Mutagenetix > Incidental Mutation

Incidental Mutation 'R1983:Filip1'

220167

Institutional Source

Beutler Lab

Gene Symbol

Filip1

Ensembl Gene

ENSMUSG00000034898

Gene Name

filamin A interacting protein 1

Synonyms

5730485H21Rik

MMRRC Submission

039995-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.422) question?

Stock #

R1983 (G1)

Quality Score

190

Status

Not validated

Chromosome

Chromosomal Location

79815051-80012851 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 79860092 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Asparagine at position 146 (K146N)

Ref Sequence

ENSEMBL: ENSMUSP00000091329 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000093811] [ENSMUST00000172973]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000093811
AA Change: K146N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000091329
Gene: ENSMUSG00000034898
AA Change: K146N

Domain	Start	End	E-Value	Type
Pfam:CortBP2	71	256	2.1e-64	PFAM
coiled coil region	258	540	N/A	INTRINSIC
low complexity region	545	564	N/A	INTRINSIC
low complexity region	579	592	N/A	INTRINSIC
coiled coil region	625	778	N/A	INTRINSIC
low complexity region	928	940	N/A	INTRINSIC
low complexity region	1126	1140	N/A	INTRINSIC
low complexity region	1168	1180	N/A	INTRINSIC
low complexity region	1198	1214	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000172973
AA Change: K146N

PolyPhen 2 Score 0.770 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000134427
Gene: ENSMUSG00000034898
AA Change: K146N

Domain	Start	End	E-Value	Type
Pfam:CortBP2	65	225	5.2e-74	PFAM

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a filamin A binding protein. The encoded protein promotes the degradation of filamin A and may regulate cortical neuron migration and dendritic spine morphology. Mice lacking a functional copy of this gene exhibit reduced dendritic spine length and altered excitatory signaling. [provided by RefSeq, Oct 2016]

Allele List at MGI

Other mutations in this stock

Total: 82 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1600012H06Rik	T	A	17: 14,944,010	V133E	probably damaging	Het
4932438A13Rik	A	G	3: 36,887,865	D273G	probably null	Het
Aco1	G	A	4: 40,175,845	G160S	probably benign	Het
Actn2	C	T	13: 12,278,810	R608H	probably benign	Het
Adora2a	A	C	10: 75,333,646	S315R	probably benign	Het
Arhgap42	T	C	9: 9,017,017	Y382C	probably damaging	Het
Arsi	G	A	18: 60,916,651	G202E	probably benign	Het
Atg4c	A	G	4: 99,228,575	Y318C	probably damaging	Het
Baz2a	C	T	10: 128,123,959	T1408I	probably benign	Het
Bbx	T	A	16: 50,209,117	Q663L	possibly damaging	Het
Btbd3	T	G	2: 138,283,688	L264R	probably damaging	Het
Cfi	T	C	3: 129,868,545	I391T	probably damaging	Het
Chadl	T	C	15: 81,693,896	I45V	probably benign	Het
Chd5	C	A	4: 152,384,666	A1853D	possibly damaging	Het
Cmas	G	T	6: 142,770,586	D251Y	probably damaging	Het
Cyp2d10	A	G	15: 82,405,999	M90T	probably benign	Het
D630003M21Rik	A	G	2: 158,208,421	F714L	probably benign	Het
Dguok	A	T	6: 83,487,128	Y126*	probably null	Het
Dnaic1	A	G	4: 41,603,232	K172E	probably benign	Het
Dnaic2	T	A	11: 114,735,856		probably null	Het
Efcab6	A	T	15: 83,892,962		probably benign	Het
Eln	A	T	5: 134,736,340		probably null	Het
Epor	T	C	9: 21,959,400	T395A	probably benign	Het
Evc2	G	T	5: 37,415,931	E996*	probably null	Het
Fam124b	T	A	1: 80,213,647	E6D	probably benign	Het
Fam208b	G	T	13: 3,574,853	T1699K	possibly damaging	Het
Filip1l	T	C	16: 57,571,274	S742P	probably damaging	Het
Fsip2	G	T	2: 82,979,831	V2165L	probably benign	Het
Gcdh	A	T	8: 84,890,910	V227E	possibly damaging	Het
Gm10696	T	G	3: 94,176,294	D70A	possibly damaging	Het
Gm12185	T	C	11: 48,915,356	N336S	probably benign	Het
Gm12695	G	T	4: 96,738,977	A399E	possibly damaging	Het
Gm16503	T	A	4: 147,541,292	V81E	unknown	Het
Gpr137c	T	C	14: 45,279,971	V388A	probably benign	Het
Hgf	A	G	5: 16,561,012	T49A	possibly damaging	Het
Hspa1a	G	T	17: 34,970,962	R322S	probably benign	Het
Jak3	A	T	8: 71,678,375	Q13L	possibly damaging	Het
Jak3	A	G	8: 71,688,136	R1098G	probably benign	Het
Kif11	C	T	19: 37,390,776	T305I	possibly damaging	Het
Lcor	T	A	19: 41,558,367	V130E	probably damaging	Het
Lmo2	T	C	2: 103,981,062	Y147H	probably damaging	Het
Lrp1b	C	T	2: 41,511,404		probably null	Het
Mdga1	G	A	17: 29,850,605	R430C	probably damaging	Het
Mfsd12	T	A	10: 81,362,256		probably null	Het
Mmp27	T	A	9: 7,578,897		probably null	Het
Mtnr1a	A	T	8: 45,087,434	N144I	probably benign	Het
Mycbp2	T	C	14: 103,145,971	T3563A	probably damaging	Het
Myef2	T	A	2: 125,098,845	M355L	probably benign	Het
Olfr1065	T	A	2: 86,445,076	H302L	probably benign	Het
Olfr1238	A	G	2: 89,406,426	F218L	probably benign	Het
Olfr1457	A	G	19: 13,095,384	I88T	probably benign	Het
Olfr470	C	T	7: 107,845,412	G107D	probably benign	Het
Parg	A	G	14: 32,217,696	K560E	probably damaging	Het
Pck2	G	A	14: 55,544,068		probably null	Het
Pdcd6	T	C	13: 74,304,000	I174V	probably benign	Het
Pomgnt1	T	C	4: 116,151,869	L57S	probably damaging	Het
Pomgnt1	C	A	4: 116,151,920	P74Q	probably benign	Het
Prdm4	T	C	10: 85,907,953	Y146C	probably damaging	Het
Prl2c2	G	C	13: 13,002,201	T47R	probably damaging	Het
Prune2	A	G	19: 17,020,642	M248V	probably damaging	Het
Ric8b	T	A	10: 85,001,838	M503K	probably damaging	Het
Ror2	C	T	13: 53,110,408	V871M	probably benign	Het
Ryr1	T	C	7: 29,059,472	N3427S	possibly damaging	Het
Ryr2	A	G	13: 11,585,402		probably null	Het
Scimp	C	T	11: 70,800,714	V30I	probably damaging	Het
Skint4	A	G	4: 112,146,492	E374G	probably benign	Het
Slc6a20a	A	G	9: 123,640,587	Y482H	probably damaging	Het
Slitrk5	A	G	14: 111,680,389	S482G	probably benign	Het
Strc	T	A	2: 121,371,037	M1229L	possibly damaging	Het
Terf2	T	C	8: 107,083,008	Y226C	probably damaging	Het
Tex10	A	T	4: 48,460,059	L431I	possibly damaging	Het
Tnc	A	G	4: 63,984,630	V1470A	possibly damaging	Het
Ttll13	T	C	7: 80,253,616	I248T	possibly damaging	Het
Ttn	T	A	2: 76,756,760	K21631M	probably damaging	Het
Ttn	T	C	2: 76,789,025	N16031S	possibly damaging	Het
Uroc1	A	T	6: 90,345,369	S292C	probably damaging	Het
Vmn1r80	A	T	7: 12,193,661	M233L	probably benign	Het
Wdr31	A	T	4: 62,460,603	M129K	probably damaging	Het
Wnk1	A	T	6: 119,937,578	N1754K	probably damaging	Het
Xirp1	G	A	9: 120,016,629	Q1063*	probably null	Het
Zfp799	C	A	17: 32,822,110	V32L	probably damaging	Het
Zfyve9	A	T	4: 108,689,189	D874E	possibly damaging	Het

Other mutations in Filip1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00420:Filip1	APN	9	79817944	missense	probably damaging	1.00
IGL01101:Filip1	APN	9	79898246	missense	probably benign	0.44
IGL01301:Filip1	APN	9	79819180	missense	possibly damaging	0.93
IGL01887:Filip1	APN	9	79819617	missense	probably benign	0.42
IGL02119:Filip1	APN	9	79818266	missense	probably benign
IGL02285:Filip1	APN	9	79820126	missense	probably damaging	1.00
IGL02395:Filip1	APN	9	79898410	missense	probably benign	0.01
IGL03398:Filip1	APN	9	79818943	missense	probably benign	0.03
IGL03400:Filip1	APN	9	79820473	missense	probably benign	0.01
IGL03404:Filip1	APN	9	79818559	missense	probably damaging	0.99
ANU18:Filip1	UTSW	9	79819180	missense	possibly damaging	0.93
BB010:Filip1	UTSW	9	79820047	missense	possibly damaging	0.65
BB020:Filip1	UTSW	9	79820047	missense	possibly damaging	0.65
R0101:Filip1	UTSW	9	79819528	missense	probably benign	0.04
R0243:Filip1	UTSW	9	79819003	missense	probably damaging	0.98
R0244:Filip1	UTSW	9	79819462	missense	possibly damaging	0.87
R0371:Filip1	UTSW	9	79860091	missense	probably damaging	1.00
R0399:Filip1	UTSW	9	79818310	missense	possibly damaging	0.71
R0412:Filip1	UTSW	9	79820289	missense	possibly damaging	0.59
R0671:Filip1	UTSW	9	79819390	missense	probably damaging	1.00
R1314:Filip1	UTSW	9	79820566	missense	probably damaging	1.00
R1465:Filip1	UTSW	9	79898307	missense	probably benign	0.25
R1465:Filip1	UTSW	9	79898307	missense	probably benign	0.25
R1602:Filip1	UTSW	9	79820591	missense	probably damaging	0.99
R1801:Filip1	UTSW	9	79815846	missense	probably damaging	0.98
R1929:Filip1	UTSW	9	79819930	missense	probably damaging	1.00
R2066:Filip1	UTSW	9	79820216	missense	probably damaging	1.00
R2128:Filip1	UTSW	9	79819330	missense	probably damaging	0.99
R2271:Filip1	UTSW	9	79819930	missense	probably damaging	1.00
R2411:Filip1	UTSW	9	79898433	missense	probably damaging	0.98
R3429:Filip1	UTSW	9	79853670	missense	probably damaging	1.00
R3430:Filip1	UTSW	9	79853670	missense	probably damaging	1.00
R3945:Filip1	UTSW	9	79818367	missense	probably benign	0.01
R4007:Filip1	UTSW	9	79818727	missense	possibly damaging	0.71
R4583:Filip1	UTSW	9	79815809	missense	possibly damaging	0.76
R4803:Filip1	UTSW	9	79820114	missense	probably benign	0.05
R4837:Filip1	UTSW	9	79819459	missense	probably damaging	0.98
R4910:Filip1	UTSW	9	79817932	missense	probably benign	0.00
R4929:Filip1	UTSW	9	79819747	missense	probably benign	0.07
R5387:Filip1	UTSW	9	79818274	missense	probably benign
R5581:Filip1	UTSW	9	79819760	missense	possibly damaging	0.95
R5808:Filip1	UTSW	9	79818701	missense	possibly damaging	0.67
R5891:Filip1	UTSW	9	79819860	missense	possibly damaging	0.69
R6166:Filip1	UTSW	9	79819454	missense	probably damaging	0.99
R6273:Filip1	UTSW	9	79815886	missense	probably benign	0.01
R6380:Filip1	UTSW	9	79819624	missense	probably damaging	0.99
R6385:Filip1	UTSW	9	79820531	missense	possibly damaging	0.68
R6614:Filip1	UTSW	9	79815839	missense	probably damaging	1.00
R6715:Filip1	UTSW	9	79818758	missense	probably benign	0.03
R7047:Filip1	UTSW	9	79853634	missense	probably damaging	0.98
R7126:Filip1	UTSW	9	79898295	missense	possibly damaging	0.88
R7144:Filip1	UTSW	9	79820213	missense	possibly damaging	0.65
R7218:Filip1	UTSW	9	79818074	missense	probably benign
R7404:Filip1	UTSW	9	79820098	missense	possibly damaging	0.94
R7702:Filip1	UTSW	9	79820649	missense	probably benign	0.20
R7866:Filip1	UTSW	9	79818943	missense	probably benign	0.03
R7933:Filip1	UTSW	9	79820047	missense	possibly damaging	0.65
R8012:Filip1	UTSW	9	79817959	missense	probably damaging	0.97
R8097:Filip1	UTSW	9	79818259	missense	probably benign
R8213:Filip1	UTSW	9	79818092	missense	probably benign	0.01
R8305:Filip1	UTSW	9	79820475	nonsense	probably null
R8798:Filip1	UTSW	9	79820090	missense	possibly damaging	0.94
R9184:Filip1	UTSW	9	79898260	missense	probably benign	0.03
R9322:Filip1	UTSW	9	79819732	missense	probably benign	0.01
R9334:Filip1	UTSW	9	79818457	missense	probably benign	0.32
R9353:Filip1	UTSW	9	79818341	missense	possibly damaging	0.67
R9541:Filip1	UTSW	9	79819853	nonsense	probably null
R9607:Filip1	UTSW	9	79819120	missense	probably damaging	1.00
X0054:Filip1	UTSW	9	79819535	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- CCTATCAGAACATATCTAGTCCAGATC -3'
(R):5'- CCTGCTGACTTTGTGAATCTGG -3'

Sequencing Primer
(F):5'- ctttctctccctctatccct -3'
(R):5'- TGAATCTGGGAGCGTCGGC -3'

Posted On

2014-08-25