Incidental Mutation 'R2024:Slc5a9'
ID220240
Institutional Source Beutler Lab
Gene Symbol Slc5a9
Ensembl Gene ENSMUSG00000028544
Gene Namesolute carrier family 5 (sodium/glucose cotransporter), member 9
SynonymsSGLT4
MMRRC Submission 040033-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R2024 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location111875375-111902918 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 111890531 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 284 (T284I)
Ref Sequence ENSEMBL: ENSMUSP00000099782 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102719] [ENSMUST00000102720] [ENSMUST00000102721] [ENSMUST00000128340]
Predicted Effect probably damaging
Transcript: ENSMUST00000102719
AA Change: T284I

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000099780
Gene: ENSMUSG00000028544
AA Change: T284I

DomainStartEndE-ValueType
low complexity region 34 44 N/A INTRINSIC
Pfam:SSF 63 492 2.3e-152 PFAM
transmembrane domain 526 548 N/A INTRINSIC
transmembrane domain 665 684 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000102720
AA Change: T284I

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000099781
Gene: ENSMUSG00000028544
AA Change: T284I

DomainStartEndE-ValueType
low complexity region 34 44 N/A INTRINSIC
Pfam:SSF 63 492 2.3e-152 PFAM
transmembrane domain 526 548 N/A INTRINSIC
transmembrane domain 665 684 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000102721
AA Change: T284I

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000099782
Gene: ENSMUSG00000028544
AA Change: T284I

DomainStartEndE-ValueType
low complexity region 34 44 N/A INTRINSIC
Pfam:SSF 63 492 2.3e-152 PFAM
transmembrane domain 526 548 N/A INTRINSIC
transmembrane domain 665 684 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000128340
AA Change: T199I

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000120546
Gene: ENSMUSG00000028544
AA Change: T199I

DomainStartEndE-ValueType
Pfam:SSF 23 255 9.3e-70 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131772
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149922
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 90.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arid2 A G 15: 96,361,799 D280G probably damaging Het
Azi2 C T 9: 118,049,322 R77* probably null Het
Chd8 T C 14: 52,231,493 D556G probably benign Het
Cit T C 5: 115,947,924 M849T probably damaging Het
Cit T C 5: 116,005,840 S1923P probably damaging Het
Col17a1 T A 19: 47,650,746 H1120L probably benign Het
Col6a5 G T 9: 105,936,994 H606Q unknown Het
Dnajc2 A C 5: 21,776,790 H45Q probably damaging Het
Dpp6 A G 5: 27,709,459 D514G possibly damaging Het
Dync2h1 A G 9: 7,129,062 S1818P probably damaging Het
Efemp1 A T 11: 28,914,696 Y250F possibly damaging Het
Emc1 G A 4: 139,360,946 E342K possibly damaging Het
Fam214a A G 9: 75,010,390 D757G probably damaging Het
Fam3c T C 6: 22,329,593 D45G probably benign Het
Fchsd2 A C 7: 101,198,533 D210A possibly damaging Het
Flg T A 3: 93,279,415 M58K probably damaging Het
Gabra5 G A 7: 57,488,950 R117C probably damaging Het
Gm6741 G A 17: 91,236,881 S24N probably benign Het
Grin2a T C 16: 9,644,243 D675G possibly damaging Het
Hectd4 T G 5: 121,281,918 V642G possibly damaging Het
Herc6 C T 6: 57,583,332 T119M probably benign Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Hmgcs2 T C 3: 98,299,214 S371P probably damaging Het
Idua C T 5: 108,680,734 A271V probably damaging Het
Inpp5d T A 1: 87,695,350 C125* probably null Het
Krt14 C T 11: 100,207,218 G80R unknown Het
Lama5 T C 2: 180,179,130 Y3176C probably benign Het
Lce1k C T 3: 92,806,502 C125Y unknown Het
Lig4 A T 8: 9,972,436 L448Q probably damaging Het
Macf1 C T 4: 123,371,918 A4821T probably damaging Het
Meioc C T 11: 102,675,358 A600V probably benign Het
Mepe T C 5: 104,327,091 S13P possibly damaging Het
Mms22l A G 4: 24,588,365 Y999C probably damaging Het
Ncbp3 T A 11: 73,053,520 M116K possibly damaging Het
Ndufa10 A G 1: 92,439,892 Y339H probably damaging Het
Nkx3-1 T C 14: 69,190,817 I38T probably damaging Het
Nup155 A T 15: 8,157,760 H1391L probably damaging Het
Olfr1299 T A 2: 111,664,823 M199K possibly damaging Het
Padi6 T G 4: 140,728,968 I572L possibly damaging Het
Pdss2 A T 10: 43,393,875 N238I possibly damaging Het
Pkd1l2 A G 8: 117,019,533 V1906A probably benign Het
Pom121 T C 5: 135,381,550 probably benign Het
Psmd9 T C 5: 123,241,862 F115L probably damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rai1 T C 11: 60,185,589 F160L probably damaging Het
Rhbdl2 A T 4: 123,826,872 R234S probably damaging Het
Rnase2a T A 14: 51,255,788 Y40F probably damaging Het
Setd2 T C 9: 110,549,133 V672A possibly damaging Het
Sgpp2 A G 1: 78,417,220 I287V probably benign Het
Sh3pxd2a T C 19: 47,267,264 E1033G probably benign Het
Slfn9 A G 11: 82,981,681 L743P probably damaging Het
Smchd1 T A 17: 71,370,928 N1473I probably benign Het
Stx1b A T 7: 127,815,403 D16E probably benign Het
Tectb T C 19: 55,181,929 F71L probably damaging Het
Tmem220 T C 11: 67,034,153 I138T possibly damaging Het
Tmtc4 T C 14: 122,921,265 N682S probably benign Het
Tnc A G 4: 63,964,621 V1921A probably damaging Het
Ubn1 T G 16: 5,064,623 L316W probably damaging Het
Vwa5a T C 9: 38,736,061 S579P probably damaging Het
Xdh A G 17: 73,921,305 L367P possibly damaging Het
Zfp280b T C 10: 76,038,494 L69S probably damaging Het
Zfp990 A C 4: 145,537,404 Y324S possibly damaging Het
Other mutations in Slc5a9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00326:Slc5a9 APN 4 111898569 missense probably damaging 0.99
IGL00837:Slc5a9 APN 4 111893690 intron probably benign
IGL01556:Slc5a9 APN 4 111898636 missense probably benign 0.00
IGL01807:Slc5a9 APN 4 111877540 makesense probably null
IGL01816:Slc5a9 APN 4 111898614 missense probably damaging 1.00
IGL02066:Slc5a9 APN 4 111887522 missense probably damaging 1.00
IGL02370:Slc5a9 APN 4 111877629 missense probably benign 0.01
IGL02491:Slc5a9 APN 4 111896352 missense probably damaging 0.99
IGL02971:Slc5a9 APN 4 111890300 missense possibly damaging 0.58
IGL03008:Slc5a9 APN 4 111890941 missense probably benign 0.14
R0365:Slc5a9 UTSW 4 111891836 nonsense probably null
R0559:Slc5a9 UTSW 4 111885582 missense probably benign 0.02
R0659:Slc5a9 UTSW 4 111883871 missense possibly damaging 0.82
R1454:Slc5a9 UTSW 4 111883964 missense probably benign 0.04
R2006:Slc5a9 UTSW 4 111880226 missense probably benign
R2014:Slc5a9 UTSW 4 111896349 missense possibly damaging 0.76
R2076:Slc5a9 UTSW 4 111885573 missense possibly damaging 0.76
R2152:Slc5a9 UTSW 4 111893223 missense possibly damaging 0.76
R3156:Slc5a9 UTSW 4 111890224 missense possibly damaging 0.80
R4566:Slc5a9 UTSW 4 111891744 intron probably null
R4568:Slc5a9 UTSW 4 111891744 intron probably null
R4579:Slc5a9 UTSW 4 111893187 missense probably damaging 1.00
R4656:Slc5a9 UTSW 4 111891744 intron probably null
R4657:Slc5a9 UTSW 4 111891744 intron probably null
R4700:Slc5a9 UTSW 4 111890937 missense possibly damaging 0.64
R4889:Slc5a9 UTSW 4 111891744 intron probably null
R4891:Slc5a9 UTSW 4 111891744 intron probably null
R4911:Slc5a9 UTSW 4 111891744 intron probably null
R4948:Slc5a9 UTSW 4 111891744 intron probably null
R4953:Slc5a9 UTSW 4 111891744 intron probably null
R5222:Slc5a9 UTSW 4 111898611 missense possibly damaging 0.55
R5376:Slc5a9 UTSW 4 111893217 missense possibly damaging 0.80
R5502:Slc5a9 UTSW 4 111893169 nonsense probably null
R5851:Slc5a9 UTSW 4 111885600 missense probably benign
R6030:Slc5a9 UTSW 4 111885528 missense possibly damaging 0.64
R6030:Slc5a9 UTSW 4 111885528 missense possibly damaging 0.64
R6125:Slc5a9 UTSW 4 111883805 missense probably damaging 1.00
R6326:Slc5a9 UTSW 4 111880253 missense probably benign
R6438:Slc5a9 UTSW 4 111891825 missense probably benign 0.00
R7105:Slc5a9 UTSW 4 111898695 missense probably benign
R7166:Slc5a9 UTSW 4 111883839 missense probably benign 0.04
R7489:Slc5a9 UTSW 4 111883916 missense probably damaging 1.00
R7599:Slc5a9 UTSW 4 111877740 missense probably benign
R7662:Slc5a9 UTSW 4 111877540 makesense probably null
R7762:Slc5a9 UTSW 4 111890174 missense probably damaging 0.99
X0012:Slc5a9 UTSW 4 111893314 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATATGTACTGGGTCAGAGCGGG -3'
(R):5'- CGGGCCATTTCTCATACCAC -3'

Sequencing Primer
(F):5'- TAGCTTAGTGCAGGTGAGCCC -3'
(R):5'- TCTCCCACAGGCTTTCAGGAG -3'
Posted On2014-08-25