Incidental Mutation 'R2024:Hmgcs2'
ID220231
Institutional Source Beutler Lab
Gene Symbol Hmgcs2
Ensembl Gene ENSMUSG00000027875
Gene Name3-hydroxy-3-methylglutaryl-Coenzyme A synthase 2
SynonymsmHS
MMRRC Submission 040033-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.117) question?
Stock #R2024 (G1)
Quality Score184
Status Not validated
Chromosome3
Chromosomal Location98280435-98310738 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 98299214 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 371 (S371P)
Ref Sequence ENSEMBL: ENSMUSP00000113296 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090746] [ENSMUST00000120541]
Predicted Effect probably damaging
Transcript: ENSMUST00000090746
AA Change: S371P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000088249
Gene: ENSMUSG00000027875
AA Change: S371P

DomainStartEndE-ValueType
Pfam:HMG_CoA_synt_N 50 223 2.9e-111 PFAM
Pfam:HMG_CoA_synt_C 224 506 6.6e-131 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000120541
AA Change: S371P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113296
Gene: ENSMUSG00000027875
AA Change: S371P

DomainStartEndE-ValueType
Pfam:HMG_CoA_synt_N 50 223 7.2e-108 PFAM
Pfam:HMG_CoA_synt_C 224 506 1.8e-131 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 90.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the HMG-CoA synthase family. It is a mitochondrial enzyme that catalyzes the first reaction of ketogenesis, a metabolic pathway that provides lipid-derived energy for various organs during times of carbohydrate deprivation, such as fasting. Mutations in this gene are associated with HMG-CoA synthase deficiency. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Oct 2009]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arid2 A G 15: 96,361,799 D280G probably damaging Het
Azi2 C T 9: 118,049,322 R77* probably null Het
Chd8 T C 14: 52,231,493 D556G probably benign Het
Cit T C 5: 115,947,924 M849T probably damaging Het
Cit T C 5: 116,005,840 S1923P probably damaging Het
Col17a1 T A 19: 47,650,746 H1120L probably benign Het
Col6a5 G T 9: 105,936,994 H606Q unknown Het
Dnajc2 A C 5: 21,776,790 H45Q probably damaging Het
Dpp6 A G 5: 27,709,459 D514G possibly damaging Het
Dync2h1 A G 9: 7,129,062 S1818P probably damaging Het
Efemp1 A T 11: 28,914,696 Y250F possibly damaging Het
Emc1 G A 4: 139,360,946 E342K possibly damaging Het
Fam214a A G 9: 75,010,390 D757G probably damaging Het
Fam3c T C 6: 22,329,593 D45G probably benign Het
Fchsd2 A C 7: 101,198,533 D210A possibly damaging Het
Flg T A 3: 93,279,415 M58K probably damaging Het
Gabra5 G A 7: 57,488,950 R117C probably damaging Het
Gm6741 G A 17: 91,236,881 S24N probably benign Het
Grin2a T C 16: 9,644,243 D675G possibly damaging Het
Hectd4 T G 5: 121,281,918 V642G possibly damaging Het
Herc6 C T 6: 57,583,332 T119M probably benign Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Idua C T 5: 108,680,734 A271V probably damaging Het
Inpp5d T A 1: 87,695,350 C125* probably null Het
Krt14 C T 11: 100,207,218 G80R unknown Het
Lama5 T C 2: 180,179,130 Y3176C probably benign Het
Lce1k C T 3: 92,806,502 C125Y unknown Het
Lig4 A T 8: 9,972,436 L448Q probably damaging Het
Macf1 C T 4: 123,371,918 A4821T probably damaging Het
Meioc C T 11: 102,675,358 A600V probably benign Het
Mepe T C 5: 104,327,091 S13P possibly damaging Het
Mms22l A G 4: 24,588,365 Y999C probably damaging Het
Ncbp3 T A 11: 73,053,520 M116K possibly damaging Het
Ndufa10 A G 1: 92,439,892 Y339H probably damaging Het
Nkx3-1 T C 14: 69,190,817 I38T probably damaging Het
Nup155 A T 15: 8,157,760 H1391L probably damaging Het
Olfr1299 T A 2: 111,664,823 M199K possibly damaging Het
Padi6 T G 4: 140,728,968 I572L possibly damaging Het
Pdss2 A T 10: 43,393,875 N238I possibly damaging Het
Pkd1l2 A G 8: 117,019,533 V1906A probably benign Het
Pom121 T C 5: 135,381,550 probably benign Het
Psmd9 T C 5: 123,241,862 F115L probably damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rai1 T C 11: 60,185,589 F160L probably damaging Het
Rhbdl2 A T 4: 123,826,872 R234S probably damaging Het
Rnase2a T A 14: 51,255,788 Y40F probably damaging Het
Setd2 T C 9: 110,549,133 V672A possibly damaging Het
Sgpp2 A G 1: 78,417,220 I287V probably benign Het
Sh3pxd2a T C 19: 47,267,264 E1033G probably benign Het
Slc5a9 G A 4: 111,890,531 T284I probably damaging Het
Slfn9 A G 11: 82,981,681 L743P probably damaging Het
Smchd1 T A 17: 71,370,928 N1473I probably benign Het
Stx1b A T 7: 127,815,403 D16E probably benign Het
Tectb T C 19: 55,181,929 F71L probably damaging Het
Tmem220 T C 11: 67,034,153 I138T possibly damaging Het
Tmtc4 T C 14: 122,921,265 N682S probably benign Het
Tnc A G 4: 63,964,621 V1921A probably damaging Het
Ubn1 T G 16: 5,064,623 L316W probably damaging Het
Vwa5a T C 9: 38,736,061 S579P probably damaging Het
Xdh A G 17: 73,921,305 L367P possibly damaging Het
Zfp280b T C 10: 76,038,494 L69S probably damaging Het
Zfp990 A C 4: 145,537,404 Y324S possibly damaging Het
Other mutations in Hmgcs2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0579:Hmgcs2 UTSW 3 98290948 missense probably damaging 1.00
R0657:Hmgcs2 UTSW 3 98291053 missense probably benign
R0724:Hmgcs2 UTSW 3 98297001 nonsense probably null
R2109:Hmgcs2 UTSW 3 98297021 nonsense probably null
R2202:Hmgcs2 UTSW 3 98291183 missense probably damaging 1.00
R2203:Hmgcs2 UTSW 3 98291183 missense probably damaging 1.00
R2204:Hmgcs2 UTSW 3 98291183 missense probably damaging 1.00
R2205:Hmgcs2 UTSW 3 98291183 missense probably damaging 1.00
R3758:Hmgcs2 UTSW 3 98291090 missense probably damaging 1.00
R3779:Hmgcs2 UTSW 3 98299112 splice site probably benign
R3958:Hmgcs2 UTSW 3 98297477 missense possibly damaging 0.48
R3959:Hmgcs2 UTSW 3 98297477 missense possibly damaging 0.48
R3960:Hmgcs2 UTSW 3 98297477 missense possibly damaging 0.48
R3962:Hmgcs2 UTSW 3 98291038 missense possibly damaging 0.91
R4788:Hmgcs2 UTSW 3 98291084 missense probably damaging 1.00
R5102:Hmgcs2 UTSW 3 98280470 start gained probably benign
R5708:Hmgcs2 UTSW 3 98291162 missense probably damaging 1.00
R5742:Hmgcs2 UTSW 3 98297516 missense probably benign
R7268:Hmgcs2 UTSW 3 98297480 missense probably benign 0.02
R7294:Hmgcs2 UTSW 3 98290895 missense probably benign 0.09
R7503:Hmgcs2 UTSW 3 98302624 missense probably damaging 1.00
R7767:Hmgcs2 UTSW 3 98291266 missense probably damaging 1.00
R8043:Hmgcs2 UTSW 3 98291128 missense probably damaging 1.00
Z1176:Hmgcs2 UTSW 3 98290945 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTCTTCAAACGTCTGAGCAC -3'
(R):5'- CAAACTTAGTTGGCCTGTCAG -3'

Sequencing Primer
(F):5'- CCCCAGAATTTTATTTACAGAAGCG -3'
(R):5'- CCTGTCAGCCCAAGGATG -3'
Posted On2014-08-25