Incidental Mutation 'R2023:Tlr11'
ID220181
Institutional Source Beutler Lab
Gene Symbol Tlr11
Ensembl Gene ENSMUSG00000051969
Gene Nametoll-like receptor 11
SynonymsLOC239081
MMRRC Submission 040032-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2023 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location50357914-50363663 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 50362569 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 671 (T671A)
Ref Sequence ENSEMBL: ENSMUSP00000138814 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063570] [ENSMUST00000185091]
Predicted Effect probably damaging
Transcript: ENSMUST00000063570
AA Change: T666A

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000068906
Gene: ENSMUSG00000051969
AA Change: T666A

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
low complexity region 105 122 N/A INTRINSIC
low complexity region 153 161 N/A INTRINSIC
LRR 311 333 3.36e1 SMART
LRR 335 361 4.44e0 SMART
LRR 362 383 2.03e1 SMART
LRR_TYP 384 407 2.57e-3 SMART
LRR_TYP 408 431 2.75e-3 SMART
low complexity region 544 556 N/A INTRINSIC
LRR 605 628 6.06e1 SMART
transmembrane domain 719 741 N/A INTRINSIC
Pfam:TIR 773 922 2.1e-9 PFAM
Pfam:TIR_2 776 894 6.6e-13 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000185091
AA Change: T671A

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000138814
Gene: ENSMUSG00000051969
AA Change: T671A

DomainStartEndE-ValueType
transmembrane domain 16 38 N/A INTRINSIC
low complexity region 110 127 N/A INTRINSIC
low complexity region 158 166 N/A INTRINSIC
Pfam:LRR_6 221 244 5.3e-2 PFAM
LRR 316 338 3.36e1 SMART
LRR 340 366 4.44e0 SMART
LRR 367 388 2.03e1 SMART
LRR_TYP 389 412 2.57e-3 SMART
LRR_TYP 413 436 2.75e-3 SMART
low complexity region 549 561 N/A INTRINSIC
LRR 610 633 6.06e1 SMART
transmembrane domain 724 746 N/A INTRINSIC
Pfam:TIR_2 781 898 1e-12 PFAM
Pfam:TIR 781 922 1.8e-13 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 92.4%
Validation Efficiency 97% (60/62)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932431P20Rik G T 7: 29,531,534 noncoding transcript Het
9930111J21Rik1 A G 11: 48,948,420 S447P possibly damaging Het
9930111J21Rik2 A G 11: 49,020,317 F430L probably benign Het
Acap2 A G 16: 31,119,415 V297A probably damaging Het
Adam3 G A 8: 24,689,463 R613C possibly damaging Het
Akt1 C T 12: 112,659,637 R67Q probably benign Het
Ambp T C 4: 63,151,465 Y108C probably damaging Het
Apob A G 12: 8,011,090 I3158V probably benign Het
Bank1 T C 3: 136,325,918 T8A probably benign Het
Casp8ap2 T C 4: 32,644,560 V1211A probably benign Het
Ccdc88a G T 11: 29,463,546 E695* probably null Het
Cep68 A C 11: 20,239,888 S375A probably benign Het
Cfap44 A G 16: 44,416,012 I417V probably benign Het
Chrna2 T A 14: 66,142,228 H5Q probably benign Het
Cog7 A T 7: 121,936,970 I549K probably damaging Het
Col28a1 C A 6: 8,083,783 S558I possibly damaging Het
Cyp4f14 A G 17: 32,906,531 I385T probably damaging Het
Erap1 T A 13: 74,666,508 V451E probably benign Het
Frem1 G T 4: 82,913,558 T1988K probably benign Het
Gm10277 TC T 11: 77,786,002 probably null Het
Gm5616 A G 9: 48,450,628 noncoding transcript Het
Gm5709 T C 3: 59,635,721 noncoding transcript Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Hsd11b1 T C 1: 193,240,378 T124A probably benign Het
Itpr3 T A 17: 27,102,811 M1054K possibly damaging Het
Kars T C 8: 112,001,852 N200S probably benign Het
Kdm2a C A 19: 4,322,464 R951L probably damaging Het
Ldhd T A 8: 111,629,946 H61L probably damaging Het
Macf1 G T 4: 123,472,730 A2746E probably damaging Het
Micall2 A G 5: 139,717,511 V190A possibly damaging Het
Mis18bp1 A T 12: 65,149,109 V627E probably damaging Het
Muc4 A T 16: 32,752,254 T711S probably benign Het
Notch4 T C 17: 34,587,528 L1813P probably damaging Het
Nox3 A G 17: 3,694,021 probably benign Het
Olfr32 G T 2: 90,138,856 C94* probably null Het
Olfr487 A G 7: 108,211,842 L229P probably damaging Het
Olfr786 T A 10: 129,437,582 Y257N probably damaging Het
Osbpl2 C A 2: 180,150,176 probably null Het
Pamr1 T A 2: 102,634,535 M343K probably benign Het
Pcdh15 T G 10: 74,631,193 S1684A possibly damaging Het
Pgr T A 9: 8,958,398 V802D probably damaging Het
Pgs1 A G 11: 118,002,402 E55G probably benign Het
Pkd2 T A 5: 104,466,878 probably null Het
Ppp3r2 T C 4: 49,681,723 I76V probably benign Het
Ptprd C T 4: 75,957,104 E1240K probably damaging Het
Recql5 G A 11: 115,893,640 T878I probably benign Het
Rnf17 A G 14: 56,431,579 D233G possibly damaging Het
Sectm1a A G 11: 121,069,582 probably benign Het
Smo A G 6: 29,754,716 N262D possibly damaging Het
Srcin1 A G 11: 97,526,046 S931P probably benign Het
Tcof1 C T 18: 60,833,533 G329R probably damaging Het
Tctex1d4 A G 4: 117,128,307 E109G possibly damaging Het
Thsd7a G A 6: 12,327,536 H1446Y probably benign Het
Tmem171 C A 13: 98,692,225 W139L probably damaging Het
Vmn2r101 C T 17: 19,590,106 R385* probably null Het
Vps13c A T 9: 67,936,285 probably benign Het
Zfp287 A C 11: 62,714,982 Y366* probably null Het
Zfp456 A T 13: 67,366,497 C363* probably null Het
Zfp523 A G 17: 28,201,004 probably benign Het
Zfp667 A C 7: 6,305,417 K361N possibly damaging Het
Other mutations in Tlr11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00590:Tlr11 APN 14 50360916 missense probably benign
IGL02090:Tlr11 APN 14 50363032 missense probably damaging 0.99
IGL02286:Tlr11 APN 14 50360871 missense possibly damaging 0.91
IGL02671:Tlr11 APN 14 50360692 missense probably damaging 1.00
IGL03064:Tlr11 APN 14 50361100 missense probably damaging 1.00
IGL03068:Tlr11 APN 14 50361484 missense probably benign
R0099:Tlr11 UTSW 14 50360818 missense probably benign 0.14
R0727:Tlr11 UTSW 14 50361469 missense possibly damaging 0.67
R0944:Tlr11 UTSW 14 50362336 missense probably benign 0.12
R1490:Tlr11 UTSW 14 50363176 missense probably benign 0.00
R1726:Tlr11 UTSW 14 50361541 missense probably benign 0.00
R1803:Tlr11 UTSW 14 50360647 missense probably benign 0.00
R1908:Tlr11 UTSW 14 50361207 missense probably benign 0.00
R1971:Tlr11 UTSW 14 50361234 missense probably benign
R1981:Tlr11 UTSW 14 50361988 missense possibly damaging 0.95
R2079:Tlr11 UTSW 14 50360980 missense probably damaging 0.99
R2155:Tlr11 UTSW 14 50360682 missense probably benign 0.01
R2251:Tlr11 UTSW 14 50360792 missense probably benign 0.02
R3017:Tlr11 UTSW 14 50362721 nonsense probably null
R3760:Tlr11 UTSW 14 50362243 missense probably damaging 1.00
R3876:Tlr11 UTSW 14 50363154 missense probably benign
R3936:Tlr11 UTSW 14 50362735 missense possibly damaging 0.78
R4002:Tlr11 UTSW 14 50362527 missense probably benign
R4024:Tlr11 UTSW 14 50362846 missense probably benign 0.02
R4118:Tlr11 UTSW 14 50363227 missense probably damaging 1.00
R4222:Tlr11 UTSW 14 50361849 missense probably damaging 0.99
R4365:Tlr11 UTSW 14 50361469 missense probably damaging 0.98
R4678:Tlr11 UTSW 14 50360982 missense possibly damaging 0.85
R4779:Tlr11 UTSW 14 50361250 missense possibly damaging 0.76
R4910:Tlr11 UTSW 14 50362889 missense probably benign 0.45
R4921:Tlr11 UTSW 14 50362885 missense possibly damaging 0.48
R5114:Tlr11 UTSW 14 50363121 missense possibly damaging 0.81
R5126:Tlr11 UTSW 14 50360830 missense probably damaging 1.00
R5349:Tlr11 UTSW 14 50360880 missense probably benign 0.45
R5606:Tlr11 UTSW 14 50362260 missense probably benign 0.08
R5650:Tlr11 UTSW 14 50361201 missense probably benign 0.03
R5958:Tlr11 UTSW 14 50360777 missense probably damaging 0.99
R5966:Tlr11 UTSW 14 50362255 missense probably benign 0.02
R6480:Tlr11 UTSW 14 50363055 missense possibly damaging 0.62
R6484:Tlr11 UTSW 14 50362678 missense probably damaging 0.99
R6679:Tlr11 UTSW 14 50362854 missense probably benign 0.00
R6717:Tlr11 UTSW 14 50362104 missense probably benign
R7085:Tlr11 UTSW 14 50362656 missense probably damaging 0.99
R7241:Tlr11 UTSW 14 50362141 missense possibly damaging 0.95
R7440:Tlr11 UTSW 14 50361344 missense probably benign 0.00
R7482:Tlr11 UTSW 14 50362999 missense probably damaging 0.99
R7582:Tlr11 UTSW 14 50361729 nonsense probably null
R7790:Tlr11 UTSW 14 50361925 missense probably benign
R7818:Tlr11 UTSW 14 50361828 missense probably damaging 1.00
R7827:Tlr11 UTSW 14 50361154 missense probably benign 0.00
RF002:Tlr11 UTSW 14 50361225 missense possibly damaging 0.63
Z1088:Tlr11 UTSW 14 50362338 missense possibly damaging 0.48
Predicted Primers PCR Primer
(F):5'- TCAAGTACTATGAAGCTAGAGATGC -3'
(R):5'- GAAACTGGTGAGAAAGCCCC -3'

Sequencing Primer
(F):5'- CTAGAGATGCTATTGAAGGAGGTACC -3'
(R):5'- CCAAAACTCAGTACCGTGTGG -3'
Posted On2014-08-25