Incidental Mutation 'R1983:Filip1'
ID 220167
Institutional Source Beutler Lab
Gene Symbol Filip1
Ensembl Gene ENSMUSG00000034898
Gene Name filamin A interacting protein 1
Synonyms 5730485H21Rik
MMRRC Submission 039995-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.264) question?
Stock # R1983 (G1)
Quality Score 190
Status Not validated
Chromosome 9
Chromosomal Location 79815051-80012851 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 79860092 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Asparagine at position 146 (K146N)
Ref Sequence ENSEMBL: ENSMUSP00000091329 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093811] [ENSMUST00000172973]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000093811
AA Change: K146N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000091329
Gene: ENSMUSG00000034898
AA Change: K146N

Pfam:CortBP2 71 256 2.1e-64 PFAM
coiled coil region 258 540 N/A INTRINSIC
low complexity region 545 564 N/A INTRINSIC
low complexity region 579 592 N/A INTRINSIC
coiled coil region 625 778 N/A INTRINSIC
low complexity region 928 940 N/A INTRINSIC
low complexity region 1126 1140 N/A INTRINSIC
low complexity region 1168 1180 N/A INTRINSIC
low complexity region 1198 1214 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000172973
AA Change: K146N

PolyPhen 2 Score 0.770 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000134427
Gene: ENSMUSG00000034898
AA Change: K146N

Pfam:CortBP2 65 225 5.2e-74 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a filamin A binding protein. The encoded protein promotes the degradation of filamin A and may regulate cortical neuron migration and dendritic spine morphology. Mice lacking a functional copy of this gene exhibit reduced dendritic spine length and altered excitatory signaling. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600012H06Rik T A 17: 14,944,010 V133E probably damaging Het
4932438A13Rik A G 3: 36,887,865 D273G probably null Het
Aco1 G A 4: 40,175,845 G160S probably benign Het
Actn2 C T 13: 12,278,810 R608H probably benign Het
Adora2a A C 10: 75,333,646 S315R probably benign Het
Arhgap42 T C 9: 9,017,017 Y382C probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Atg4c A G 4: 99,228,575 Y318C probably damaging Het
Baz2a C T 10: 128,123,959 T1408I probably benign Het
Bbx T A 16: 50,209,117 Q663L possibly damaging Het
Btbd3 T G 2: 138,283,688 L264R probably damaging Het
Cfi T C 3: 129,868,545 I391T probably damaging Het
Chadl T C 15: 81,693,896 I45V probably benign Het
Chd5 C A 4: 152,384,666 A1853D possibly damaging Het
Cmas G T 6: 142,770,586 D251Y probably damaging Het
Cyp2d10 A G 15: 82,405,999 M90T probably benign Het
D630003M21Rik A G 2: 158,208,421 F714L probably benign Het
Dguok A T 6: 83,487,128 Y126* probably null Het
Dnaic1 A G 4: 41,603,232 K172E probably benign Het
Dnaic2 T A 11: 114,735,856 probably null Het
Efcab6 A T 15: 83,892,962 probably benign Het
Eln A T 5: 134,736,340 probably null Het
Epor T C 9: 21,959,400 T395A probably benign Het
Evc2 G T 5: 37,415,931 E996* probably null Het
Fam124b T A 1: 80,213,647 E6D probably benign Het
Fam208b G T 13: 3,574,853 T1699K possibly damaging Het
Filip1l T C 16: 57,571,274 S742P probably damaging Het
Fsip2 G T 2: 82,979,831 V2165L probably benign Het
Gcdh A T 8: 84,890,910 V227E possibly damaging Het
Gm10696 T G 3: 94,176,294 D70A possibly damaging Het
Gm12185 T C 11: 48,915,356 N336S probably benign Het
Gm12695 G T 4: 96,738,977 A399E possibly damaging Het
Gm16503 T A 4: 147,541,292 V81E unknown Het
Gpr137c T C 14: 45,279,971 V388A probably benign Het
Hgf A G 5: 16,561,012 T49A possibly damaging Het
Hspa1a G T 17: 34,970,962 R322S probably benign Het
Jak3 A T 8: 71,678,375 Q13L possibly damaging Het
Jak3 A G 8: 71,688,136 R1098G probably benign Het
Kif11 C T 19: 37,390,776 T305I possibly damaging Het
Lcor T A 19: 41,558,367 V130E probably damaging Het
Lmo2 T C 2: 103,981,062 Y147H probably damaging Het
Lrp1b C T 2: 41,511,404 probably null Het
Mdga1 G A 17: 29,850,605 R430C probably damaging Het
Mfsd12 T A 10: 81,362,256 probably null Het
Mmp27 T A 9: 7,578,897 probably null Het
Mtnr1a A T 8: 45,087,434 N144I probably benign Het
Mycbp2 T C 14: 103,145,971 T3563A probably damaging Het
Myef2 T A 2: 125,098,845 M355L probably benign Het
Olfr1065 T A 2: 86,445,076 H302L probably benign Het
Olfr1238 A G 2: 89,406,426 F218L probably benign Het
Olfr1457 A G 19: 13,095,384 I88T probably benign Het
Olfr470 C T 7: 107,845,412 G107D probably benign Het
Parg A G 14: 32,217,696 K560E probably damaging Het
Pck2 G A 14: 55,544,068 probably null Het
Pdcd6 T C 13: 74,304,000 I174V probably benign Het
Pomgnt1 T C 4: 116,151,869 L57S probably damaging Het
Pomgnt1 C A 4: 116,151,920 P74Q probably benign Het
Prdm4 T C 10: 85,907,953 Y146C probably damaging Het
Prl2c2 G C 13: 13,002,201 T47R probably damaging Het
Prune2 A G 19: 17,020,642 M248V probably damaging Het
Ric8b T A 10: 85,001,838 M503K probably damaging Het
Ror2 C T 13: 53,110,408 V871M probably benign Het
Ryr1 T C 7: 29,059,472 N3427S possibly damaging Het
Ryr2 A G 13: 11,585,402 probably null Het
Scimp C T 11: 70,800,714 V30I probably damaging Het
Skint4 A G 4: 112,146,492 E374G probably benign Het
Slc6a20a A G 9: 123,640,587 Y482H probably damaging Het
Slitrk5 A G 14: 111,680,389 S482G probably benign Het
Strc T A 2: 121,371,037 M1229L possibly damaging Het
Terf2 T C 8: 107,083,008 Y226C probably damaging Het
Tex10 A T 4: 48,460,059 L431I possibly damaging Het
Tnc A G 4: 63,984,630 V1470A possibly damaging Het
Ttll13 T C 7: 80,253,616 I248T possibly damaging Het
Ttn T A 2: 76,756,760 K21631M probably damaging Het
Ttn T C 2: 76,789,025 N16031S possibly damaging Het
Uroc1 A T 6: 90,345,369 S292C probably damaging Het
Vmn1r80 A T 7: 12,193,661 M233L probably benign Het
Wdr31 A T 4: 62,460,603 M129K probably damaging Het
Wnk1 A T 6: 119,937,578 N1754K probably damaging Het
Xirp1 G A 9: 120,016,629 Q1063* probably null Het
Zfp799 C A 17: 32,822,110 V32L probably damaging Het
Zfyve9 A T 4: 108,689,189 D874E possibly damaging Het
Other mutations in Filip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Filip1 APN 9 79817944 missense probably damaging 1.00
IGL01101:Filip1 APN 9 79898246 missense probably benign 0.44
IGL01301:Filip1 APN 9 79819180 missense possibly damaging 0.93
IGL01887:Filip1 APN 9 79819617 missense probably benign 0.42
IGL02119:Filip1 APN 9 79818266 missense probably benign
IGL02285:Filip1 APN 9 79820126 missense probably damaging 1.00
IGL02395:Filip1 APN 9 79898410 missense probably benign 0.01
IGL03398:Filip1 APN 9 79818943 missense probably benign 0.03
IGL03400:Filip1 APN 9 79820473 missense probably benign 0.01
IGL03404:Filip1 APN 9 79818559 missense probably damaging 0.99
ANU18:Filip1 UTSW 9 79819180 missense possibly damaging 0.93
BB010:Filip1 UTSW 9 79820047 missense possibly damaging 0.65
BB020:Filip1 UTSW 9 79820047 missense possibly damaging 0.65
R0101:Filip1 UTSW 9 79819528 missense probably benign 0.04
R0243:Filip1 UTSW 9 79819003 missense probably damaging 0.98
R0244:Filip1 UTSW 9 79819462 missense possibly damaging 0.87
R0371:Filip1 UTSW 9 79860091 missense probably damaging 1.00
R0399:Filip1 UTSW 9 79818310 missense possibly damaging 0.71
R0412:Filip1 UTSW 9 79820289 missense possibly damaging 0.59
R0671:Filip1 UTSW 9 79819390 missense probably damaging 1.00
R1314:Filip1 UTSW 9 79820566 missense probably damaging 1.00
R1465:Filip1 UTSW 9 79898307 missense probably benign 0.25
R1465:Filip1 UTSW 9 79898307 missense probably benign 0.25
R1602:Filip1 UTSW 9 79820591 missense probably damaging 0.99
R1801:Filip1 UTSW 9 79815846 missense probably damaging 0.98
R1929:Filip1 UTSW 9 79819930 missense probably damaging 1.00
R2066:Filip1 UTSW 9 79820216 missense probably damaging 1.00
R2128:Filip1 UTSW 9 79819330 missense probably damaging 0.99
R2271:Filip1 UTSW 9 79819930 missense probably damaging 1.00
R2411:Filip1 UTSW 9 79898433 missense probably damaging 0.98
R3429:Filip1 UTSW 9 79853670 missense probably damaging 1.00
R3430:Filip1 UTSW 9 79853670 missense probably damaging 1.00
R3945:Filip1 UTSW 9 79818367 missense probably benign 0.01
R4007:Filip1 UTSW 9 79818727 missense possibly damaging 0.71
R4583:Filip1 UTSW 9 79815809 missense possibly damaging 0.76
R4803:Filip1 UTSW 9 79820114 missense probably benign 0.05
R4837:Filip1 UTSW 9 79819459 missense probably damaging 0.98
R4910:Filip1 UTSW 9 79817932 missense probably benign 0.00
R4929:Filip1 UTSW 9 79819747 missense probably benign 0.07
R5387:Filip1 UTSW 9 79818274 missense probably benign
R5581:Filip1 UTSW 9 79819760 missense possibly damaging 0.95
R5808:Filip1 UTSW 9 79818701 missense possibly damaging 0.67
R5891:Filip1 UTSW 9 79819860 missense possibly damaging 0.69
R6166:Filip1 UTSW 9 79819454 missense probably damaging 0.99
R6273:Filip1 UTSW 9 79815886 missense probably benign 0.01
R6380:Filip1 UTSW 9 79819624 missense probably damaging 0.99
R6385:Filip1 UTSW 9 79820531 missense possibly damaging 0.68
R6614:Filip1 UTSW 9 79815839 missense probably damaging 1.00
R6715:Filip1 UTSW 9 79818758 missense probably benign 0.03
R7047:Filip1 UTSW 9 79853634 missense probably damaging 0.98
R7126:Filip1 UTSW 9 79898295 missense possibly damaging 0.88
R7144:Filip1 UTSW 9 79820213 missense possibly damaging 0.65
R7218:Filip1 UTSW 9 79818074 missense probably benign
R7404:Filip1 UTSW 9 79820098 missense possibly damaging 0.94
R7702:Filip1 UTSW 9 79820649 missense probably benign 0.20
R7866:Filip1 UTSW 9 79818943 missense probably benign 0.03
R7933:Filip1 UTSW 9 79820047 missense possibly damaging 0.65
R8012:Filip1 UTSW 9 79817959 missense probably damaging 0.97
R8097:Filip1 UTSW 9 79818259 missense probably benign
R8213:Filip1 UTSW 9 79818092 missense probably benign 0.01
R8305:Filip1 UTSW 9 79820475 nonsense probably null
R8798:Filip1 UTSW 9 79820090 missense possibly damaging 0.94
R9184:Filip1 UTSW 9 79898260 missense probably benign 0.03
R9322:Filip1 UTSW 9 79819732 missense probably benign 0.01
R9334:Filip1 UTSW 9 79818457 missense probably benign 0.32
R9353:Filip1 UTSW 9 79818341 missense possibly damaging 0.67
X0054:Filip1 UTSW 9 79819535 missense probably damaging 0.98
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- ctttctctccctctatccct -3'
Posted On 2014-08-25