Incidental Mutation 'R2024:Emc1'
ID220247
Institutional Source Beutler Lab
Gene Symbol Emc1
Ensembl Gene ENSMUSG00000078517
Gene NameER membrane protein complex subunit 1
SynonymsC230096C10Rik
MMRRC Submission 040033-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.962) question?
Stock #R2024 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location139352587-139378730 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 139360946 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 342 (E342K)
Ref Sequence ENSEMBL: ENSMUSP00000137103 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042096] [ENSMUST00000082262] [ENSMUST00000147999] [ENSMUST00000155700] [ENSMUST00000179784]
Predicted Effect possibly damaging
Transcript: ENSMUST00000042096
AA Change: E342K

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000049034
Gene: ENSMUSG00000078517
AA Change: E342K

DomainStartEndE-ValueType
Pfam:PQQ_2 21 258 5.3e-9 PFAM
Pfam:DUF1620 787 993 1.1e-66 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000082262
AA Change: E342K

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000080888
Gene: ENSMUSG00000078517
AA Change: E342K

DomainStartEndE-ValueType
Pfam:PQQ_2 21 258 4.7e-10 PFAM
Pfam:DUF1620 791 996 1.1e-77 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147999
SMART Domains Protein: ENSMUSP00000117419
Gene: ENSMUSG00000066036

DomainStartEndE-ValueType
low complexity region 170 226 N/A INTRINSIC
low complexity region 617 629 N/A INTRINSIC
Pfam:E3_UbLigase_R4 1205 1301 4.5e-60 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000155700
AA Change: E169K

PolyPhen 2 Score 0.524 (Sensitivity: 0.88; Specificity: 0.90)
Predicted Effect possibly damaging
Transcript: ENSMUST00000179784
AA Change: E342K

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000137103
Gene: ENSMUSG00000078517
AA Change: E342K

DomainStartEndE-ValueType
Pfam:PQQ_2 21 258 5.3e-9 PFAM
Pfam:DUF1620 790 996 1.1e-66 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 90.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a single-pass type I transmembrane protein, which is a subunit of the endoplasmic reticulum membrane protein complex (EMC). Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2012]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arid2 A G 15: 96,361,799 D280G probably damaging Het
Azi2 C T 9: 118,049,322 R77* probably null Het
Chd8 T C 14: 52,231,493 D556G probably benign Het
Cit T C 5: 115,947,924 M849T probably damaging Het
Cit T C 5: 116,005,840 S1923P probably damaging Het
Col17a1 T A 19: 47,650,746 H1120L probably benign Het
Col6a5 G T 9: 105,936,994 H606Q unknown Het
Dnajc2 A C 5: 21,776,790 H45Q probably damaging Het
Dpp6 A G 5: 27,709,459 D514G possibly damaging Het
Dync2h1 A G 9: 7,129,062 S1818P probably damaging Het
Efemp1 A T 11: 28,914,696 Y250F possibly damaging Het
Fam214a A G 9: 75,010,390 D757G probably damaging Het
Fam3c T C 6: 22,329,593 D45G probably benign Het
Fchsd2 A C 7: 101,198,533 D210A possibly damaging Het
Flg T A 3: 93,279,415 M58K probably damaging Het
Gabra5 G A 7: 57,488,950 R117C probably damaging Het
Gm6741 G A 17: 91,236,881 S24N probably benign Het
Grin2a T C 16: 9,644,243 D675G possibly damaging Het
Hectd4 T G 5: 121,281,918 V642G possibly damaging Het
Herc6 C T 6: 57,583,332 T119M probably benign Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Hmgcs2 T C 3: 98,299,214 S371P probably damaging Het
Idua C T 5: 108,680,734 A271V probably damaging Het
Inpp5d T A 1: 87,695,350 C125* probably null Het
Krt14 C T 11: 100,207,218 G80R unknown Het
Lama5 T C 2: 180,179,130 Y3176C probably benign Het
Lce1k C T 3: 92,806,502 C125Y unknown Het
Lig4 A T 8: 9,972,436 L448Q probably damaging Het
Macf1 C T 4: 123,371,918 A4821T probably damaging Het
Meioc C T 11: 102,675,358 A600V probably benign Het
Mepe T C 5: 104,327,091 S13P possibly damaging Het
Mms22l A G 4: 24,588,365 Y999C probably damaging Het
Ncbp3 T A 11: 73,053,520 M116K possibly damaging Het
Ndufa10 A G 1: 92,439,892 Y339H probably damaging Het
Nkx3-1 T C 14: 69,190,817 I38T probably damaging Het
Nup155 A T 15: 8,157,760 H1391L probably damaging Het
Olfr1299 T A 2: 111,664,823 M199K possibly damaging Het
Padi6 T G 4: 140,728,968 I572L possibly damaging Het
Pdss2 A T 10: 43,393,875 N238I possibly damaging Het
Pkd1l2 A G 8: 117,019,533 V1906A probably benign Het
Pom121 T C 5: 135,381,550 probably benign Het
Psmd9 T C 5: 123,241,862 F115L probably damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rai1 T C 11: 60,185,589 F160L probably damaging Het
Rhbdl2 A T 4: 123,826,872 R234S probably damaging Het
Rnase2a T A 14: 51,255,788 Y40F probably damaging Het
Setd2 T C 9: 110,549,133 V672A possibly damaging Het
Sgpp2 A G 1: 78,417,220 I287V probably benign Het
Sh3pxd2a T C 19: 47,267,264 E1033G probably benign Het
Slc5a9 G A 4: 111,890,531 T284I probably damaging Het
Slfn9 A G 11: 82,981,681 L743P probably damaging Het
Smchd1 T A 17: 71,370,928 N1473I probably benign Het
Stx1b A T 7: 127,815,403 D16E probably benign Het
Tectb T C 19: 55,181,929 F71L probably damaging Het
Tmem220 T C 11: 67,034,153 I138T possibly damaging Het
Tmtc4 T C 14: 122,921,265 N682S probably benign Het
Tnc A G 4: 63,964,621 V1921A probably damaging Het
Ubn1 T G 16: 5,064,623 L316W probably damaging Het
Vwa5a T C 9: 38,736,061 S579P probably damaging Het
Xdh A G 17: 73,921,305 L367P possibly damaging Het
Zfp280b T C 10: 76,038,494 L69S probably damaging Het
Zfp990 A C 4: 145,537,404 Y324S possibly damaging Het
Other mutations in Emc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Emc1 APN 4 139355082 splice site probably benign
IGL00898:Emc1 APN 4 139371630 missense probably damaging 1.00
IGL01481:Emc1 APN 4 139362099 missense probably benign 0.00
IGL02174:Emc1 APN 4 139371668 missense possibly damaging 0.95
IGL02264:Emc1 APN 4 139375464 missense probably damaging 1.00
IGL02501:Emc1 APN 4 139370984 missense probably benign 0.00
IGL02697:Emc1 APN 4 139352644 missense probably benign
IGL03355:Emc1 APN 4 139371593 splice site probably benign
IGL03386:Emc1 APN 4 139363781 critical splice donor site probably null
PIT4480001:Emc1 UTSW 4 139359277 missense possibly damaging 0.69
R0023:Emc1 UTSW 4 139371009 missense probably damaging 1.00
R0023:Emc1 UTSW 4 139371009 missense probably damaging 1.00
R0051:Emc1 UTSW 4 139375163 missense possibly damaging 0.81
R0094:Emc1 UTSW 4 139360485 missense probably damaging 0.99
R0613:Emc1 UTSW 4 139375072 splice site probably benign
R1464:Emc1 UTSW 4 139370937 missense probably damaging 0.97
R1464:Emc1 UTSW 4 139370937 missense probably damaging 0.97
R1512:Emc1 UTSW 4 139360184 splice site probably null
R1702:Emc1 UTSW 4 139375201 missense probably damaging 1.00
R1839:Emc1 UTSW 4 139360485 missense probably damaging 0.98
R1843:Emc1 UTSW 4 139375512 missense probably benign 0.02
R1850:Emc1 UTSW 4 139359373 splice site probably benign
R2196:Emc1 UTSW 4 139366530 missense probably benign 0.08
R2912:Emc1 UTSW 4 139365260 missense possibly damaging 0.51
R3696:Emc1 UTSW 4 139365386 missense possibly damaging 0.46
R3697:Emc1 UTSW 4 139365386 missense possibly damaging 0.46
R3698:Emc1 UTSW 4 139365386 missense possibly damaging 0.46
R3803:Emc1 UTSW 4 139367163 missense possibly damaging 0.91
R3923:Emc1 UTSW 4 139363185 nonsense probably null
R4738:Emc1 UTSW 4 139362202 missense possibly damaging 0.52
R4914:Emc1 UTSW 4 139375165 nonsense probably null
R5033:Emc1 UTSW 4 139371696 missense probably damaging 1.00
R5322:Emc1 UTSW 4 139354246 missense probably damaging 1.00
R5375:Emc1 UTSW 4 139366491 missense probably damaging 0.96
R5483:Emc1 UTSW 4 139375376 missense probably damaging 1.00
R5587:Emc1 UTSW 4 139362148 missense probably damaging 0.98
R5687:Emc1 UTSW 4 139375380 missense probably damaging 1.00
R5938:Emc1 UTSW 4 139357620 missense probably benign
R6056:Emc1 UTSW 4 139354222 missense possibly damaging 0.51
R6170:Emc1 UTSW 4 139366378 missense probably benign 0.01
R6174:Emc1 UTSW 4 139366531 missense probably benign 0.01
R6208:Emc1 UTSW 4 139354271 missense probably damaging 0.99
R6340:Emc1 UTSW 4 139365563 missense probably damaging 1.00
R6371:Emc1 UTSW 4 139371665 nonsense probably null
R6889:Emc1 UTSW 4 139365350 missense probably damaging 0.97
R7592:Emc1 UTSW 4 139360566 missense probably benign 0.00
R7715:Emc1 UTSW 4 139371623 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCGTGACTCTGCTTAAGAACTTC -3'
(R):5'- GGCTACATCAGGATCCTGTTCC -3'

Sequencing Primer
(F):5'- TGGAACTCACTCTGTAGACCAGG -3'
(R):5'- ACATCAGGATCCTGTTCCTATTGAGG -3'
Posted On2014-08-25