Mutagenetix > Incidental Mutation

Incidental Mutation 'R2024:Hjurp'

220215

Institutional Source

Beutler Lab

Gene Symbol

Hjurp

Ensembl Gene

ENSMUSG00000044783

Gene Name

Holliday junction recognition protein

Synonyms

MMRRC Submission

040033-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.908) question?

Stock #

R2024 (G1)

Quality Score

217

Status

Not validated

Chromosome

Chromosomal Location

88262471-88277633 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

GT to GTT at 88266524 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000118659 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000054674] [ENSMUST00000061013] [ENSMUST00000065420] [ENSMUST00000113130] [ENSMUST00000127446] [ENSMUST00000147393]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000054674

SMART Domains

Protein: ENSMUSP00000054263
Gene: ENSMUSG00000044783

Domain	Start	End	E-Value	Type
Pfam:Scm3	11	68	1.5e-10	PFAM
low complexity region	159	175	N/A	INTRINSIC
low complexity region	215	232	N/A	INTRINSIC
Pfam:HJURP_mid	254	370	7.6e-54	PFAM
Pfam:HJURP_C	385	446	3.1e-26	PFAM
low complexity region	496	515	N/A	INTRINSIC
Pfam:HJURP_C	527	585	7.1e-21	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000061013

SMART Domains

Protein: ENSMUSP00000130508
Gene: ENSMUSG00000079429

Domain	Start	End	E-Value	Type
low complexity region	9	26	N/A	INTRINSIC
low complexity region	99	112	N/A	INTRINSIC
low complexity region	1235	1248	N/A	INTRINSIC
SCOP:d1jdha_	1371	1669	9e-8	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000065420

SMART Domains

Protein: ENSMUSP00000070419
Gene: ENSMUSG00000044783

Domain	Start	End	E-Value	Type
Pfam:Scm3	9	70	2.9e-11	PFAM
low complexity region	83	99	N/A	INTRINSIC
low complexity region	139	156	N/A	INTRINSIC
Pfam:HJURP_mid	178	295	7.4e-64	PFAM
Pfam:HJURP_C	309	371	1.2e-26	PFAM
low complexity region	420	439	N/A	INTRINSIC
Pfam:HJURP_C	451	510	3e-26	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000113130

SMART Domains

Protein: ENSMUSP00000108755
Gene: ENSMUSG00000079429

Domain	Start	End	E-Value	Type
low complexity region	9	26	N/A	INTRINSIC
low complexity region	99	112	N/A	INTRINSIC
low complexity region	1232	1245	N/A	INTRINSIC
SCOP:d1gw5a_	1446	1671	6e-6	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000127446

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000128532

Predicted Effect

probably benign
Transcript: ENSMUST00000147393

SMART Domains

Protein: ENSMUSP00000120753
Gene: ENSMUSG00000044783

Domain	Start	End	E-Value	Type
Pfam:Scm3	9	70	7.2e-13	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000148384

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.1%
20x: 90.8%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Arid2	A	G	15: 96,361,799	D280G	probably damaging	Het
Azi2	C	T	9: 118,049,322	R77*	probably null	Het
Chd8	T	C	14: 52,231,493	D556G	probably benign	Het
Cit	T	C	5: 115,947,924	M849T	probably damaging	Het
Cit	T	C	5: 116,005,840	S1923P	probably damaging	Het
Col17a1	T	A	19: 47,650,746	H1120L	probably benign	Het
Col6a5	G	T	9: 105,936,994	H606Q	unknown	Het
Dnajc2	A	C	5: 21,776,790	H45Q	probably damaging	Het
Dpp6	A	G	5: 27,709,459	D514G	possibly damaging	Het
Dync2h1	A	G	9: 7,129,062	S1818P	probably damaging	Het
Efemp1	A	T	11: 28,914,696	Y250F	possibly damaging	Het
Emc1	G	A	4: 139,360,946	E342K	possibly damaging	Het
Fam214a	A	G	9: 75,010,390	D757G	probably damaging	Het
Fam3c	T	C	6: 22,329,593	D45G	probably benign	Het
Fchsd2	A	C	7: 101,198,533	D210A	possibly damaging	Het
Flg	T	A	3: 93,279,415	M58K	probably damaging	Het
Gabra5	G	A	7: 57,488,950	R117C	probably damaging	Het
Gm6741	G	A	17: 91,236,881	S24N	probably benign	Het
Grin2a	T	C	16: 9,644,243	D675G	possibly damaging	Het
Hectd4	T	G	5: 121,281,918	V642G	possibly damaging	Het
Herc6	C	T	6: 57,583,332	T119M	probably benign	Het
Hmgcs2	T	C	3: 98,299,214	S371P	probably damaging	Het
Idua	C	T	5: 108,680,734	A271V	probably damaging	Het
Inpp5d	T	A	1: 87,695,350	C125*	probably null	Het
Krt14	C	T	11: 100,207,218	G80R	unknown	Het
Lama5	T	C	2: 180,179,130	Y3176C	probably benign	Het
Lce1k	C	T	3: 92,806,502	C125Y	unknown	Het
Lig4	A	T	8: 9,972,436	L448Q	probably damaging	Het
Macf1	C	T	4: 123,371,918	A4821T	probably damaging	Het
Meioc	C	T	11: 102,675,358	A600V	probably benign	Het
Mepe	T	C	5: 104,327,091	S13P	possibly damaging	Het
Mms22l	A	G	4: 24,588,365	Y999C	probably damaging	Het
Ncbp3	T	A	11: 73,053,520	M116K	possibly damaging	Het
Ndufa10	A	G	1: 92,439,892	Y339H	probably damaging	Het
Nkx3-1	T	C	14: 69,190,817	I38T	probably damaging	Het
Nup155	A	T	15: 8,157,760	H1391L	probably damaging	Het
Olfr1299	T	A	2: 111,664,823	M199K	possibly damaging	Het
Padi6	T	G	4: 140,728,968	I572L	possibly damaging	Het
Pdss2	A	T	10: 43,393,875	N238I	possibly damaging	Het
Pkd1l2	A	G	8: 117,019,533	V1906A	probably benign	Het
Pom121	T	C	5: 135,381,550		probably benign	Het
Psmd9	T	C	5: 123,241,862	F115L	probably damaging	Het
Ptch1	T	G	13: 63,524,959	E944A	probably benign	Het
Rai1	T	C	11: 60,185,589	F160L	probably damaging	Het
Rhbdl2	A	T	4: 123,826,872	R234S	probably damaging	Het
Rnase2a	T	A	14: 51,255,788	Y40F	probably damaging	Het
Setd2	T	C	9: 110,549,133	V672A	possibly damaging	Het
Sgpp2	A	G	1: 78,417,220	I287V	probably benign	Het
Sh3pxd2a	T	C	19: 47,267,264	E1033G	probably benign	Het
Slc5a9	G	A	4: 111,890,531	T284I	probably damaging	Het
Slfn9	A	G	11: 82,981,681	L743P	probably damaging	Het
Smchd1	T	A	17: 71,370,928	N1473I	probably benign	Het
Stx1b	A	T	7: 127,815,403	D16E	probably benign	Het
Tectb	T	C	19: 55,181,929	F71L	probably damaging	Het
Tmem220	T	C	11: 67,034,153	I138T	possibly damaging	Het
Tmtc4	T	C	14: 122,921,265	N682S	probably benign	Het
Tnc	A	G	4: 63,964,621	V1921A	probably damaging	Het
Ubn1	T	G	16: 5,064,623	L316W	probably damaging	Het
Vwa5a	T	C	9: 38,736,061	S579P	probably damaging	Het
Xdh	A	G	17: 73,921,305	L367P	possibly damaging	Het
Zfp280b	T	C	10: 76,038,494	L69S	probably damaging	Het
Zfp990	A	C	4: 145,537,404	Y324S	possibly damaging	Het

Other mutations in Hjurp

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00990:Hjurp	APN	1	88270269	missense	probably benign	0.04
IGL03099:Hjurp	APN	1	88266289	missense	probably benign	0.09
BB003:Hjurp	UTSW	1	88266278	utr 3 prime	probably benign
IGL03097:Hjurp	UTSW	1	88266280	utr 3 prime	probably benign
IGL03098:Hjurp	UTSW	1	88266280	utr 3 prime	probably benign
IGL03147:Hjurp	UTSW	1	88266280	utr 3 prime	probably benign
PIT4131001:Hjurp	UTSW	1	88266278	utr 3 prime	probably benign
PIT4142001:Hjurp	UTSW	1	88266046	missense	probably damaging	0.98
PIT4142001:Hjurp	UTSW	1	88266278	utr 3 prime	probably benign
PIT4142001:Hjurp	UTSW	1	88266561	utr 3 prime	probably benign
PIT4142001:Hjurp	UTSW	1	88266616	missense	probably benign	0.04
PIT4378001:Hjurp	UTSW	1	88266277	utr 3 prime	probably benign
PIT4812001:Hjurp	UTSW	1	88266277	utr 3 prime	probably benign
R0053:Hjurp	UTSW	1	88277215	splice site	probably benign
R0371:Hjurp	UTSW	1	88277368	splice site	probably benign
R0442:Hjurp	UTSW	1	88266524	nonsense	probably null
R0762:Hjurp	UTSW	1	88277215	splice site	probably benign
R0928:Hjurp	UTSW	1	88266524	nonsense	probably null
R1333:Hjurp	UTSW	1	88266046	missense	probably damaging	0.98
R1342:Hjurp	UTSW	1	88277368	splice site	probably benign
R1364:Hjurp	UTSW	1	88266525	frame shift	probably null
R1496:Hjurp	UTSW	1	88275050	missense	possibly damaging	0.59
R1637:Hjurp	UTSW	1	88266121	missense	probably benign	0.03
R1905:Hjurp	UTSW	1	88266616	missense	probably benign	0.04
R1965:Hjurp	UTSW	1	88266524	nonsense	probably null
R1992:Hjurp	UTSW	1	88266524	nonsense	probably null
R2002:Hjurp	UTSW	1	88266524	nonsense	probably null
R2023:Hjurp	UTSW	1	88266524	nonsense	probably null
R2332:Hjurp	UTSW	1	88277215	splice site	probably benign
R2420:Hjurp	UTSW	1	88266524	nonsense	probably null
R2422:Hjurp	UTSW	1	88266561	utr 3 prime	probably benign
R2869:Hjurp	UTSW	1	88266524	nonsense	probably null
R2870:Hjurp	UTSW	1	88266524	nonsense	probably null
R2871:Hjurp	UTSW	1	88266524	nonsense	probably null
R2872:Hjurp	UTSW	1	88266524	nonsense	probably null
R3019:Hjurp	UTSW	1	88266524	nonsense	probably null
R3021:Hjurp	UTSW	1	88266524	nonsense	probably null
R3150:Hjurp	UTSW	1	88266561	utr 3 prime	probably benign
R3411:Hjurp	UTSW	1	88266524	nonsense	probably null
R3552:Hjurp	UTSW	1	88266524	nonsense	probably null
R3704:Hjurp	UTSW	1	88277215	splice site	probably benign
R3730:Hjurp	UTSW	1	88266524	nonsense	probably null
R3733:Hjurp	UTSW	1	88266524	nonsense	probably null
R3764:Hjurp	UTSW	1	88266524	nonsense	probably null
R3799:Hjurp	UTSW	1	88277215	splice site	probably benign
R3819:Hjurp	UTSW	1	88277215	splice site	probably benign
R3857:Hjurp	UTSW	1	88266524	nonsense	probably null
R3930:Hjurp	UTSW	1	88266524	nonsense	probably null
R3952:Hjurp	UTSW	1	88277215	splice site	probably benign
R4090:Hjurp	UTSW	1	88277215	splice site	probably benign
R4159:Hjurp	UTSW	1	88277215	splice site	probably benign
R4207:Hjurp	UTSW	1	88277215	splice site	probably benign
R4322:Hjurp	UTSW	1	88277215	splice site	probably benign
R4391:Hjurp	UTSW	1	88266561	utr 3 prime	probably benign
R4392:Hjurp	UTSW	1	88266524	nonsense	probably null
R4393:Hjurp	UTSW	1	88266524	nonsense	probably null
R4393:Hjurp	UTSW	1	88266561	utr 3 prime	probably benign
R4397:Hjurp	UTSW	1	88266524	nonsense	probably null
R4700:Hjurp	UTSW	1	88266524	nonsense	probably null
R4808:Hjurp	UTSW	1	88277215	splice site	probably benign
R4900:Hjurp	UTSW	1	88266524	nonsense	probably null
R4901:Hjurp	UTSW	1	88266524	nonsense	probably null
R5023:Hjurp	UTSW	1	88275050	missense	possibly damaging	0.59
R5024:Hjurp	UTSW	1	88275050	missense	possibly damaging	0.59
R5076:Hjurp	UTSW	1	88266524	nonsense	probably null
R5123:Hjurp	UTSW	1	88275050	missense	possibly damaging	0.59
R5236:Hjurp	UTSW	1	88266524	nonsense	probably null
R5300:Hjurp	UTSW	1	88266524	nonsense	probably null
R5318:Hjurp	UTSW	1	88266524	nonsense	probably null
R5370:Hjurp	UTSW	1	88266524	nonsense	probably null
R5410:Hjurp	UTSW	1	88266524	nonsense	probably null
R5445:Hjurp	UTSW	1	88266316	missense	probably benign	0.43
R5457:Hjurp	UTSW	1	88266525	frame shift	probably null
R5497:Hjurp	UTSW	1	88266320	missense	possibly damaging	0.92
R5560:Hjurp	UTSW	1	88266524	nonsense	probably null
R5561:Hjurp	UTSW	1	88266524	nonsense	probably null
R5615:Hjurp	UTSW	1	88266524	nonsense	probably null
R5661:Hjurp	UTSW	1	88277215	splice site	probably benign
R5722:Hjurp	UTSW	1	88266524	nonsense	probably null
R6087:Hjurp	UTSW	1	88266524	nonsense	probably null
R6089:Hjurp	UTSW	1	88266524	nonsense	probably null
R6090:Hjurp	UTSW	1	88266524	nonsense	probably null
R6125:Hjurp	UTSW	1	88266524	nonsense	probably null
R6175:Hjurp	UTSW	1	88266524	nonsense	probably null
R6362:Hjurp	UTSW	1	88275050	missense	possibly damaging	0.59
R6659:Hjurp	UTSW	1	88266524	nonsense	probably null
R7016:Hjurp	UTSW	1	88266277	utr 3 prime	probably benign
R7016:Hjurp	UTSW	1	88266278	utr 3 prime	probably benign
R7045:Hjurp	UTSW	1	88266278	utr 3 prime	probably benign
R7179:Hjurp	UTSW	1	88266278	utr 3 prime	probably benign
R7200:Hjurp	UTSW	1	88266278	utr 3 prime	probably benign
R7463:Hjurp	UTSW	1	88266277	utr 3 prime	probably benign
R7912:Hjurp	UTSW	1	88266278	utr 3 prime	probably benign
R8215:Hjurp	UTSW	1	88266524	nonsense	probably null
R8968:Hjurp	UTSW	1	88266277	utr 3 prime	probably benign
R9038:Hjurp	UTSW	1	88266524	nonsense	probably null
R9115:Hjurp	UTSW	1	88266277	utr 3 prime	probably benign
R9133:Hjurp	UTSW	1	88275050	missense	possibly damaging	0.59
R9146:Hjurp	UTSW	1	88266278	utr 3 prime	probably benign
R9221:Hjurp	UTSW	1	88266277	utr 3 prime	probably benign
R9475:Hjurp	UTSW	1	88266277	utr 3 prime	probably benign
R9482:Hjurp	UTSW	1	88266274	utr 3 prime	probably benign
R9565:Hjurp	UTSW	1	88266278	utr 3 prime	probably benign
R9599:Hjurp	UTSW	1	88266278	utr 3 prime	probably benign
V5622:Hjurp	UTSW	1	88277525	unclassified	probably benign

Predicted Primers

PCR Primer
(F):5'- CCAGCTCTGGTTGATGTAGG -3'
(R):5'- ACTGTCATGGTTTGTGATGCCC -3'

Sequencing Primer
(F):5'- AGGTCTTGGTGGAGATGATGCAG -3'
(R):5'- CCTGCCCGGTGGGTAAGTATG -3'

Posted On

2014-08-25