A G 14: 32,217,696 K560E probably damaging Het
Pck2 G A 14: 55,544,068 probably null Het
Pdcd6 T C 13: 74,304,000 I174V probably benign Het
Pomgnt1 T C 4: 116,151,869 L57S probably damaging Het
Pomgnt1 C A 4: 116,151,920 P74Q probably benign Het
Prdm4 T C 10: 85,907,953 Y146C probably damaging Het
Prl2c2 G C 13: 13,002,201 T47R probably damaging Het
Prune2 A G 19: 17,020,642 M248V probably damaging Het
Ric8b T A 10: 85,001,838 M503K probably damaging Het
Ror2 C T 13: 53,110,408 V871M probably benign Het
Ryr1 T C 7: 29,059,472 N3427S possibly damaging Het
Ryr2 A G 13: 11,585,402 probably null Het
Scimp C T 11: 70,800,714 V30I probably damaging Het
Skint4 A G 4: 112,146,492 E374G probably benign Het
Slc6a20a A G 9: 123,640,587 Y482H probably damaging Het
Slitrk5 A G 14: 111,680,389 S482G probably benign Het
Strc T A 2: 121,371,037 M1229L possibly damaging Het
Terf2 T C 8: 107,083,008 Y226C probably damaging Het
Tex10 A T 4: 48,460,059 L431I possibly damaging Het
Tnc A G 4: 63,984,630 V1470A possibly damaging Het
Ttll13 T C 7: 80,253,616 I248T possibly damaging Het
Ttn T A 2: 76,756,760 K21631M probably damaging Het
Ttn T C 2: 76,789,025 N16031S possibly damaging Het
Uroc1 A T 6: 90,345,369 S292C probably damaging Het
Vmn1r80 A T 7: 12,193,661 M233L probably benign Het
Wdr31 A T 4: 62,460,603 M129K probably damaging Het
Wnk1 A T 6: 119,937,578 N1754K probably damaging Het
Xirp1 G A 9: 120,016,629 Q1063* probably null Het
Zfp799 C A 17: 32,822,110 V32L probably damaging Het
Zfyve9 A T 4: 108,689,189 D874E possibly damaging Het
Other mutations in Hgf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Hgf APN 5 16611882 missense possibly damaging 0.70
IGL00427:Hgf APN 5 16578486 missense probably benign 0.09
IGL00788:Hgf APN 5 16598230 missense probably damaging 0.99
IGL01290:Hgf APN 5 16604846 missense probably damaging 1.00
IGL01333:Hgf APN 5 16576941 nonsense probably null
IGL01568:Hgf APN 5 16564814 missense probably damaging 1.00
IGL02314:Hgf APN 5 16572602 missense probably damaging 0.99
IGL02328:Hgf APN 5 16598221 missense probably damaging 1.00
IGL02368:Hgf APN 5 16564794 missense possibly damaging 0.95
IGL02486:Hgf APN 5 16602289 missense probably damaging 1.00
IGL02654:Hgf APN 5 16561051 missense probably benign
Foiegras UTSW 5 16615802 missense probably benign 0.01
PIT4378001:Hgf UTSW 5 16611862 missense probably damaging 1.00
R0708:Hgf UTSW 5 16566763 nonsense probably null
R0710:Hgf UTSW 5 16566763 nonsense probably null
R0718:Hgf UTSW 5 16593859 missense probably damaging 1.00
R0967:Hgf UTSW 5 16593841 splice site probably benign
R1181:Hgf UTSW 5 16618925 missense probably damaging 1.00
R1589:Hgf UTSW 5 16613785 missense probably damaging 1.00
R1705:Hgf UTSW 5 16615802 missense probably benign 0.01
R2021:Hgf UTSW 5 16576921 missense probably benign
R2441:Hgf UTSW 5 16604790 missense probably damaging 0.99
R4083:Hgf UTSW 5 16615858 nonsense probably null
R4084:Hgf UTSW 5 16615858 nonsense probably null
R4211:Hgf UTSW 5 16614993 missense probably damaging 0.99
R4388:Hgf UTSW 5 16614943 missense probably benign 0.12
R4394:Hgf UTSW 5 16618951 nonsense probably null
R4575:Hgf UTSW 5 16572601 missense probably benign
R5044:Hgf UTSW 5 16614894 missense probably benign 0.00
R5319:Hgf UTSW 5 16566862 critical splice donor site probably null
R5585:Hgf UTSW 5 16564801 missense possibly damaging 0.93
R5700:Hgf UTSW 5 16610124 missense probably damaging 1.00
R5814:Hgf UTSW 5 16602307 missense probably benign 0.19
R6125:Hgf UTSW 5 16598161 missense probably damaging 1.00
R6749:Hgf UTSW 5 16613642 splice site probably null
R6891:Hgf UTSW 5 16604922 critical splice donor site probably null
R6962:Hgf UTSW 5 16615754 missense probably benign 0.32
R7251:Hgf UTSW 5 16593944 missense possibly damaging 0.95
R7296:Hgf UTSW 5 16564843 missense probably benign 0.39
R7463:Hgf UTSW 5 16578450 missense probably benign 0.00
R7470:Hgf UTSW 5 16618856 missense probably benign 0.02
R7630:Hgf UTSW 5 16598250 missense probably benign 0.01
R7807:Hgf UTSW 5 16577011 missense probably damaging 0.99
R8098:Hgf UTSW 5 16561061 missense probably benign 0.04
R8120:Hgf UTSW 5 16613781 missense probably damaging 1.00
R8132:Hgf UTSW 5 16602331 missense probably damaging 1.00
X0024:Hgf UTSW 5 16604828 missense probably damaging 1.00
Z1088:Hgf UTSW 5 16618919 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCGCAGAGGTATATTGTGTTGTC -3'
(R):5'- AGGACTGGTTGTGTTGACTACC -3'

Sequencing Primer
(F):5'- AGGTATATTGTGTTGTCCTATGTCC -3'
(R):5'- GGTTGTGTTGACTACCAAAAACG -3'
Posted On2014-08-25