Incidental Mutation 'R1983:Pck2'
ID220216
Institutional Source Beutler Lab
Gene Symbol Pck2
Ensembl Gene ENSMUSG00000040618
Gene Namephosphoenolpyruvate carboxykinase 2 (mitochondrial)
Synonyms1810010O14Rik, 9130022B02Rik
MMRRC Submission 039995-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.215) question?
Stock #R1983 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location55540266-55551242 bp(+) (GRCm38)
Type of Mutationsplice site (5 bp from exon)
DNA Base Change (assembly) G to A at 55544068 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000154736 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048781] [ENSMUST00000226352] [ENSMUST00000226519] [ENSMUST00000228240]
Predicted Effect probably null
Transcript: ENSMUST00000048781
SMART Domains Protein: ENSMUSP00000038555
Gene: ENSMUSG00000040618

DomainStartEndE-ValueType
low complexity region 2 22 N/A INTRINSIC
Pfam:PEPCK 73 664 1.9e-276 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000226231
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226270
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226295
Predicted Effect probably null
Transcript: ENSMUST00000226352
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226514
Predicted Effect probably null
Transcript: ENSMUST00000226519
Predicted Effect probably null
Transcript: ENSMUST00000226650
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226664
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226714
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226770
Predicted Effect probably null
Transcript: ENSMUST00000228240
Predicted Effect probably benign
Transcript: ENSMUST00000228921
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228843
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228283
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mitochondrial enzyme that catalyzes the conversion of oxaloacetate to phosphoenolpyruvate in the presence of guanosine triphosphate (GTP). A cytosolic form of this protein is encoded by a different gene and is the key enzyme of gluconeogenesis in the liver. Alternatively spliced transcript variants have been described. [provided by RefSeq, Apr 2014]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600012H06Rik T A 17: 14,944,010 V133E probably damaging Het
4932438A13Rik A G 3: 36,887,865 D273G probably null Het
Aco1 G A 4: 40,175,845 G160S probably benign Het
Actn2 C T 13: 12,278,810 R608H probably benign Het
Adora2a A C 10: 75,333,646 S315R probably benign Het
Arhgap42 T C 9: 9,017,017 Y382C probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Atg4c A G 4: 99,228,575 Y318C probably damaging Het
Baz2a C T 10: 128,123,959 T1408I probably benign Het
Bbx T A 16: 50,209,117 Q663L possibly damaging Het
Btbd3 T G 2: 138,283,688 L264R probably damaging Het
Cfi T C 3: 129,868,545 I391T probably damaging Het
Chadl T C 15: 81,693,896 I45V probably benign Het
Chd5 C A 4: 152,384,666 A1853D possibly damaging Het
Cmas G T 6: 142,770,586 D251Y probably damaging Het
Cyp2d10 A G 15: 82,405,999 M90T probably benign Het
D630003M21Rik A G 2: 158,208,421 F714L probably benign Het
Dguok A T 6: 83,487,128 Y126* probably null Het
Dnaic1 A G 4: 41,603,232 K172E probably benign Het
Dnaic2 T A 11: 114,735,856 probably null Het
Efcab6 A T 15: 83,892,962 probably benign Het
Eln A T 5: 134,736,340 probably null Het
Epor T C 9: 21,959,400 T395A probably benign Het
Evc2 G T 5: 37,415,931 E996* probably null Het
Fam124b T A 1: 80,213,647 E6D probably benign Het
Fam208b G T 13: 3,574,853 T1699K possibly damaging Het
Filip1 T A 9: 79,860,092 K146N probably damaging Het
Filip1l T C 16: 57,571,274 S742P probably damaging Het
Fsip2 G T 2: 82,979,831 V2165L probably benign Het
Gcdh A T 8: 84,890,910 V227E possibly damaging Het
Gm10696 T G 3: 94,176,294 D70A possibly damaging Het
Gm12185 T C 11: 48,915,356 N336S probably benign Het
Gm12695 G T 4: 96,738,977 A399E possibly damaging Het
Gm16503 T A 4: 147,541,292 V81E unknown Het
Gpr137c T C 14: 45,279,971 V388A probably benign Het
Hgf A G 5: 16,561,012 T49A possibly damaging Het
Hspa1a G T 17: 34,970,962 R322S probably benign Het
Jak3 A T 8: 71,678,375 Q13L possibly damaging Het
Jak3 A G 8: 71,688,136 R1098G probably benign Het
Kif11 C T 19: 37,390,776 T305I possibly damaging Het
Lcor T A 19: 41,558,367 V130E probably damaging Het
Lmo2 T C 2: 103,981,062 Y147H probably damaging Het
Lrp1b C T 2: 41,511,404 probably null Het
Mdga1 G A 17: 29,850,605 R430C probably damaging Het
Mfsd12 T A 10: 81,362,256 probably null Het
Mmp27 T A 9: 7,578,897 probably null Het
Mtnr1a A T 8: 45,087,434 N144I probably benign Het
Mycbp2 T C 14: 103,145,971 T3563A probably damaging Het
Myef2 T A 2: 125,098,845 M355L probably benign Het
Olfr1065 T A 2: 86,445,076 H302L probably benign Het
Olfr1238 A G 2: 89,406,426 F218L probably benign Het
Olfr1457 A G 19: 13,095,384 I88T probably benign Het
Olfr470 C T 7: 107,845,412 G107D probably benign Het
Parg A G 14: 32,217,696 K560E probably damaging Het
Pdcd6 T C 13: 74,304,000 I174V probably benign Het
Pomgnt1 T C 4: 116,151,869 L57S probably damaging Het
Pomgnt1 C A 4: 116,151,920 P74Q probably benign Het
Prdm4 T C 10: 85,907,953 Y146C probably damaging Het
Prl2c2 G C 13: 13,002,201 T47R probably damaging Het
Prune2 A G 19: 17,020,642 M248V probably damaging Het
Ric8b T A 10: 85,001,838 M503K probably damaging Het
Ror2 C T 13: 53,110,408 V871M probably benign Het
Ryr1 T C 7: 29,059,472 N3427S possibly damaging Het
Ryr2 A G 13: 11,585,402 probably null Het
Scimp C T 11: 70,800,714 V30I probably damaging Het
Skint4 A G 4: 112,146,492 E374G probably benign Het
Slc6a20a A G 9: 123,640,587 Y482H probably damaging Het
Slitrk5 A G 14: 111,680,389 S482G probably benign Het
Strc T A 2: 121,371,037 M1229L possibly damaging Het
Terf2 T C 8: 107,083,008 Y226C probably damaging Het
Tex10 A T 4: 48,460,059 L431I possibly damaging Het
Tnc A G 4: 63,984,630 V1470A possibly damaging Het
Ttll13 T C 7: 80,253,616 I248T possibly damaging Het
Ttn T C 2: 76,789,025 N16031S possibly damaging Het
Ttn T A 2: 76,756,760 K21631M probably damaging Het
Uroc1 A T 6: 90,345,369 S292C probably damaging Het
Vmn1r80 A T 7: 12,193,661 M233L probably benign Het
Wdr31 A T 4: 62,460,603 M129K probably damaging Het
Wnk1 A T 6: 119,937,578 N1754K probably damaging Het
Xirp1 G A 9: 120,016,629 Q1063* probably null Het
Zfp799 C A 17: 32,822,110 V32L probably damaging Het
Zfyve9 A T 4: 108,689,189 D874E possibly damaging Het
Other mutations in Pck2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Pck2 APN 14 55542641 missense probably benign 0.30
IGL00430:Pck2 APN 14 55543944 missense probably benign 0.07
IGL00814:Pck2 APN 14 55548299 unclassified probably benign
IGL01012:Pck2 APN 14 55544069 splice site probably benign
IGL02095:Pck2 APN 14 55542510 missense probably benign 0.02
IGL02227:Pck2 APN 14 55543866 missense probably benign
IGL02435:Pck2 APN 14 55544390 splice site probably benign
IGL03124:Pck2 APN 14 55545333 missense probably damaging 1.00
R0271:Pck2 UTSW 14 55544584 critical splice donor site probably null
R1014:Pck2 UTSW 14 55542410 missense probably benign 0.00
R1116:Pck2 UTSW 14 55545366 missense probably benign 0.00
R1640:Pck2 UTSW 14 55548584 missense possibly damaging 0.51
R1793:Pck2 UTSW 14 55543965 missense possibly damaging 0.81
R1965:Pck2 UTSW 14 55542507 missense probably benign 0.07
R3196:Pck2 UTSW 14 55543992 missense probably damaging 1.00
R4751:Pck2 UTSW 14 55542561 missense probably damaging 1.00
R5385:Pck2 UTSW 14 55545231 missense probably damaging 1.00
R5960:Pck2 UTSW 14 55548547 missense possibly damaging 0.48
R6134:Pck2 UTSW 14 55543962 missense probably damaging 1.00
R6276:Pck2 UTSW 14 55542624 missense probably damaging 1.00
R7030:Pck2 UTSW 14 55547766 missense probably damaging 1.00
R7199:Pck2 UTSW 14 55548712 missense probably benign 0.43
R7516:Pck2 UTSW 14 55542456 missense probably benign 0.00
R8066:Pck2 UTSW 14 55544401 missense probably benign 0.30
X0065:Pck2 UTSW 14 55548063 missense probably benign 0.01
Z1176:Pck2 UTSW 14 55545269 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCAACATCTTCCTCCACAGG -3'
(R):5'- GTGCTTTGTCAGACCTGTCGAC -3'

Sequencing Primer
(F):5'- CACAGGCCGCATTATGTATG -3'
(R):5'- AGACCTGTCGACTGACTTCTG -3'
Posted On2014-08-25