Incidental Mutation 'R2023:Recql5'
ID220163
Institutional Source Beutler Lab
Gene Symbol Recql5
Ensembl Gene ENSMUSG00000020752
Gene NameRecQ protein-like 5
SynonymsRecq5b, Recql5b
MMRRC Submission 040032-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.426) question?
Stock #R2023 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location115892595-115933477 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 115893640 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 878 (T878I)
Ref Sequence ENSEMBL: ENSMUSP00000021097 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021097] [ENSMUST00000093911] [ENSMUST00000131578] [ENSMUST00000140174] [ENSMUST00000167507] [ENSMUST00000222123]
Predicted Effect probably benign
Transcript: ENSMUST00000021097
AA Change: T878I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000021097
Gene: ENSMUSG00000020752
AA Change: T878I

DomainStartEndE-ValueType
DEXDc 25 230 1.13e-29 SMART
HELICc 274 355 8.68e-22 SMART
Pfam:RecQ_Zn_bind 366 436 1.8e-12 PFAM
low complexity region 472 499 N/A INTRINSIC
PDB:4BK0|B 516 621 2e-51 PDB
Pfam:RecQ5 626 818 3.1e-97 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000093911
SMART Domains Protein: ENSMUSP00000091439
Gene: ENSMUSG00000034427

DomainStartEndE-ValueType
MYSc 1 640 2.4e-134 SMART
IQ 660 682 1.03e1 SMART
Pfam:MyTH4 837 945 2.1e-23 PFAM
low complexity region 1050 1068 N/A INTRINSIC
low complexity region 1136 1170 N/A INTRINSIC
low complexity region 1207 1246 N/A INTRINSIC
low complexity region 1302 1327 N/A INTRINSIC
low complexity region 1454 1468 N/A INTRINSIC
low complexity region 1489 1509 N/A INTRINSIC
SH3 1735 1792 1.15e-7 SMART
Pfam:MyTH4 1928 2029 8.3e-25 PFAM
B41 2032 2235 6.99e-4 SMART
low complexity region 2243 2253 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000131578
SMART Domains Protein: ENSMUSP00000136178
Gene: ENSMUSG00000020752

DomainStartEndE-ValueType
HELICc 1 82 8.68e-22 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132447
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136774
Predicted Effect probably benign
Transcript: ENSMUST00000140174
SMART Domains Protein: ENSMUSP00000136506
Gene: ENSMUSG00000020752

DomainStartEndE-ValueType
DEXDc 25 230 1.13e-29 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141947
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144824
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147172
Predicted Effect probably benign
Transcript: ENSMUST00000167507
SMART Domains Protein: ENSMUSP00000129226
Gene: ENSMUSG00000034427

DomainStartEndE-ValueType
Pfam:MyTH4 100 205 3.1e-24 PFAM
B41 207 410 6.99e-4 SMART
low complexity region 418 428 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000222123
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 92.4%
Validation Efficiency 97% (60/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a helicase that is important for genome stability. The encoded protein also prevents aberrant homologous recombination by displacing RAD51 from ssDNA. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2011]
PHENOTYPE: Mice homozygous for disruptions in this gene express elevated levels of sister chromatid exchange due to a failure to suppress crossovers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932431P20Rik G T 7: 29,531,534 noncoding transcript Het
9930111J21Rik1 A G 11: 48,948,420 S447P possibly damaging Het
9930111J21Rik2 A G 11: 49,020,317 F430L probably benign Het
Acap2 A G 16: 31,119,415 V297A probably damaging Het
Adam3 G A 8: 24,689,463 R613C possibly damaging Het
Akt1 C T 12: 112,659,637 R67Q probably benign Het
Ambp T C 4: 63,151,465 Y108C probably damaging Het
Apob A G 12: 8,011,090 I3158V probably benign Het
Bank1 T C 3: 136,325,918 T8A probably benign Het
Casp8ap2 T C 4: 32,644,560 V1211A probably benign Het
Ccdc88a G T 11: 29,463,546 E695* probably null Het
Cep68 A C 11: 20,239,888 S375A probably benign Het
Cfap44 A G 16: 44,416,012 I417V probably benign Het
Chrna2 T A 14: 66,142,228 H5Q probably benign Het
Cog7 A T 7: 121,936,970 I549K probably damaging Het
Col28a1 C A 6: 8,083,783 S558I possibly damaging Het
Cyp4f14 A G 17: 32,906,531 I385T probably damaging Het
Erap1 T A 13: 74,666,508 V451E probably benign Het
Frem1 G T 4: 82,913,558 T1988K probably benign Het
Gm10277 TC T 11: 77,786,002 probably null Het
Gm5616 A G 9: 48,450,628 noncoding transcript Het
Gm5709 T C 3: 59,635,721 noncoding transcript Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Hsd11b1 T C 1: 193,240,378 T124A probably benign Het
Itpr3 T A 17: 27,102,811 M1054K possibly damaging Het
Kars T C 8: 112,001,852 N200S probably benign Het
Kdm2a C A 19: 4,322,464 R951L probably damaging Het
Ldhd T A 8: 111,629,946 H61L probably damaging Het
Macf1 G T 4: 123,472,730 A2746E probably damaging Het
Micall2 A G 5: 139,717,511 V190A possibly damaging Het
Mis18bp1 A T 12: 65,149,109 V627E probably damaging Het
Muc4 A T 16: 32,752,254 T711S probably benign Het
Notch4 T C 17: 34,587,528 L1813P probably damaging Het
Nox3 A G 17: 3,694,021 probably benign Het
Olfr32 G T 2: 90,138,856 C94* probably null Het
Olfr487 A G 7: 108,211,842 L229P probably damaging Het
Olfr786 T A 10: 129,437,582 Y257N probably damaging Het
Osbpl2 C A 2: 180,150,176 probably null Het
Pamr1 T A 2: 102,634,535 M343K probably benign Het
Pcdh15 T G 10: 74,631,193 S1684A possibly damaging Het
Pgr T A 9: 8,958,398 V802D probably damaging Het
Pgs1 A G 11: 118,002,402 E55G probably benign Het
Pkd2 T A 5: 104,466,878 probably null Het
Ppp3r2 T C 4: 49,681,723 I76V probably benign Het
Ptprd C T 4: 75,957,104 E1240K probably damaging Het
Rnf17 A G 14: 56,431,579 D233G possibly damaging Het
Sectm1a A G 11: 121,069,582 probably benign Het
Smo A G 6: 29,754,716 N262D possibly damaging Het
Srcin1 A G 11: 97,526,046 S931P probably benign Het
Tcof1 C T 18: 60,833,533 G329R probably damaging Het
Tctex1d4 A G 4: 117,128,307 E109G possibly damaging Het
Thsd7a G A 6: 12,327,536 H1446Y probably benign Het
Tlr11 A G 14: 50,362,569 T671A probably damaging Het
Tmem171 C A 13: 98,692,225 W139L probably damaging Het
Vmn2r101 C T 17: 19,590,106 R385* probably null Het
Vps13c A T 9: 67,936,285 probably benign Het
Zfp287 A C 11: 62,714,982 Y366* probably null Het
Zfp456 A T 13: 67,366,497 C363* probably null Het
Zfp523 A G 17: 28,201,004 probably benign Het
Zfp667 A C 7: 6,305,417 K361N possibly damaging Het
Other mutations in Recql5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01108:Recql5 APN 11 115897181 missense probably benign 0.04
IGL01589:Recql5 APN 11 115894669 missense probably damaging 1.00
IGL02040:Recql5 APN 11 115932797 missense possibly damaging 0.89
IGL02131:Recql5 APN 11 115923242 missense probably benign 0.01
IGL02198:Recql5 APN 11 115894673 missense probably benign 0.00
IGL02236:Recql5 APN 11 115894030 missense probably benign 0.01
IGL02501:Recql5 APN 11 115895091 missense probably benign 0.26
IGL02980:Recql5 APN 11 115893944 splice site probably null
IGL03028:Recql5 APN 11 115894431 missense possibly damaging 0.94
PIT4581001:Recql5 UTSW 11 115932856 missense possibly damaging 0.53
R0152:Recql5 UTSW 11 115894673 missense probably benign
R0269:Recql5 UTSW 11 115928224 missense possibly damaging 0.91
R0317:Recql5 UTSW 11 115894673 missense probably benign
R0511:Recql5 UTSW 11 115928383 missense probably benign 0.00
R0786:Recql5 UTSW 11 115895802 missense probably benign
R0975:Recql5 UTSW 11 115923256 missense probably damaging 1.00
R1170:Recql5 UTSW 11 115897234 missense probably damaging 0.98
R1208:Recql5 UTSW 11 115893156 missense probably damaging 0.98
R1208:Recql5 UTSW 11 115893156 missense probably damaging 0.98
R1807:Recql5 UTSW 11 115895115 missense possibly damaging 0.63
R1872:Recql5 UTSW 11 115923309 missense probably benign 0.15
R1878:Recql5 UTSW 11 115895101 missense probably benign 0.00
R1935:Recql5 UTSW 11 115897191 missense probably benign 0.00
R1936:Recql5 UTSW 11 115897191 missense probably benign 0.00
R1945:Recql5 UTSW 11 115928297 nonsense probably null
R2011:Recql5 UTSW 11 115897097 missense probably benign 0.20
R2012:Recql5 UTSW 11 115897097 missense probably benign 0.20
R2183:Recql5 UTSW 11 115896787 missense probably benign 0.00
R3881:Recql5 UTSW 11 115893954 missense probably benign
R3881:Recql5 UTSW 11 115893955 missense probably benign 0.00
R4093:Recql5 UTSW 11 115904888 missense probably benign 0.05
R4857:Recql5 UTSW 11 115928212 missense probably damaging 1.00
R5245:Recql5 UTSW 11 115893559 missense probably damaging 1.00
R5323:Recql5 UTSW 11 115927389 missense probably damaging 1.00
R5796:Recql5 UTSW 11 115927865 intron probably benign
R6160:Recql5 UTSW 11 115932787 critical splice donor site probably null
R6229:Recql5 UTSW 11 115930714 missense probably damaging 0.96
R6824:Recql5 UTSW 11 115923212 missense possibly damaging 0.83
R7013:Recql5 UTSW 11 115894576 missense probably benign 0.02
R7043:Recql5 UTSW 11 115930676 critical splice donor site probably null
R7135:Recql5 UTSW 11 115930672 splice site probably null
R7354:Recql5 UTSW 11 115928201 missense probably damaging 1.00
R7373:Recql5 UTSW 11 115928372 missense possibly damaging 0.92
R7503:Recql5 UTSW 11 115895055 missense probably benign 0.00
R7574:Recql5 UTSW 11 115928422 missense probably benign
R7597:Recql5 UTSW 11 115928381 missense probably benign 0.03
R7658:Recql5 UTSW 11 115923276 missense probably damaging 1.00
R8025:Recql5 UTSW 11 115928112 missense probably damaging 1.00
R8038:Recql5 UTSW 11 115927352 missense possibly damaging 0.90
R8316:Recql5 UTSW 11 115894035 missense possibly damaging 0.46
X0026:Recql5 UTSW 11 115923261 missense probably damaging 1.00
X0028:Recql5 UTSW 11 115894606 missense probably benign
Predicted Primers PCR Primer
(F):5'- CGAGTATTCCAGGCCTACTCAC -3'
(R):5'- GGGGAAAATCACTTCTCATACTCC -3'

Sequencing Primer
(F):5'- TCACCCTACCTTGGATATAAACCTG -3'
(R):5'- TCTCATACTCCAGCAGCAGGTG -3'
Posted On2014-08-25