Incidental Mutation 'R1983:Ryr1'
ID 220142
Institutional Source Beutler Lab
Gene Symbol Ryr1
Ensembl Gene ENSMUSG00000030592
Gene Name ryanodine receptor 1, skeletal muscle
Synonyms skrr, calcium release channel isoform 1, Ryr
MMRRC Submission 039995-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1983 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 29003344-29125179 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 29059472 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 3427 (N3427S)
Ref Sequence ENSEMBL: ENSMUSP00000149042 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032813] [ENSMUST00000179893] [ENSMUST00000214374]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000032813
AA Change: N3420S

PolyPhen 2 Score 0.117 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000032813
Gene: ENSMUSG00000030592
AA Change: N3420S

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
MIR 99 154 7.52e-4 SMART
MIR 161 206 1.11e-6 SMART
MIR 212 266 1.23e-8 SMART
MIR 272 362 1.05e-25 SMART
Pfam:RYDR_ITPR 441 645 1.2e-73 PFAM
SPRY 660 798 2.79e-27 SMART
Pfam:RyR 851 945 6.5e-33 PFAM
Pfam:RyR 965 1059 1.5e-30 PFAM
SPRY 1086 1209 8.62e-42 SMART
low complexity region 1318 1332 N/A INTRINSIC
low complexity region 1340 1349 N/A INTRINSIC
SPRY 1431 1571 3.05e-33 SMART
low complexity region 1787 1798 N/A INTRINSIC
coiled coil region 1871 1932 N/A INTRINSIC
low complexity region 1989 1998 N/A INTRINSIC
low complexity region 2048 2057 N/A INTRINSIC
low complexity region 2069 2092 N/A INTRINSIC
Pfam:RYDR_ITPR 2158 2366 7e-66 PFAM
low complexity region 2390 2404 N/A INTRINSIC
Pfam:RyR 2735 2829 9.7e-34 PFAM
Pfam:RyR 2855 2943 5.7e-32 PFAM
low complexity region 3130 3144 N/A INTRINSIC
low complexity region 3290 3304 N/A INTRINSIC
low complexity region 3375 3394 N/A INTRINSIC
PDB:2BCX|B 3613 3642 2e-13 PDB
low complexity region 3681 3691 N/A INTRINSIC
low complexity region 3735 3760 N/A INTRINSIC
Pfam:RIH_assoc 3872 4004 1.9e-41 PFAM
low complexity region 4010 4023 N/A INTRINSIC
Pfam:EF-hand_8 4085 4136 9.8e-8 PFAM
transmembrane domain 4283 4305 N/A INTRINSIC
transmembrane domain 4318 4336 N/A INTRINSIC
transmembrane domain 4341 4363 N/A INTRINSIC
Pfam:RR_TM4-6 4377 4666 2e-86 PFAM
Pfam:Ion_trans 4761 4932 3.4e-10 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000179893
AA Change: N3420S

PolyPhen 2 Score 0.476 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000137123
Gene: ENSMUSG00000030592
AA Change: N3420S

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
MIR 99 154 7.52e-4 SMART
MIR 161 206 1.11e-6 SMART
MIR 212 266 1.23e-8 SMART
MIR 272 362 1.05e-25 SMART
Pfam:RYDR_ITPR 443 638 4.5e-63 PFAM
SPRY 660 798 2.79e-27 SMART
Pfam:RyR 852 942 1.3e-37 PFAM
Pfam:RyR 966 1056 1.6e-28 PFAM
SPRY 1086 1209 8.62e-42 SMART
low complexity region 1318 1332 N/A INTRINSIC
low complexity region 1340 1349 N/A INTRINSIC
SPRY 1431 1571 3.05e-33 SMART
low complexity region 1787 1798 N/A INTRINSIC
coiled coil region 1871 1932 N/A INTRINSIC
low complexity region 1989 1998 N/A INTRINSIC
low complexity region 2048 2057 N/A INTRINSIC
low complexity region 2069 2092 N/A INTRINSIC
Pfam:RYDR_ITPR 2160 2366 2.2e-68 PFAM
low complexity region 2390 2404 N/A INTRINSIC
Pfam:RyR 2736 2826 7.2e-31 PFAM
Pfam:RyR 2856 2940 5.6e-27 PFAM
low complexity region 3130 3144 N/A INTRINSIC
low complexity region 3290 3304 N/A INTRINSIC
low complexity region 3375 3394 N/A INTRINSIC
PDB:2BCX|B 3615 3644 2e-13 PDB
low complexity region 3683 3693 N/A INTRINSIC
low complexity region 3737 3762 N/A INTRINSIC
Pfam:RIH_assoc 3878 3996 6.2e-35 PFAM
low complexity region 4012 4025 N/A INTRINSIC
Pfam:EF-hand_8 4087 4137 1.8e-8 PFAM
transmembrane domain 4285 4307 N/A INTRINSIC
transmembrane domain 4320 4338 N/A INTRINSIC
transmembrane domain 4343 4365 N/A INTRINSIC
Pfam:RR_TM4-6 4379 4668 8.4e-76 PFAM
Pfam:Ion_trans 4763 4946 2.8e-15 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000214374
AA Change: N3427S

PolyPhen 2 Score 0.737 (Sensitivity: 0.85; Specificity: 0.92)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ryanodine receptor found in skeletal muscle. The encoded protein functions as a calcium release channel in the sarcoplasmic reticulum but also serves to connect the sarcoplasmic reticulum and transverse tubule. Mutations in this gene are associated with malignant hyperthermia susceptibility, central core disease, and minicore myopathy with external ophthalmoplegia. Alternatively spliced transcripts encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation and a similar ENU-induced mutation are born with a rounded body shape, edema, thin and misshapened ribs, and abnormal muscle fibers. Mutants die perinatally. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600012H06Rik T A 17: 14,944,010 (GRCm38) V133E probably damaging Het
4932438A13Rik A G 3: 36,887,865 (GRCm38) D273G probably null Het
Aco1 G A 4: 40,175,845 (GRCm38) G160S probably benign Het
Actn2 C T 13: 12,278,810 (GRCm38) R608H probably benign Het
Adora2a A C 10: 75,333,646 (GRCm38) S315R probably benign Het
Arhgap42 T C 9: 9,017,017 (GRCm38) Y382C probably damaging Het
Arsi G A 18: 60,916,651 (GRCm38) G202E probably benign Het
Atg4c A G 4: 99,228,575 (GRCm38) Y318C probably damaging Het
Baz2a C T 10: 128,123,959 (GRCm38) T1408I probably benign Het
Bbx T A 16: 50,209,117 (GRCm38) Q663L possibly damaging Het
Btbd3 T G 2: 138,283,688 (GRCm38) L264R probably damaging Het
Cfi T C 3: 129,868,545 (GRCm38) I391T probably damaging Het
Chadl T C 15: 81,693,896 (GRCm38) I45V probably benign Het
Chd5 C A 4: 152,384,666 (GRCm38) A1853D possibly damaging Het
Cmas G T 6: 142,770,586 (GRCm38) D251Y probably damaging Het
Cyp2d10 A G 15: 82,405,999 (GRCm38) M90T probably benign Het
D630003M21Rik A G 2: 158,208,421 (GRCm38) F714L probably benign Het
Dguok A T 6: 83,487,128 (GRCm38) Y126* probably null Het
Dnaic1 A G 4: 41,603,232 (GRCm38) K172E probably benign Het
Dnaic2 T A 11: 114,735,856 (GRCm38) probably null Het
Efcab6 A T 15: 83,892,962 (GRCm38) probably benign Het
Eln A T 5: 134,736,340 (GRCm38) probably null Het
Epor T C 9: 21,959,400 (GRCm38) T395A probably benign Het
Evc2 G T 5: 37,415,931 (GRCm38) E996* probably null Het
Fam124b T A 1: 80,213,647 (GRCm38) E6D probably benign Het
Fam208b G T 13: 3,574,853 (GRCm38) T1699K possibly damaging Het
Filip1 T A 9: 79,860,092 (GRCm38) K146N probably damaging Het
Filip1l T C 16: 57,571,274 (GRCm38) S742P probably damaging Het
Fsip2 G T 2: 82,979,831 (GRCm38) V2165L probably benign Het
Gcdh A T 8: 84,890,910 (GRCm38) V227E possibly damaging Het
Gm10696 T G 3: 94,176,294 (GRCm38) D70A possibly damaging Het
Gm12185 T C 11: 48,915,356 (GRCm38) N336S probably benign Het
Gm12695 G T 4: 96,738,977 (GRCm38) A399E possibly damaging Het
Gm16503 T A 4: 147,541,292 (GRCm38) V81E unknown Het
Gpr137c T C 14: 45,279,971 (GRCm38) V388A probably benign Het
Hgf A G 5: 16,561,012 (GRCm38) T49A possibly damaging Het
Hspa1a G T 17: 34,970,962 (GRCm38) R322S probably benign Het
Jak3 A T 8: 71,678,375 (GRCm38) Q13L possibly damaging Het
Jak3 A G 8: 71,688,136 (GRCm38) R1098G probably benign Het
Kif11 C T 19: 37,390,776 (GRCm38) T305I possibly damaging Het
Lcor T A 19: 41,558,367 (GRCm38) V130E probably damaging Het
Lmo2 T C 2: 103,981,062 (GRCm38) Y147H probably damaging Het
Lrp1b C T 2: 41,511,404 (GRCm38) probably null Het
Mdga1 G A 17: 29,850,605 (GRCm38) R430C probably damaging Het
Mfsd12 T A 10: 81,362,256 (GRCm38) probably null Het
Mmp27 T A 9: 7,578,897 (GRCm38) probably null Het
Mtnr1a A T 8: 45,087,434 (GRCm38) N144I probably benign Het
Mycbp2 T C 14: 103,145,971 (GRCm38) T3563A probably damaging Het
Myef2 T A 2: 125,098,845 (GRCm38) M355L probably benign Het
Olfr1065 T A 2: 86,445,076 (GRCm38) H302L probably benign Het
Olfr1238 A G 2: 89,406,426 (GRCm38) F218L probably benign Het
Olfr1457 A G 19: 13,095,384 (GRCm38) I88T probably benign Het
Olfr470 C T 7: 107,845,412 (GRCm38) G107D probably benign Het
Parg A G 14: 32,217,696 (GRCm38) K560E probably damaging Het
Pck2 G A 14: 55,544,068 (GRCm38) probably null Het
Pdcd6 T C 13: 74,304,000 (GRCm38) I174V probably benign Het
Pomgnt1 T C 4: 116,151,869 (GRCm38) L57S probably damaging Het
Pomgnt1 C A 4: 116,151,920 (GRCm38) P74Q probably benign Het
Prdm4 T C 10: 85,907,953 (GRCm38) Y146C probably damaging Het
Prl2c2 G C 13: 13,002,201 (GRCm38) T47R probably damaging Het
Prune2 A G 19: 17,020,642 (GRCm38) M248V probably damaging Het
Ric8b T A 10: 85,001,838 (GRCm38) M503K probably damaging Het
Ror2 C T 13: 53,110,408 (GRCm38) V871M probably benign Het
Ryr2 A G 13: 11,585,402 (GRCm38) probably null Het
Scimp C T 11: 70,800,714 (GRCm38) V30I probably damaging Het
Skint4 A G 4: 112,146,492 (GRCm38) E374G probably benign Het
Slc6a20a A G 9: 123,640,587 (GRCm38) Y482H probably damaging Het
Slitrk5 A G 14: 111,680,389 (GRCm38) S482G probably benign Het
Strc T A 2: 121,371,037 (GRCm38) M1229L possibly damaging Het
Terf2 T C 8: 107,083,008 (GRCm38) Y226C probably damaging Het
Tex10 A T 4: 48,460,059 (GRCm38) L431I possibly damaging Het
Tnc A G 4: 63,984,630 (GRCm38) V1470A possibly damaging Het
Ttll13 T C 7: 80,253,616 (GRCm38) I248T possibly damaging Het
Ttn T C 2: 76,789,025 (GRCm38) N16031S possibly damaging Het
Ttn T A 2: 76,756,760 (GRCm38) K21631M probably damaging Het
Uroc1 A T 6: 90,345,369 (GRCm38) S292C probably damaging Het
Vmn1r80 A T 7: 12,193,661 (GRCm38) M233L probably benign Het
Wdr31 A T 4: 62,460,603 (GRCm38) M129K probably damaging Het
Wnk1 A T 6: 119,937,578 (GRCm38) N1754K probably damaging Het
Xirp1 G A 9: 120,016,629 (GRCm38) Q1063* probably null Het
Zfp799 C A 17: 32,822,110 (GRCm38) V32L probably damaging Het
Zfyve9 A T 4: 108,689,189 (GRCm38) D874E possibly damaging Het
Other mutations in Ryr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00321:Ryr1 APN 7 29,102,810 (GRCm38) missense probably damaging 1.00
IGL00335:Ryr1 APN 7 29,124,960 (GRCm38) splice site probably null
IGL00427:Ryr1 APN 7 29,104,737 (GRCm38) splice site probably benign
IGL00559:Ryr1 APN 7 29,012,242 (GRCm38) splice site probably benign
IGL00803:Ryr1 APN 7 29,069,645 (GRCm38) missense possibly damaging 0.95
IGL00886:Ryr1 APN 7 29,024,229 (GRCm38) missense probably damaging 1.00
IGL00948:Ryr1 APN 7 29,020,195 (GRCm38) missense possibly damaging 0.78
IGL01017:Ryr1 APN 7 29,082,543 (GRCm38) missense probably damaging 0.99
IGL01116:Ryr1 APN 7 29,100,202 (GRCm38) splice site probably benign
IGL01385:Ryr1 APN 7 29,056,985 (GRCm38) missense probably damaging 1.00
IGL01482:Ryr1 APN 7 29,052,337 (GRCm38) missense probably damaging 1.00
IGL01529:Ryr1 APN 7 29,075,227 (GRCm38) missense probably damaging 1.00
IGL01543:Ryr1 APN 7 29,091,076 (GRCm38) missense probably damaging 1.00
IGL01653:Ryr1 APN 7 29,078,597 (GRCm38) missense probably damaging 0.99
IGL01701:Ryr1 APN 7 29,059,810 (GRCm38) missense probably damaging 0.98
IGL02051:Ryr1 APN 7 29,071,658 (GRCm38) missense probably benign 0.16
IGL02152:Ryr1 APN 7 29,052,015 (GRCm38) missense possibly damaging 0.95
IGL02271:Ryr1 APN 7 29,094,047 (GRCm38) missense probably benign 0.07
IGL02321:Ryr1 APN 7 29,078,696 (GRCm38) missense probably damaging 1.00
IGL02448:Ryr1 APN 7 29,105,066 (GRCm38) splice site probably benign
IGL02472:Ryr1 APN 7 29,040,844 (GRCm38) missense probably damaging 1.00
IGL02544:Ryr1 APN 7 29,115,599 (GRCm38) missense probably benign 0.24
IGL02666:Ryr1 APN 7 29,019,763 (GRCm38) missense unknown
IGL02672:Ryr1 APN 7 29,004,519 (GRCm38) unclassified probably benign
IGL02677:Ryr1 APN 7 29,110,608 (GRCm38) missense probably benign 0.18
IGL02686:Ryr1 APN 7 29,069,550 (GRCm38) splice site probably benign
IGL02751:Ryr1 APN 7 29,078,774 (GRCm38) missense probably damaging 1.00
IGL02899:Ryr1 APN 7 29,048,795 (GRCm38) missense possibly damaging 0.53
IGL02926:Ryr1 APN 7 29,061,540 (GRCm38) missense probably damaging 1.00
IGL02950:Ryr1 APN 7 29,097,459 (GRCm38) missense probably damaging 1.00
IGL02960:Ryr1 APN 7 29,060,053 (GRCm38) missense probably damaging 1.00
IGL02968:Ryr1 APN 7 29,043,893 (GRCm38) missense probably damaging 1.00
IGL03070:Ryr1 APN 7 29,070,659 (GRCm38) missense probably damaging 1.00
IGL03091:Ryr1 APN 7 29,083,486 (GRCm38) missense possibly damaging 0.85
IGL03100:Ryr1 APN 7 29,104,593 (GRCm38) missense probably damaging 1.00
IGL03107:Ryr1 APN 7 29,075,199 (GRCm38) missense probably damaging 1.00
IGL03117:Ryr1 APN 7 29,102,964 (GRCm38) missense probably damaging 1.00
IGL03118:Ryr1 APN 7 29,015,786 (GRCm38) missense unknown
IGL03146:Ryr1 APN 7 29,094,032 (GRCm38) missense probably benign 0.09
IGL03165:Ryr1 APN 7 29,105,040 (GRCm38) missense probably benign 0.22
IGL03220:Ryr1 APN 7 29,059,855 (GRCm38) missense probably damaging 1.00
R0017:Ryr1 UTSW 7 29,047,542 (GRCm38) missense probably damaging 1.00
R0066:Ryr1 UTSW 7 29,005,567 (GRCm38) unclassified probably benign
R0066:Ryr1 UTSW 7 29,005,567 (GRCm38) unclassified probably benign
R0069:Ryr1 UTSW 7 29,110,505 (GRCm38) splice site probably benign
R0148:Ryr1 UTSW 7 29,052,035 (GRCm38) missense probably damaging 0.99
R0266:Ryr1 UTSW 7 29,040,679 (GRCm38) missense probably damaging 1.00
R0346:Ryr1 UTSW 7 29,067,588 (GRCm38) splice site probably benign
R0387:Ryr1 UTSW 7 29,083,367 (GRCm38) splice site probably benign
R0454:Ryr1 UTSW 7 29,036,075 (GRCm38) missense probably damaging 0.99
R0494:Ryr1 UTSW 7 29,003,793 (GRCm38) splice site probably benign
R0533:Ryr1 UTSW 7 29,078,780 (GRCm38) missense probably damaging 1.00
R0585:Ryr1 UTSW 7 29,036,076 (GRCm38) missense probably damaging 1.00
R0591:Ryr1 UTSW 7 29,104,795 (GRCm38) missense possibly damaging 0.68
R0624:Ryr1 UTSW 7 29,074,609 (GRCm38) missense probably damaging 1.00
R0662:Ryr1 UTSW 7 29,100,189 (GRCm38) missense probably damaging 1.00
R0849:Ryr1 UTSW 7 29,040,679 (GRCm38) missense probably damaging 1.00
R0961:Ryr1 UTSW 7 29,009,697 (GRCm38) missense unknown
R1052:Ryr1 UTSW 7 29,096,258 (GRCm38) missense probably damaging 0.96
R1218:Ryr1 UTSW 7 29,086,109 (GRCm38) missense possibly damaging 0.79
R1340:Ryr1 UTSW 7 29,116,012 (GRCm38) missense probably damaging 0.99
R1513:Ryr1 UTSW 7 29,070,621 (GRCm38) missense probably damaging 1.00
R1543:Ryr1 UTSW 7 29,083,537 (GRCm38) missense possibly damaging 0.67
R1566:Ryr1 UTSW 7 29,092,175 (GRCm38) missense possibly damaging 0.95
R1572:Ryr1 UTSW 7 29,062,191 (GRCm38) missense probably damaging 1.00
R1623:Ryr1 UTSW 7 29,095,490 (GRCm38) missense probably damaging 1.00
R1632:Ryr1 UTSW 7 29,094,261 (GRCm38) missense probably benign 0.03
R1661:Ryr1 UTSW 7 29,101,738 (GRCm38) missense probably damaging 0.98
R1665:Ryr1 UTSW 7 29,036,078 (GRCm38) missense probably damaging 1.00
R1678:Ryr1 UTSW 7 29,116,154 (GRCm38) missense probably damaging 0.99
R1705:Ryr1 UTSW 7 29,078,564 (GRCm38) missense probably damaging 1.00
R1712:Ryr1 UTSW 7 29,047,503 (GRCm38) missense probably benign 0.25
R1720:Ryr1 UTSW 7 29,101,870 (GRCm38) missense probably damaging 0.99
R1799:Ryr1 UTSW 7 29,067,621 (GRCm38) missense probably damaging 1.00
R1847:Ryr1 UTSW 7 29,079,811 (GRCm38) missense probably benign 0.43
R1860:Ryr1 UTSW 7 29,009,552 (GRCm38) missense unknown
R1861:Ryr1 UTSW 7 29,009,552 (GRCm38) missense unknown
R1921:Ryr1 UTSW 7 29,054,944 (GRCm38) missense probably damaging 1.00
R2043:Ryr1 UTSW 7 29,059,631 (GRCm38) missense probably damaging 0.99
R2089:Ryr1 UTSW 7 29,086,049 (GRCm38) missense probably damaging 1.00
R2091:Ryr1 UTSW 7 29,086,049 (GRCm38) missense probably damaging 1.00
R2091:Ryr1 UTSW 7 29,086,049 (GRCm38) missense probably damaging 1.00
R2105:Ryr1 UTSW 7 29,090,150 (GRCm38) missense probably damaging 0.99
R2175:Ryr1 UTSW 7 29,068,442 (GRCm38) missense probably damaging 1.00
R2259:Ryr1 UTSW 7 29,019,741 (GRCm38) missense unknown
R2291:Ryr1 UTSW 7 29,098,777 (GRCm38) missense probably damaging 1.00
R2351:Ryr1 UTSW 7 29,075,293 (GRCm38) missense probably benign 0.18
R2512:Ryr1 UTSW 7 29,103,542 (GRCm38) missense possibly damaging 0.64
R2571:Ryr1 UTSW 7 29,036,126 (GRCm38) missense possibly damaging 0.94
R2571:Ryr1 UTSW 7 29,009,562 (GRCm38) missense unknown
R2885:Ryr1 UTSW 7 29,074,798 (GRCm38) missense probably damaging 0.99
R2886:Ryr1 UTSW 7 29,074,798 (GRCm38) missense probably damaging 0.99
R2889:Ryr1 UTSW 7 29,078,741 (GRCm38) missense possibly damaging 0.76
R3051:Ryr1 UTSW 7 29,053,090 (GRCm38) missense probably damaging 1.00
R3052:Ryr1 UTSW 7 29,053,090 (GRCm38) missense probably damaging 1.00
R3053:Ryr1 UTSW 7 29,053,090 (GRCm38) missense probably damaging 1.00
R3082:Ryr1 UTSW 7 29,045,646 (GRCm38) missense probably damaging 1.00
R3103:Ryr1 UTSW 7 29,074,948 (GRCm38) missense probably damaging 1.00
R3237:Ryr1 UTSW 7 29,069,650 (GRCm38) critical splice acceptor site probably null
R3551:Ryr1 UTSW 7 29,056,997 (GRCm38) missense probably damaging 1.00
R3552:Ryr1 UTSW 7 29,056,997 (GRCm38) missense probably damaging 1.00
R3807:Ryr1 UTSW 7 29,020,152 (GRCm38) missense probably damaging 1.00
R3815:Ryr1 UTSW 7 29,072,902 (GRCm38) missense probably damaging 0.98
R4010:Ryr1 UTSW 7 29,095,124 (GRCm38) missense probably benign 0.41
R4041:Ryr1 UTSW 7 29,085,931 (GRCm38) missense possibly damaging 0.77
R4226:Ryr1 UTSW 7 29,062,151 (GRCm38) nonsense probably null
R4257:Ryr1 UTSW 7 29,082,450 (GRCm38) missense possibly damaging 0.93
R4328:Ryr1 UTSW 7 29,083,059 (GRCm38) missense probably damaging 1.00
R4394:Ryr1 UTSW 7 29,094,242 (GRCm38) missense possibly damaging 0.69
R4485:Ryr1 UTSW 7 29,090,156 (GRCm38) missense probably damaging 0.97
R4550:Ryr1 UTSW 7 29,098,735 (GRCm38) missense probably benign 0.05
R4554:Ryr1 UTSW 7 29,105,008 (GRCm38) missense probably benign 0.03
R4562:Ryr1 UTSW 7 29,074,580 (GRCm38) intron probably benign
R4642:Ryr1 UTSW 7 29,086,038 (GRCm38) missense possibly damaging 0.91
R4669:Ryr1 UTSW 7 29,059,831 (GRCm38) missense probably null 0.99
R4707:Ryr1 UTSW 7 29,045,662 (GRCm38) missense probably damaging 1.00
R4766:Ryr1 UTSW 7 29,085,833 (GRCm38) missense probably damaging 0.96
R4768:Ryr1 UTSW 7 29,004,821 (GRCm38) unclassified probably benign
R4770:Ryr1 UTSW 7 29,109,282 (GRCm38) missense probably damaging 0.99
R4780:Ryr1 UTSW 7 29,095,097 (GRCm38) missense possibly damaging 0.85
R4927:Ryr1 UTSW 7 29,019,983 (GRCm38) missense unknown
R4933:Ryr1 UTSW 7 29,104,298 (GRCm38) missense probably damaging 1.00
R4934:Ryr1 UTSW 7 29,068,095 (GRCm38) missense probably damaging 1.00
R4942:Ryr1 UTSW 7 29,069,573 (GRCm38) missense probably damaging 0.98
R4960:Ryr1 UTSW 7 29,078,783 (GRCm38) missense possibly damaging 0.82
R5007:Ryr1 UTSW 7 29,069,115 (GRCm38) missense probably damaging 1.00
R5011:Ryr1 UTSW 7 29,102,809 (GRCm38) splice site probably null
R5013:Ryr1 UTSW 7 29,102,809 (GRCm38) splice site probably null
R5137:Ryr1 UTSW 7 29,101,858 (GRCm38) missense possibly damaging 0.94
R5167:Ryr1 UTSW 7 29,067,693 (GRCm38) missense probably damaging 1.00
R5239:Ryr1 UTSW 7 29,036,128 (GRCm38) missense probably damaging 1.00
R5291:Ryr1 UTSW 7 29,115,598 (GRCm38) missense probably benign 0.03
R5303:Ryr1 UTSW 7 29,068,482 (GRCm38) missense probably damaging 1.00
R5386:Ryr1 UTSW 7 29,117,416 (GRCm38) missense probably damaging 0.98
R5431:Ryr1 UTSW 7 29,109,812 (GRCm38) missense probably benign 0.39
R5460:Ryr1 UTSW 7 29,071,961 (GRCm38) missense probably damaging 1.00
R5463:Ryr1 UTSW 7 29,024,023 (GRCm38) missense possibly damaging 0.79
R5503:Ryr1 UTSW 7 29,069,028 (GRCm38) missense possibly damaging 0.87
R5541:Ryr1 UTSW 7 29,086,185 (GRCm38) missense probably damaging 1.00
R5573:Ryr1 UTSW 7 29,015,723 (GRCm38) missense unknown
R5575:Ryr1 UTSW 7 29,078,693 (GRCm38) missense possibly damaging 0.77
R5610:Ryr1 UTSW 7 29,111,974 (GRCm38) missense probably benign 0.05
R5658:Ryr1 UTSW 7 29,091,089 (GRCm38) splice site probably null
R5918:Ryr1 UTSW 7 29,009,152 (GRCm38) missense probably benign 0.39
R5926:Ryr1 UTSW 7 29,104,360 (GRCm38) missense probably damaging 1.00
R5938:Ryr1 UTSW 7 29,046,865 (GRCm38) missense probably damaging 1.00
R5939:Ryr1 UTSW 7 29,116,127 (GRCm38) missense probably damaging 0.97
R5947:Ryr1 UTSW 7 29,071,924 (GRCm38) missense probably null 0.98
R5991:Ryr1 UTSW 7 29,104,610 (GRCm38) missense probably damaging 0.99
R5992:Ryr1 UTSW 7 29,067,637 (GRCm38) missense probably damaging 1.00
R5996:Ryr1 UTSW 7 29,024,241 (GRCm38) missense probably benign 0.38
R6075:Ryr1 UTSW 7 29,087,438 (GRCm38) missense probably damaging 1.00
R6091:Ryr1 UTSW 7 29,071,973 (GRCm38) missense probably benign 0.01
R6126:Ryr1 UTSW 7 29,076,239 (GRCm38) missense probably null 1.00
R6147:Ryr1 UTSW 7 29,085,914 (GRCm38) missense possibly damaging 0.88
R6235:Ryr1 UTSW 7 29,116,181 (GRCm38) missense probably benign 0.07
R6279:Ryr1 UTSW 7 29,087,428 (GRCm38) missense possibly damaging 0.93
R6381:Ryr1 UTSW 7 29,075,257 (GRCm38) missense possibly damaging 0.87
R6441:Ryr1 UTSW 7 29,059,695 (GRCm38) missense possibly damaging 0.95
R6443:Ryr1 UTSW 7 29,077,078 (GRCm38) missense probably damaging 0.97
R6459:Ryr1 UTSW 7 29,015,654 (GRCm38) missense probably benign 0.39
R6514:Ryr1 UTSW 7 29,046,841 (GRCm38) missense probably damaging 1.00
R6563:Ryr1 UTSW 7 29,095,492 (GRCm38) missense possibly damaging 0.92
R6660:Ryr1 UTSW 7 29,038,345 (GRCm38) critical splice donor site probably null
R6746:Ryr1 UTSW 7 29,117,404 (GRCm38) missense possibly damaging 0.56
R6785:Ryr1 UTSW 7 29,064,874 (GRCm38) missense probably benign 0.12
R6800:Ryr1 UTSW 7 29,024,316 (GRCm38) missense possibly damaging 0.95
R6939:Ryr1 UTSW 7 29,052,326 (GRCm38) missense possibly damaging 0.91
R6980:Ryr1 UTSW 7 29,109,387 (GRCm38) missense probably benign 0.03
R6995:Ryr1 UTSW 7 29,094,182 (GRCm38) missense probably damaging 0.97
R7065:Ryr1 UTSW 7 29,103,643 (GRCm38) missense probably damaging 1.00
R7123:Ryr1 UTSW 7 29,046,854 (GRCm38) missense probably benign 0.37
R7238:Ryr1 UTSW 7 29,095,382 (GRCm38) missense probably benign 0.24
R7240:Ryr1 UTSW 7 29,052,015 (GRCm38) missense possibly damaging 0.95
R7300:Ryr1 UTSW 7 29,059,511 (GRCm38) missense probably damaging 1.00
R7365:Ryr1 UTSW 7 29,085,755 (GRCm38) missense probably benign 0.05
R7403:Ryr1 UTSW 7 29,013,867 (GRCm38) missense probably benign 0.34
R7422:Ryr1 UTSW 7 29,085,870 (GRCm38) missense probably benign 0.00
R7493:Ryr1 UTSW 7 29,095,205 (GRCm38) missense probably benign 0.44
R7570:Ryr1 UTSW 7 29,078,585 (GRCm38) missense probably damaging 0.98
R7593:Ryr1 UTSW 7 29,036,103 (GRCm38) missense probably damaging 1.00
R7769:Ryr1 UTSW 7 29,098,785 (GRCm38) missense probably damaging 1.00
R7781:Ryr1 UTSW 7 29,067,630 (GRCm38) missense probably damaging 1.00
R7790:Ryr1 UTSW 7 29,104,832 (GRCm38) missense probably benign 0.39
R7799:Ryr1 UTSW 7 29,003,560 (GRCm38) splice site probably null
R7916:Ryr1 UTSW 7 29,090,939 (GRCm38) nonsense probably null
R7922:Ryr1 UTSW 7 29,097,224 (GRCm38) missense probably benign 0.09
R7988:Ryr1 UTSW 7 29,096,171 (GRCm38) missense probably benign 0.29
R7997:Ryr1 UTSW 7 29,003,543 (GRCm38) missense unknown
R8052:Ryr1 UTSW 7 29,083,385 (GRCm38) missense probably benign 0.05
R8096:Ryr1 UTSW 7 29,009,201 (GRCm38) missense unknown
R8116:Ryr1 UTSW 7 29,110,883 (GRCm38) missense probably benign 0.03
R8202:Ryr1 UTSW 7 29,091,032 (GRCm38) missense probably benign 0.18
R8207:Ryr1 UTSW 7 29,090,225 (GRCm38) missense probably damaging 1.00
R8248:Ryr1 UTSW 7 29,069,121 (GRCm38) missense probably damaging 1.00
R8257:Ryr1 UTSW 7 29,064,639 (GRCm38) missense possibly damaging 0.82
R8354:Ryr1 UTSW 7 29,015,717 (GRCm38) missense unknown
R8454:Ryr1 UTSW 7 29,015,717 (GRCm38) missense unknown
R8487:Ryr1 UTSW 7 29,040,867 (GRCm38) missense probably damaging 0.97
R8529:Ryr1 UTSW 7 29,070,084 (GRCm38) missense possibly damaging 0.86
R8545:Ryr1 UTSW 7 29,004,814 (GRCm38) unclassified probably benign
R8678:Ryr1 UTSW 7 29,077,064 (GRCm38) missense probably damaging 0.99
R8717:Ryr1 UTSW 7 29,052,328 (GRCm38) missense probably benign 0.03
R8724:Ryr1 UTSW 7 29,117,377 (GRCm38) missense probably benign 0.04
R8755:Ryr1 UTSW 7 29,092,268 (GRCm38) missense probably benign 0.19
R8772:Ryr1 UTSW 7 29,116,132 (GRCm38) missense probably benign 0.05
R8790:Ryr1 UTSW 7 29,076,872 (GRCm38) missense probably damaging 1.00
R8793:Ryr1 UTSW 7 29,064,859 (GRCm38) missense probably damaging 1.00
R8836:Ryr1 UTSW 7 29,074,666 (GRCm38) missense probably damaging 1.00
R8858:Ryr1 UTSW 7 29,109,213 (GRCm38) missense probably benign 0.00
R8910:Ryr1 UTSW 7 29,071,915 (GRCm38) missense probably damaging 1.00
R8920:Ryr1 UTSW 7 29,090,215 (GRCm38) missense possibly damaging 0.89
R8938:Ryr1 UTSW 7 29,101,933 (GRCm38) missense probably damaging 1.00
R9035:Ryr1 UTSW 7 29,090,997 (GRCm38) missense probably damaging 0.97
R9115:Ryr1 UTSW 7 29,104,564 (GRCm38) nonsense probably null
R9123:Ryr1 UTSW 7 29,071,804 (GRCm38) missense probably damaging 1.00
R9154:Ryr1 UTSW 7 29,069,858 (GRCm38) missense probably benign 0.08
R9189:Ryr1 UTSW 7 29,077,046 (GRCm38) missense probably damaging 1.00
R9200:Ryr1 UTSW 7 29,095,099 (GRCm38) missense probably benign 0.00
R9214:Ryr1 UTSW 7 29,085,762 (GRCm38) missense possibly damaging 0.52
R9216:Ryr1 UTSW 7 29,101,852 (GRCm38) missense probably damaging 0.97
R9240:Ryr1 UTSW 7 29,043,888 (GRCm38) missense probably damaging 1.00
R9261:Ryr1 UTSW 7 29,052,388 (GRCm38) missense possibly damaging 0.91
R9276:Ryr1 UTSW 7 29,102,829 (GRCm38) missense probably damaging 0.99
R9280:Ryr1 UTSW 7 29,102,964 (GRCm38) missense probably damaging 1.00
R9316:Ryr1 UTSW 7 29,017,962 (GRCm38) missense unknown
R9333:Ryr1 UTSW 7 29,074,789 (GRCm38) critical splice donor site probably null
R9459:Ryr1 UTSW 7 29,068,643 (GRCm38) missense probably damaging 1.00
R9468:Ryr1 UTSW 7 29,073,085 (GRCm38) missense probably damaging 1.00
R9486:Ryr1 UTSW 7 29,078,540 (GRCm38) missense probably benign 0.15
R9524:Ryr1 UTSW 7 29,024,175 (GRCm38) missense probably damaging 1.00
R9620:Ryr1 UTSW 7 29,015,713 (GRCm38) missense unknown
R9664:Ryr1 UTSW 7 29,059,667 (GRCm38) missense probably damaging 1.00
R9776:Ryr1 UTSW 7 29,075,239 (GRCm38) missense probably damaging 1.00
X0021:Ryr1 UTSW 7 29,061,531 (GRCm38) missense probably damaging 1.00
Z1176:Ryr1 UTSW 7 29,103,498 (GRCm38) missense probably damaging 1.00
Z1176:Ryr1 UTSW 7 29,086,035 (GRCm38) missense probably benign 0.10
Z1176:Ryr1 UTSW 7 29,020,214 (GRCm38) missense probably damaging 1.00
Z1177:Ryr1 UTSW 7 29,101,922 (GRCm38) missense probably damaging 1.00
Z1177:Ryr1 UTSW 7 29,048,792 (GRCm38) nonsense probably null
Z1177:Ryr1 UTSW 7 29,017,985 (GRCm38) missense unknown
Z1186:Ryr1 UTSW 7 29,082,477 (GRCm38) missense possibly damaging 0.61
Predicted Primers PCR Primer
(F):5'- AACCCAGGAAGGCCTTGTGT -3'
(R):5'- CCATCGGGCGATTGCGTAAG -3'

Sequencing Primer
(F):5'- TGCTGTGCACATAGAAGCC -3'
(R):5'- CGTAAGCGGGCAGGGAAG -3'
Posted On 2014-08-25