Incidental Mutation 'R2024:Rhbdl2'
ID220245
Institutional Source Beutler Lab
Gene Symbol Rhbdl2
Ensembl Gene ENSMUSG00000043333
Gene Namerhomboid like 2
Synonyms
MMRRC Submission 040033-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2024 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location123787874-123829904 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 123826872 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 234 (R234S)
Ref Sequence ENSEMBL: ENSMUSP00000101810 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053202] [ENSMUST00000106204]
Predicted Effect probably damaging
Transcript: ENSMUST00000053202
AA Change: R234S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000054546
Gene: ENSMUSG00000043333
AA Change: R234S

DomainStartEndE-ValueType
low complexity region 17 36 N/A INTRINSIC
transmembrane domain 68 90 N/A INTRINSIC
Pfam:Rhomboid 113 268 7.1e-39 PFAM
transmembrane domain 277 299 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106204
AA Change: R234S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000101810
Gene: ENSMUSG00000043333
AA Change: R234S

DomainStartEndE-ValueType
low complexity region 17 36 N/A INTRINSIC
transmembrane domain 68 90 N/A INTRINSIC
Pfam:Rhomboid 113 268 1.8e-38 PFAM
transmembrane domain 277 299 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 90.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the rhomboid family of integral membrane proteins. This family contains proteins that are related to Drosophila rhomboid protein. Members of this family are found in both prokaryotes and eukaryotes and are thought to function as intramembrane serine proteases. The encoded protein is thought to release soluble growth factors by proteolytic cleavage of certain membrane-bound substrates, including ephrin B2 and ephrin B3. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2015]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arid2 A G 15: 96,361,799 D280G probably damaging Het
Azi2 C T 9: 118,049,322 R77* probably null Het
Chd8 T C 14: 52,231,493 D556G probably benign Het
Cit T C 5: 115,947,924 M849T probably damaging Het
Cit T C 5: 116,005,840 S1923P probably damaging Het
Col17a1 T A 19: 47,650,746 H1120L probably benign Het
Col6a5 G T 9: 105,936,994 H606Q unknown Het
Dnajc2 A C 5: 21,776,790 H45Q probably damaging Het
Dpp6 A G 5: 27,709,459 D514G possibly damaging Het
Dync2h1 A G 9: 7,129,062 S1818P probably damaging Het
Efemp1 A T 11: 28,914,696 Y250F possibly damaging Het
Emc1 G A 4: 139,360,946 E342K possibly damaging Het
Fam214a A G 9: 75,010,390 D757G probably damaging Het
Fam3c T C 6: 22,329,593 D45G probably benign Het
Fchsd2 A C 7: 101,198,533 D210A possibly damaging Het
Flg T A 3: 93,279,415 M58K probably damaging Het
Gabra5 G A 7: 57,488,950 R117C probably damaging Het
Gm6741 G A 17: 91,236,881 S24N probably benign Het
Grin2a T C 16: 9,644,243 D675G possibly damaging Het
Hectd4 T G 5: 121,281,918 V642G possibly damaging Het
Herc6 C T 6: 57,583,332 T119M probably benign Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Hmgcs2 T C 3: 98,299,214 S371P probably damaging Het
Idua C T 5: 108,680,734 A271V probably damaging Het
Inpp5d T A 1: 87,695,350 C125* probably null Het
Krt14 C T 11: 100,207,218 G80R unknown Het
Lama5 T C 2: 180,179,130 Y3176C probably benign Het
Lce1k C T 3: 92,806,502 C125Y unknown Het
Lig4 A T 8: 9,972,436 L448Q probably damaging Het
Macf1 C T 4: 123,371,918 A4821T probably damaging Het
Meioc C T 11: 102,675,358 A600V probably benign Het
Mepe T C 5: 104,327,091 S13P possibly damaging Het
Mms22l A G 4: 24,588,365 Y999C probably damaging Het
Ncbp3 T A 11: 73,053,520 M116K possibly damaging Het
Ndufa10 A G 1: 92,439,892 Y339H probably damaging Het
Nkx3-1 T C 14: 69,190,817 I38T probably damaging Het
Nup155 A T 15: 8,157,760 H1391L probably damaging Het
Olfr1299 T A 2: 111,664,823 M199K possibly damaging Het
Padi6 T G 4: 140,728,968 I572L possibly damaging Het
Pdss2 A T 10: 43,393,875 N238I possibly damaging Het
Pkd1l2 A G 8: 117,019,533 V1906A probably benign Het
Pom121 T C 5: 135,381,550 probably benign Het
Psmd9 T C 5: 123,241,862 F115L probably damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rai1 T C 11: 60,185,589 F160L probably damaging Het
Rnase2a T A 14: 51,255,788 Y40F probably damaging Het
Setd2 T C 9: 110,549,133 V672A possibly damaging Het
Sgpp2 A G 1: 78,417,220 I287V probably benign Het
Sh3pxd2a T C 19: 47,267,264 E1033G probably benign Het
Slc5a9 G A 4: 111,890,531 T284I probably damaging Het
Slfn9 A G 11: 82,981,681 L743P probably damaging Het
Smchd1 T A 17: 71,370,928 N1473I probably benign Het
Stx1b A T 7: 127,815,403 D16E probably benign Het
Tectb T C 19: 55,181,929 F71L probably damaging Het
Tmem220 T C 11: 67,034,153 I138T possibly damaging Het
Tmtc4 T C 14: 122,921,265 N682S probably benign Het
Tnc A G 4: 63,964,621 V1921A probably damaging Het
Ubn1 T G 16: 5,064,623 L316W probably damaging Het
Vwa5a T C 9: 38,736,061 S579P probably damaging Het
Xdh A G 17: 73,921,305 L367P possibly damaging Het
Zfp280b T C 10: 76,038,494 L69S probably damaging Het
Zfp990 A C 4: 145,537,404 Y324S possibly damaging Het
Other mutations in Rhbdl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01389:Rhbdl2 APN 4 123829657 missense probably benign
IGL02111:Rhbdl2 APN 4 123822837 missense probably damaging 1.00
IGL03381:Rhbdl2 APN 4 123822817 missense possibly damaging 0.84
IGL03410:Rhbdl2 APN 4 123829670 nonsense probably null
R0039:Rhbdl2 UTSW 4 123810029 missense probably benign 0.02
R1292:Rhbdl2 UTSW 4 123829642 missense possibly damaging 0.69
R2120:Rhbdl2 UTSW 4 123824919 missense probably damaging 1.00
R4364:Rhbdl2 UTSW 4 123809935 start codon destroyed probably null 0.87
R4366:Rhbdl2 UTSW 4 123809935 start codon destroyed probably null 0.87
R4413:Rhbdl2 UTSW 4 123810087 missense probably benign 0.04
R4749:Rhbdl2 UTSW 4 123826901 critical splice donor site probably null
R5069:Rhbdl2 UTSW 4 123817917 nonsense probably null
R5303:Rhbdl2 UTSW 4 123810221 intron probably benign
R5951:Rhbdl2 UTSW 4 123814327 missense probably benign 0.00
R7147:Rhbdl2 UTSW 4 123810115 missense probably damaging 1.00
R7171:Rhbdl2 UTSW 4 123814256 missense possibly damaging 0.95
R7337:Rhbdl2 UTSW 4 123817866 missense possibly damaging 0.91
R7374:Rhbdl2 UTSW 4 123817865 missense probably benign 0.01
R7411:Rhbdl2 UTSW 4 123829642 missense possibly damaging 0.69
R7718:Rhbdl2 UTSW 4 123824919 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTCTTATGAGAACTAATGAATCGATG -3'
(R):5'- GAGTTGTAATCTCTATTTGATATCCCC -3'

Sequencing Primer
(F):5'- CTAATGAATCGATGGAGGGAAAACTC -3'
(R):5'- GTCTCAGCAGGTAAAAGTTCTTGCC -3'
Posted On2014-08-25