Incidental Mutation 'R1983:Prdm4'
ID220180
Institutional Source Beutler Lab
Gene Symbol Prdm4
Ensembl Gene ENSMUSG00000035529
Gene NamePR domain containing 4
Synonyms2810470D21Rik, SC-1, 1700031E19Rik
MMRRC Submission 039995-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1983 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location85891966-85917142 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 85907953 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 146 (Y146C)
Ref Sequence ENSEMBL: ENSMUSP00000151931 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037646] [ENSMUST00000218969] [ENSMUST00000219370] [ENSMUST00000220032]
Predicted Effect probably damaging
Transcript: ENSMUST00000037646
AA Change: Y146C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000041942
Gene: ENSMUSG00000035529
AA Change: Y146C

DomainStartEndE-ValueType
low complexity region 14 28 N/A INTRINSIC
low complexity region 33 44 N/A INTRINSIC
low complexity region 51 69 N/A INTRINSIC
low complexity region 339 353 N/A INTRINSIC
PDB:3DB5|B 386 543 2e-98 PDB
Blast:SET 408 538 5e-82 BLAST
ZnF_C2H2 548 569 7.77e1 SMART
low complexity region 575 588 N/A INTRINSIC
ZnF_C2H2 593 615 3.78e-1 SMART
ZnF_C2H2 621 643 2.27e-4 SMART
ZnF_C2H2 649 671 8.02e-5 SMART
ZnF_C2H2 677 699 3.63e-3 SMART
ZnF_C2H2 705 727 3.11e-2 SMART
ZnF_C2H2 733 753 1.81e1 SMART
low complexity region 759 780 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218289
Predicted Effect probably damaging
Transcript: ENSMUST00000218969
AA Change: Y146C

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219112
Predicted Effect probably benign
Transcript: ENSMUST00000219370
Predicted Effect probably damaging
Transcript: ENSMUST00000220032
AA Change: Y146C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the PR/SET family of zinc finger proteins. This protein has been shown to bind DNA in a sequence-specific manner and has been implicated in neural stem cell proliferation and differentiation. Pseudogenes have been identified on chromosomes 14 and X. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2014]
PHENOTYPE: Mice homozygous for alleles lacking the zinc finger domain or PR/SET domain exhibit no abnormal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600012H06Rik T A 17: 14,944,010 V133E probably damaging Het
4932438A13Rik A G 3: 36,887,865 D273G probably null Het
Aco1 G A 4: 40,175,845 G160S probably benign Het
Actn2 C T 13: 12,278,810 R608H probably benign Het
Adora2a A C 10: 75,333,646 S315R probably benign Het
Arhgap42 T C 9: 9,017,017 Y382C probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Atg4c A G 4: 99,228,575 Y318C probably damaging Het
Baz2a C T 10: 128,123,959 T1408I probably benign Het
Bbx T A 16: 50,209,117 Q663L possibly damaging Het
Btbd3 T G 2: 138,283,688 L264R probably damaging Het
Cfi T C 3: 129,868,545 I391T probably damaging Het
Chadl T C 15: 81,693,896 I45V probably benign Het
Chd5 C A 4: 152,384,666 A1853D possibly damaging Het
Cmas G T 6: 142,770,586 D251Y probably damaging Het
Cyp2d10 A G 15: 82,405,999 M90T probably benign Het
D630003M21Rik A G 2: 158,208,421 F714L probably benign Het
Dguok A T 6: 83,487,128 Y126* probably null Het
Dnaic1 A G 4: 41,603,232 K172E probably benign Het
Dnaic2 T A 11: 114,735,856 probably null Het
Efcab6 A T 15: 83,892,962 probably benign Het
Eln A T 5: 134,736,340 probably null Het
Epor T C 9: 21,959,400 T395A probably benign Het
Evc2 G T 5: 37,415,931 E996* probably null Het
Fam124b T A 1: 80,213,647 E6D probably benign Het
Fam208b G T 13: 3,574,853 T1699K possibly damaging Het
Filip1 T A 9: 79,860,092 K146N probably damaging Het
Filip1l T C 16: 57,571,274 S742P probably damaging Het
Fsip2 G T 2: 82,979,831 V2165L probably benign Het
Gcdh A T 8: 84,890,910 V227E possibly damaging Het
Gm10696 T G 3: 94,176,294 D70A possibly damaging Het
Gm12185 T C 11: 48,915,356 N336S probably benign Het
Gm12695 G T 4: 96,738,977 A399E possibly damaging Het
Gm16503 T A 4: 147,541,292 V81E unknown Het
Gpr137c T C 14: 45,279,971 V388A probably benign Het
Hgf A G 5: 16,561,012 T49A possibly damaging Het
Hspa1a G T 17: 34,970,962 R322S probably benign Het
Jak3 A G 8: 71,688,136 R1098G probably benign Het
Jak3 A T 8: 71,678,375 Q13L possibly damaging Het
Kif11 C T 19: 37,390,776 T305I possibly damaging Het
Lcor T A 19: 41,558,367 V130E probably damaging Het
Lmo2 T C 2: 103,981,062 Y147H probably damaging Het
Lrp1b C T 2: 41,511,404 probably null Het
Mdga1 G A 17: 29,850,605 R430C probably damaging Het
Mfsd12 T A 10: 81,362,256 probably null Het
Mmp27 T A 9: 7,578,897 probably null Het
Mtnr1a A T 8: 45,087,434 N144I probably benign Het
Mycbp2 T C 14: 103,145,971 T3563A probably damaging Het
Myef2 T A 2: 125,098,845 M355L probably benign Het
Olfr1065 T A 2: 86,445,076 H302L probably benign Het
Olfr1238 A G 2: 89,406,426 F218L probably benign Het
Olfr1457 A G 19: 13,095,384 I88T probably benign Het
Olfr470 C T 7: 107,845,412 G107D probably benign Het
Parg A G 14: 32,217,696 K560E probably damaging Het
Pck2 G A 14: 55,544,068 probably null Het
Pdcd6 T C 13: 74,304,000 I174V probably benign Het
Pomgnt1 T C 4: 116,151,869 L57S probably damaging Het
Pomgnt1 C A 4: 116,151,920 P74Q probably benign Het
Prl2c2 G C 13: 13,002,201 T47R probably damaging Het
Prune2 A G 19: 17,020,642 M248V probably damaging Het
Ric8b T A 10: 85,001,838 M503K probably damaging Het
Ror2 C T 13: 53,110,408 V871M probably benign Het
Ryr1 T C 7: 29,059,472 N3427S possibly damaging Het
Ryr2 A G 13: 11,585,402 probably null Het
Scimp C T 11: 70,800,714 V30I probably damaging Het
Skint4 A G 4: 112,146,492 E374G probably benign Het
Slc6a20a A G 9: 123,640,587 Y482H probably damaging Het
Slitrk5 A G 14: 111,680,389 S482G probably benign Het
Strc T A 2: 121,371,037 M1229L possibly damaging Het
Terf2 T C 8: 107,083,008 Y226C probably damaging Het
Tex10 A T 4: 48,460,059 L431I possibly damaging Het
Tnc A G 4: 63,984,630 V1470A possibly damaging Het
Ttll13 T C 7: 80,253,616 I248T possibly damaging Het
Ttn T C 2: 76,789,025 N16031S possibly damaging Het
Ttn T A 2: 76,756,760 K21631M probably damaging Het
Uroc1 A T 6: 90,345,369 S292C probably damaging Het
Vmn1r80 A T 7: 12,193,661 M233L probably benign Het
Wdr31 A T 4: 62,460,603 M129K probably damaging Het
Wnk1 A T 6: 119,937,578 N1754K probably damaging Het
Xirp1 G A 9: 120,016,629 Q1063* probably null Het
Zfp799 C A 17: 32,822,110 V32L probably damaging Het
Zfyve9 A T 4: 108,689,189 D874E possibly damaging Het
Other mutations in Prdm4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01864:Prdm4 APN 10 85893236 missense probably benign 0.08
IGL02514:Prdm4 APN 10 85907917 missense probably damaging 0.99
IGL02576:Prdm4 APN 10 85900937 missense possibly damaging 0.86
IGL02674:Prdm4 APN 10 85893399 missense probably damaging 0.99
IGL03002:Prdm4 APN 10 85893152 missense probably benign 0.08
IGL03153:Prdm4 APN 10 85907996 missense probably benign
IGL03278:Prdm4 APN 10 85907758 missense probably damaging 0.99
IGL03338:Prdm4 APN 10 85907821 missense possibly damaging 0.90
R0020:Prdm4 UTSW 10 85907623 missense probably benign
R0133:Prdm4 UTSW 10 85910221 critical splice donor site probably null
R0366:Prdm4 UTSW 10 85908004 missense probably damaging 1.00
R0633:Prdm4 UTSW 10 85907903 missense probably damaging 1.00
R1132:Prdm4 UTSW 10 85899281 missense probably damaging 1.00
R1460:Prdm4 UTSW 10 85907822 missense probably benign 0.28
R1477:Prdm4 UTSW 10 85904265 missense probably benign 0.00
R1680:Prdm4 UTSW 10 85899223 missense possibly damaging 0.96
R1772:Prdm4 UTSW 10 85893392 missense probably damaging 0.99
R2136:Prdm4 UTSW 10 85893351 nonsense probably null
R3426:Prdm4 UTSW 10 85910289 missense probably damaging 1.00
R3723:Prdm4 UTSW 10 85899281 missense probably damaging 1.00
R4490:Prdm4 UTSW 10 85900899 missense probably damaging 1.00
R4750:Prdm4 UTSW 10 85899221 missense probably damaging 1.00
R5561:Prdm4 UTSW 10 85893123 makesense probably null
R5601:Prdm4 UTSW 10 85893123 makesense probably null
R5602:Prdm4 UTSW 10 85893123 makesense probably null
R5604:Prdm4 UTSW 10 85893123 makesense probably null
R5972:Prdm4 UTSW 10 85907501 missense probably damaging 1.00
R6272:Prdm4 UTSW 10 85907830 missense possibly damaging 0.82
R6300:Prdm4 UTSW 10 85910221 critical splice donor site probably null
R6457:Prdm4 UTSW 10 85908032 missense probably damaging 1.00
R6605:Prdm4 UTSW 10 85904138 missense probably benign 0.00
R6642:Prdm4 UTSW 10 85907818 missense probably benign 0.00
R7663:Prdm4 UTSW 10 85899281 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGAGATTGGGCTGGTAACC -3'
(R):5'- GTTCCATAGAGAAACTCAGAATGG -3'

Sequencing Primer
(F):5'- TGGGCTGGTAACCCTAGAAACATTC -3'
(R):5'- CTCAGAATGGCATATATGTGCTAC -3'
Posted On2014-08-25